ID: 1001260363

View in Genome Browser
Species Human (GRCh38)
Location 5:170223208-170223230
Sequence GTCCCTAAGCCTAGGTTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001260363_1001260365 -7 Left 1001260363 5:170223208-170223230 CCTGAGAACCTAGGCTTAGGGAC No data
Right 1001260365 5:170223224-170223246 TAGGGACACTTTTTGTGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001260363 Original CRISPR GTCCCTAAGCCTAGGTTCTC AGG (reversed) Intergenic
No off target data available for this crispr