ID: 1001266432

View in Genome Browser
Species Human (GRCh38)
Location 5:170277840-170277862
Sequence AAGAGGAAAGAGAAGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6835
Summary {0: 1, 1: 7, 2: 110, 3: 985, 4: 5732}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001266427_1001266432 27 Left 1001266427 5:170277790-170277812 CCTCATTAGAGCAATGGGATAAA 0: 1
1: 0
2: 1
3: 13
4: 159
Right 1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG 0: 1
1: 7
2: 110
3: 985
4: 5732

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001266432 Original CRISPR AAGAGGAAAGAGAAGGAGGA AGG Intronic
Too many off-targets to display for this crispr