ID: 1001255947

View in Genome Browser
Species Human (GRCh38)
Location 5:170183743-170183765
Sequence CCACTGAGTGCCCTGTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001255947_1001255957 5 Left 1001255947 5:170183743-170183765 CCTAGAAACAGGGCACTCAGTGG No data
Right 1001255957 5:170183771-170183793 AAGGTGAGCAGAGGCCAGAGGGG No data
1001255947_1001255958 17 Left 1001255947 5:170183743-170183765 CCTAGAAACAGGGCACTCAGTGG No data
Right 1001255958 5:170183783-170183805 GGCCAGAGGGGCCCAAGTGCAGG No data
1001255947_1001255951 -4 Left 1001255947 5:170183743-170183765 CCTAGAAACAGGGCACTCAGTGG No data
Right 1001255951 5:170183762-170183784 GTGGGCCCCAAGGTGAGCAGAGG No data
1001255947_1001255956 4 Left 1001255947 5:170183743-170183765 CCTAGAAACAGGGCACTCAGTGG No data
Right 1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG No data
1001255947_1001255955 3 Left 1001255947 5:170183743-170183765 CCTAGAAACAGGGCACTCAGTGG No data
Right 1001255955 5:170183769-170183791 CCAAGGTGAGCAGAGGCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001255947 Original CRISPR CCACTGAGTGCCCTGTTTCT AGG (reversed) Intergenic
No off target data available for this crispr