ID: 1001253927

View in Genome Browser
Species Human (GRCh38)
Location 5:170169369-170169391
Sequence TGGAGCAAACAGACTTCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001253922_1001253927 5 Left 1001253922 5:170169341-170169363 CCAGAAGGATGGAGTTCAAAGGG No data
Right 1001253927 5:170169369-170169391 TGGAGCAAACAGACTTCGGGTGG No data
1001253916_1001253927 29 Left 1001253916 5:170169317-170169339 CCCAGGGCTGATTGCCAGTCACT No data
Right 1001253927 5:170169369-170169391 TGGAGCAAACAGACTTCGGGTGG No data
1001253917_1001253927 28 Left 1001253917 5:170169318-170169340 CCAGGGCTGATTGCCAGTCACTT No data
Right 1001253927 5:170169369-170169391 TGGAGCAAACAGACTTCGGGTGG No data
1001253920_1001253927 15 Left 1001253920 5:170169331-170169353 CCAGTCACTTCCAGAAGGATGGA No data
Right 1001253927 5:170169369-170169391 TGGAGCAAACAGACTTCGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001253927 Original CRISPR TGGAGCAAACAGACTTCGGG TGG Intergenic
No off target data available for this crispr