ID: 1001274453

View in Genome Browser
Species Human (GRCh38)
Location 5:170340261-170340283
Sequence TAGAAAGAGGAGAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001274453_1001274462 25 Left 1001274453 5:170340261-170340283 CCAGCCTCCCTCTCCTCTTTCTA No data
Right 1001274462 5:170340309-170340331 CCGACAGCTGTTGTTTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001274453 Original CRISPR TAGAAAGAGGAGAGGGAGGC TGG (reversed) Intergenic
No off target data available for this crispr