ID: 1001255956

View in Genome Browser
Species Human (GRCh38)
Location 5:170183770-170183792
Sequence CAAGGTGAGCAGAGGCCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001255947_1001255956 4 Left 1001255947 5:170183743-170183765 CCTAGAAACAGGGCACTCAGTGG No data
Right 1001255956 5:170183770-170183792 CAAGGTGAGCAGAGGCCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001255956 Original CRISPR CAAGGTGAGCAGAGGCCAGA GGG Intergenic
No off target data available for this crispr