ID: 1001264896

View in Genome Browser
Species Human (GRCh38)
Location 5:170267039-170267061
Sequence TGGGTTCTTCGTGGTTGGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 170}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001264889_1001264896 19 Left 1001264889 5:170266997-170267019 CCTTGTACTCACGCTTTGCCGTT 0: 1
1: 0
2: 0
3: 0
4: 43
Right 1001264896 5:170267039-170267061 TGGGTTCTTCGTGGTTGGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 170
1001264891_1001264896 1 Left 1001264891 5:170267015-170267037 CCGTTTTGTGGTTTCTGCTTCTG 0: 1
1: 0
2: 5
3: 60
4: 619
Right 1001264896 5:170267039-170267061 TGGGTTCTTCGTGGTTGGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 170
1001264888_1001264896 20 Left 1001264888 5:170266996-170267018 CCCTTGTACTCACGCTTTGCCGT 0: 1
1: 0
2: 0
3: 3
4: 44
Right 1001264896 5:170267039-170267061 TGGGTTCTTCGTGGTTGGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 170

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001264896 Original CRISPR TGGGTTCTTCGTGGTTGGTC TGG Exonic