ID: 1001276603

View in Genome Browser
Species Human (GRCh38)
Location 5:170355792-170355814
Sequence GACACAGAAGGGACTCCGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 981
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 923}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001276594_1001276603 17 Left 1001276594 5:170355752-170355774 CCCTCTCTCTGCTCAGAATCCCA 0: 1
1: 0
2: 3
3: 47
4: 496
Right 1001276603 5:170355792-170355814 GACACAGAAGGGACTCCGTGGGG 0: 1
1: 0
2: 2
3: 55
4: 923
1001276596_1001276603 -2 Left 1001276596 5:170355771-170355793 CCCAGAAACTAAGATCCATGTGA 0: 1
1: 0
2: 0
3: 20
4: 179
Right 1001276603 5:170355792-170355814 GACACAGAAGGGACTCCGTGGGG 0: 1
1: 0
2: 2
3: 55
4: 923
1001276593_1001276603 20 Left 1001276593 5:170355749-170355771 CCTCCCTCTCTCTGCTCAGAATC 0: 1
1: 0
2: 2
3: 42
4: 444
Right 1001276603 5:170355792-170355814 GACACAGAAGGGACTCCGTGGGG 0: 1
1: 0
2: 2
3: 55
4: 923
1001276597_1001276603 -3 Left 1001276597 5:170355772-170355794 CCAGAAACTAAGATCCATGTGAC 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1001276603 5:170355792-170355814 GACACAGAAGGGACTCCGTGGGG 0: 1
1: 0
2: 2
3: 55
4: 923
1001276595_1001276603 16 Left 1001276595 5:170355753-170355775 CCTCTCTCTGCTCAGAATCCCAG 0: 1
1: 0
2: 2
3: 46
4: 327
Right 1001276603 5:170355792-170355814 GACACAGAAGGGACTCCGTGGGG 0: 1
1: 0
2: 2
3: 55
4: 923

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001276603 Original CRISPR GACACAGAAGGGACTCCGTG GGG Intronic
900354733 1:2254967-2254989 GACACAGAGGTGACACTGTGGGG - Intronic
900424625 1:2570548-2570570 CACAGAGAAGCGACTGCGTGAGG - Intergenic
900788141 1:4662629-4662651 GACACATAAGGGGCTTCTTGCGG - Intronic
900822747 1:4901804-4901826 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
900824951 1:4918944-4918966 GCCCCAGTAGGGACTCTGTGCGG + Intergenic
901124656 1:6920536-6920558 GCCCCAGTAGGGACTCTGTGTGG + Intronic
901171142 1:7258519-7258541 CACACAGCAGGGACTGAGTGAGG + Intronic
901767365 1:11511729-11511751 GGCCCAGTAGGGACTCTGTGTGG + Intronic
902271276 1:15306886-15306908 GCCCCAGTAGGGACTCTGTGTGG - Intronic
902570619 1:17344882-17344904 GTCCCAGTAGGGACTCTGTGTGG - Intronic
903146534 1:21376288-21376310 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
903545432 1:24120915-24120937 GACACACAAGGGACTCCAGCAGG + Exonic
904386128 1:30143354-30143376 GCCCCAGAAGGGACTCTGTGTGG + Intergenic
904390343 1:30181131-30181153 CACAGAGAAGGGTCTCAGTGGGG + Intergenic
905205047 1:36338677-36338699 GACACAGAAGTGTGTCCGCGTGG + Intergenic
905524301 1:38624780-38624802 GCCACAGAAGGGCTTCCGTGGGG - Intergenic
905731008 1:40299676-40299698 GACACAGGAGGGACACAGTGGGG - Intergenic
906287390 1:44596269-44596291 GACAGAGAAGGGGCTGGGTGCGG + Intronic
906760451 1:48372615-48372637 GCCCCAGTAGGGACTCTGTGTGG + Intronic
906763958 1:48409521-48409543 GCCCCAGTAGGGACTCTGTGTGG + Intronic
907007751 1:50932708-50932730 GACCTAGCAGGGACTCTGTGTGG + Intronic
907625098 1:56022153-56022175 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
907685767 1:56609725-56609747 GTCCCAGTAGGGACTCTGTGTGG + Intronic
907890959 1:58636069-58636091 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
908047315 1:60184704-60184726 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
908426873 1:64016016-64016038 GAAACAGAAGGGAGTTGGTGGGG - Intronic
908624760 1:66028021-66028043 GCCCCAGTAGGGACTCTGTGTGG + Intronic
908627210 1:66058420-66058442 GCCCCAGTAGGGACTCTGTGTGG + Intronic
908699337 1:66881218-66881240 GCCCCAGTAGGGACTCTGTGTGG - Intronic
908911163 1:69073364-69073386 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
909057056 1:70833779-70833801 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
909057984 1:70845261-70845283 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
909065545 1:70931409-70931431 GCCCCAGTAGGGACTCTGTGTGG + Intronic
909096134 1:71291080-71291102 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
909105217 1:71398182-71398204 GTCCCAGTAGGGACTCTGTGTGG - Exonic
909192625 1:72573214-72573236 GGCACAGTGGGGACTCTGTGTGG - Intergenic
909271564 1:73628929-73628951 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
909632905 1:77785911-77785933 GCCCCAGTAGGGACTCTGTGTGG + Intronic
909710822 1:78647359-78647381 GCCCCAGAGGGGACTCTGTGTGG + Intergenic
910083548 1:83371658-83371680 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
910233189 1:85007903-85007925 GCCCCAGTAGGGACTCTGTGTGG + Intronic
910774500 1:90861765-90861787 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
911500543 1:98679964-98679986 GCCCCAGTAGGGACTCTGTGTGG + Intronic
911741055 1:101387134-101387156 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
911840471 1:102675622-102675644 GCCCCAGTAGGGACTGCGTGGGG + Intergenic
911855688 1:102872302-102872324 GCCCCAGCAGGGACTCTGTGTGG + Intergenic
911880840 1:103236560-103236582 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
911985451 1:104616662-104616684 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
912004366 1:104878677-104878699 GCCACAGTAGTGACTCTGTGTGG - Intergenic
912579111 1:110704434-110704456 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
912610160 1:111034504-111034526 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
913709970 1:121473076-121473098 GTCCCAGCAGGGACTCTGTGGGG + Intergenic
915710912 1:157897114-157897136 GCCCCAGTAGGGACTCTGTGGGG + Intronic
915752401 1:158223971-158223993 GCCCCAGAAGAGACTCTGTGGGG - Intergenic
915828339 1:159102413-159102435 GCCCCAGTAGGGACTCTGTGTGG - Intronic
916035888 1:160922187-160922209 GCCACAGTGGGGACTCTGTGTGG - Intergenic
916370864 1:164092812-164092834 GCCACAGTAGGGACTCTGTGTGG + Intergenic
916411477 1:164551090-164551112 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
916466640 1:165079998-165080020 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
916477414 1:165183480-165183502 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
916618761 1:166472957-166472979 GCCCCAGGAGGGACTCTGTGTGG + Intergenic
917097098 1:171409568-171409590 GACACAGAAGGGATACCTTAAGG + Intergenic
917230212 1:172828394-172828416 GAAACAGATGGGAATCAGTGAGG + Intergenic
918049161 1:180959443-180959465 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
919175187 1:194010598-194010620 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
919291902 1:195643544-195643566 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
919409664 1:197227737-197227759 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
919460523 1:197871917-197871939 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
919554270 1:199031505-199031527 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
920895903 1:210049221-210049243 GCCCCAGTAGGGACTCTGTGTGG + Intronic
921000614 1:211039395-211039417 GCCCCAGTAGGGACTCTGTGTGG - Intronic
921594318 1:217038166-217038188 GCCCCAGAAGGGACTCTGTGTGG + Intronic
921610428 1:217206746-217206768 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
921763204 1:218940716-218940738 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
921792743 1:219308846-219308868 GCCCCAGCAGGGACTCTGTGTGG - Intergenic
922058370 1:222063595-222063617 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
922530497 1:226341478-226341500 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
923297862 1:232612280-232612302 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
923687410 1:236162888-236162910 GCCCCAGTAGGGACTCTGTGTGG - Intronic
923919311 1:238545969-238545991 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
923997005 1:239506630-239506652 GCCCCAGTAGGGACTCTGTGTGG - Intronic
924040540 1:239980000-239980022 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
924050848 1:240078383-240078405 GCCCCAGTAGGGACTCTGTGTGG - Intronic
924152405 1:241142299-241142321 GCCCCAGTAGGGACTCTGTGTGG + Intronic
924792941 1:247269848-247269870 GACCCAGAGGGGACTCTGTGTGG + Intergenic
924806623 1:247366595-247366617 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
924936817 1:248778745-248778767 GCCACAGTAGGAACTCTGTGTGG + Intergenic
1062932858 10:1363972-1363994 GGCACAGCAGGCACTCCCTGAGG + Intronic
1063161346 10:3421018-3421040 GACACAGCAGGGACTCAGGTAGG + Intergenic
1063481467 10:6380345-6380367 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1063549512 10:7016795-7016817 GACACAGATGGGACTTCTTTGGG - Intergenic
1064956977 10:20922239-20922261 GACACAGAGAGGAGTCAGTGAGG - Intronic
1065534251 10:26701740-26701762 GCCCCAGCAGGGACTCCGTGTGG - Intronic
1066040739 10:31546152-31546174 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1066098783 10:32098420-32098442 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
1066451892 10:35537354-35537376 GCCCCAGCAGGGACTCTGTGTGG - Intronic
1067814727 10:49464950-49464972 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1067956306 10:50795249-50795271 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1068163181 10:53293914-53293936 GCCCCAGTAGGGACTCTGTGCGG - Intergenic
1068235421 10:54227131-54227153 GCCCCAGTAGGGACTCAGTGTGG + Intronic
1068312203 10:55292948-55292970 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1068676802 10:59777499-59777521 GCCCCAGGAGGGACTCTGTGTGG + Intergenic
1069070048 10:63983501-63983523 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1069145710 10:64890130-64890152 GCAACAGAGTGGACTCCGTGTGG - Intergenic
1069173576 10:65262617-65262639 GCCATAGAAGGGACTCTGTGTGG + Intergenic
1069211001 10:65760368-65760390 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1069368030 10:67714115-67714137 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1069805222 10:71118139-71118161 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1070375988 10:75831615-75831637 GCCTCAGTAGGGACTCTGTGTGG + Intronic
1071018923 10:81029472-81029494 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1071043043 10:81337318-81337340 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1071942039 10:90601095-90601117 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1072443570 10:95478699-95478721 GAGAGAGAAGGGGCTCTGTGGGG - Intronic
1073807038 10:107109203-107109225 GCCACAGTGAGGACTCCGTGGGG + Intronic
1073841529 10:107503930-107503952 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
1073994029 10:109295204-109295226 GTCCCAGTAGGGACTCTGTGGGG - Intergenic
1074041385 10:109793174-109793196 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1074223656 10:111462400-111462422 GCTCCAGTAGGGACTCCGTGTGG - Intergenic
1074262767 10:111870562-111870584 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1074622313 10:115138327-115138349 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1074965865 10:118490282-118490304 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1075089354 10:119434787-119434809 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1075530522 10:123225272-123225294 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1075543636 10:123337165-123337187 GCCCCAGTAGGGACTCAGTGTGG + Intergenic
1075783888 10:125035083-125035105 GACACAGAAGAGACCCACTGGGG + Intronic
1075937955 10:126359805-126359827 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1076898392 10:133325291-133325313 GACCCAGGAGAGACCCCGTGGGG - Intronic
1077193364 11:1265640-1265662 GGCCCAGTAGGGACTCTGTGTGG + Intergenic
1077827492 11:5826683-5826705 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1078117332 11:8466705-8466727 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1078201695 11:9189381-9189403 GTCTCAGTAGGGACTCTGTGTGG - Intronic
1078482246 11:11687676-11687698 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1078496690 11:11824741-11824763 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1078978627 11:16506035-16506057 GCCCCAGCAGGGACTCTGTGTGG - Intronic
1079143873 11:17833476-17833498 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1079519171 11:21304434-21304456 GACACAGAAGTGATGCAGTGGGG + Intronic
1079949548 11:26784492-26784514 GCCTCAGTGGGGACTCCGTGTGG - Intergenic
1080153399 11:29078870-29078892 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1080717557 11:34818794-34818816 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1080959835 11:37145659-37145681 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1081008123 11:37773880-37773902 GCCCCAGCAGGGACTCTGTGTGG + Intergenic
1081120154 11:39256290-39256312 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1081598744 11:44477223-44477245 GCCCCAGCAGGGACTCTGTGTGG - Intergenic
1081771358 11:45652150-45652172 GACACAGAAGGGAAGGAGTGGGG - Intronic
1081939466 11:46928466-46928488 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1082074161 11:47963343-47963365 GACACAGCAGGGACTCCCCAAGG - Intergenic
1082268326 11:50143115-50143137 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1082287747 11:50335400-50335422 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1083065220 11:59916829-59916851 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1083121842 11:60520810-60520832 GCCTCAGTAGGGACTCTGTGTGG + Intronic
1084650901 11:70488646-70488668 GACCCAGAAGGGGCTCACTGAGG - Intronic
1085225922 11:74921181-74921203 AACACAGAATGGACTCCAGGAGG + Intronic
1085588242 11:77731931-77731953 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1085651562 11:78273154-78273176 GCCCCAGAAGGGACTCTGTGTGG - Intronic
1085861850 11:80244391-80244413 GCCCCAGGAGGGACTCTGTGTGG - Intergenic
1085906868 11:80774519-80774541 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1086309356 11:85519129-85519151 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1086580331 11:88391712-88391734 GACCCAGTAGGGACTCTGTCTGG + Intergenic
1086826709 11:91507745-91507767 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1086995707 11:93353494-93353516 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1087171513 11:95054080-95054102 TACCCAGTGGGGACTCCGTGTGG - Intergenic
1087511569 11:99101872-99101894 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1087541928 11:99531953-99531975 GCCCCAGAAGGGACTCTGTGTGG - Intronic
1087877501 11:103375353-103375375 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1087963116 11:104376786-104376808 GACACAGAAGAAACTCAGTCTGG - Intergenic
1088377630 11:109159619-109159641 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
1089312134 11:117565615-117565637 CACACAGAAGGGGCTCCATGTGG + Intronic
1090355964 11:126140519-126140541 GACACAGAAGGGTCTCAGCTGGG + Intergenic
1090504669 11:127298277-127298299 GCCCCAGAAGGGACTCTGGGTGG - Intergenic
1090727356 11:129539873-129539895 GCCCCAGTAGGGACTCCGTGCGG + Intergenic
1091255225 11:134178248-134178270 GGCACAGAACAGACTTCGTGGGG + Intronic
1091266438 11:134275778-134275800 GACACAGAGAGGAGTCCGGGAGG - Intronic
1092093579 12:5823719-5823741 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1092471604 12:8786625-8786647 GCCCCAGAAGGGACTCCATGTGG + Intergenic
1092662639 12:10755395-10755417 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
1094295289 12:28898620-28898642 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1094798442 12:34002346-34002368 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
1095345850 12:41148078-41148100 GACCCAGTGGGGACTCTGTGTGG + Intergenic
1095928785 12:47605737-47605759 GCCCCAGCAGGGACTCCATGTGG + Intergenic
1096775804 12:53963369-53963391 GACACTGAACGGACTCTGTTTGG + Intergenic
1097329575 12:58318532-58318554 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1097481060 12:60126426-60126448 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1097570500 12:61325967-61325989 GCCCCAGCAGGGACTCTGTGTGG + Intergenic
1097609944 12:61807495-61807517 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1098108981 12:67101876-67101898 GACACAGAAGGGCTTGAGTGGGG + Intergenic
1098163861 12:67673364-67673386 GCCACAGTAGGTACTCTGTGTGG + Intergenic
1098686185 12:73424367-73424389 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1098836404 12:75429045-75429067 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1098926859 12:76360552-76360574 GCCCCAGTAGGGACTCTGTGGGG + Intronic
1099004128 12:77216723-77216745 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1099294381 12:80811877-80811899 GTCACAGAATGGACTGTGTGGGG + Intronic
1099396540 12:82147263-82147285 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1099501482 12:83419176-83419198 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1099507797 12:83500415-83500437 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1099655049 12:85479098-85479120 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1099668473 12:85660268-85660290 GCCCCAGAAGGGACTCTGTGTGG - Intergenic
1099674633 12:85742917-85742939 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1099846139 12:88031014-88031036 GCCCCAGGAGGGACTCTGTGTGG + Intronic
1099858966 12:88205209-88205231 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1100054385 12:90491152-90491174 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1100898817 12:99215356-99215378 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1101113285 12:101506943-101506965 GCCCCAGTAGGGACTCTGTGGGG - Intergenic
1101117793 12:101549125-101549147 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1101257932 12:102998060-102998082 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1101663535 12:106788416-106788438 GCCCCAGTAGGGACTCCGTGTGG + Intronic
1102148746 12:110673912-110673934 ACCCCAGAAGGGACTCAGTGTGG - Intronic
1102523214 12:113492326-113492348 GCCCCAGAAGGGATTCTGTGTGG - Intergenic
1102758795 12:115367187-115367209 GCCCCAGTAGGGACTCTGTGAGG - Intergenic
1104240504 12:126984684-126984706 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1106106636 13:26738795-26738817 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1106614478 13:31314197-31314219 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1106678344 13:31984880-31984902 GCCACAGTCGGGACTCTGTGTGG - Intergenic
1108542199 13:51454442-51454464 GACACAGAAGAGACACTTTGTGG + Intergenic
1108603728 13:52016820-52016842 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1108719617 13:53117724-53117746 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1108790709 13:53966465-53966487 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1109076745 13:57845748-57845770 GCCCCAGTAGGGACTCTGTGGGG + Intergenic
1109171950 13:59107785-59107807 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1109286042 13:60409301-60409323 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1109337192 13:61008223-61008245 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1109480388 13:62945050-62945072 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1109502459 13:63255630-63255652 GACCCAGTGGGGACTCTGTGTGG + Intergenic
1109512993 13:63404126-63404148 GCCCCAGCAGGGACTCAGTGTGG + Intergenic
1109614182 13:64808996-64809018 GCCACAGTAGGGACTCTGTGTGG - Intergenic
1109681321 13:65756601-65756623 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1109871818 13:68342626-68342648 GCCCCAGACGGGACTCTGTGTGG + Intergenic
1110044439 13:70810750-70810772 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1110044816 13:70814199-70814221 GCCACAGTAGGGACTCTGTGTGG - Intergenic
1110511469 13:76356006-76356028 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1110649386 13:77925727-77925749 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1110924367 13:81131808-81131830 GCCCCAGAAGGGACTCTGTGTGG - Intergenic
1111081902 13:83322044-83322066 GCCTCAGTGGGGACTCCGTGTGG + Intergenic
1111715776 13:91877208-91877230 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1111770029 13:92585085-92585107 GCCCCAGGAGGGACTCTGTGTGG - Intronic
1111889908 13:94068996-94069018 GTCCCAGTAGGGACTCTGTGTGG + Intronic
1112101826 13:96197899-96197921 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1113169408 13:107482741-107482763 TACACAGAAGGGAAACTGTGAGG + Intronic
1113252784 13:108472531-108472553 GGCCCAGTAGGGACTCTGTGTGG - Intergenic
1113501838 13:110782021-110782043 GCCACAGTGGGGACTCTGTGTGG + Intergenic
1114147419 14:19993749-19993771 GACACAGTGGGGTCTCTGTGTGG + Intergenic
1114217118 14:20665304-20665326 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1114433015 14:22678649-22678671 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1114687540 14:24548276-24548298 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1114987657 14:28250836-28250858 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1115007125 14:28499107-28499129 GTCCCAGAAGGGACTCTGTGCGG + Intergenic
1115277326 14:31622862-31622884 GCCCCAGTAGGGACTCTGTGGGG - Intronic
1115481715 14:33867519-33867541 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1115541745 14:34427465-34427487 GCCCCAGTAGGGACTCCGTGTGG - Intronic
1115989990 14:39141500-39141522 ACCCCAGTAGGGACTCCGTGAGG + Intergenic
1116420115 14:44722563-44722585 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1116756275 14:48952600-48952622 GACACAGAAGTGACTCCTTTAGG - Intergenic
1117473577 14:56071212-56071234 GACAAAGAAGGGACTCATTTAGG - Intergenic
1117751645 14:58930020-58930042 GGCCCAGTAGGGACTCTGTGTGG + Intergenic
1118069632 14:62231993-62232015 GCCACAGTAGGGACTCTGTGTGG - Intergenic
1118070921 14:62245898-62245920 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1118431876 14:65727232-65727254 GTCCCAGTAGGGACTCTGTGTGG + Intronic
1118460113 14:65979750-65979772 GCCTCAGTAGGGACTCTGTGTGG - Intronic
1118485051 14:66206802-66206824 GCCACAGGGGGGACTCTGTGTGG - Intergenic
1118533024 14:66728309-66728331 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1118657469 14:67967860-67967882 GTCCCAGAAGGGACTCTGTGTGG + Intronic
1118752843 14:68819200-68819222 CAGAGAGAAGGGACTCTGTGAGG + Intergenic
1118933476 14:70264386-70264408 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG + Intergenic
1119477443 14:74939320-74939342 GACAGGGCAGGGACTCCTTGGGG - Intergenic
1119963133 14:78882253-78882275 ACCCCAGTAGGGACTCCGTGTGG - Intronic
1120060712 14:79978936-79978958 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1120091101 14:80334167-80334189 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1120101587 14:80450899-80450921 GTCCCAGTGGGGACTCCGTGTGG - Intergenic
1120247888 14:82027587-82027609 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1120407138 14:84103908-84103930 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1120454688 14:84716673-84716695 GCCCCAGCAGGGACTCTGTGTGG - Intergenic
1120457800 14:84754675-84754697 GGCCCAGTAGGGACTCTGTGTGG - Intergenic
1120692293 14:87606101-87606123 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1120947590 14:90012682-90012704 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1121147042 14:91593231-91593253 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1122757524 14:103994081-103994103 TACACAGCAGTGACTCCCTGTGG - Intronic
1123197366 14:106629466-106629488 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1124858340 15:33412554-33412576 GACCCAGAAGAGAAACCGTGGGG - Intronic
1125273955 15:37971043-37971065 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1125279304 15:38027064-38027086 GCCCCAGGAGGGACTCTGTGTGG - Intergenic
1125724344 15:41860725-41860747 TCCACAGAAGGGGCTCCATGGGG + Exonic
1125881416 15:43199111-43199133 GCCCCAGCAGGGACTCTGTGTGG - Intronic
1126126424 15:45298295-45298317 GACCCAGTAGGGACTCTGTGGGG - Intergenic
1126411511 15:48377124-48377146 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1126497979 15:49313456-49313478 TTCACAGAAGGGACACTGTGTGG + Intronic
1126648041 15:50894665-50894687 GGCCCAGTAGGGACTCTGTGTGG - Intergenic
1127144979 15:56014531-56014553 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1127955233 15:63847381-63847403 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1128260074 15:66227211-66227233 AGCACAGCAGGGACTCAGTGAGG - Intronic
1129469483 15:75742837-75742859 GCCCCAGGAGGGACTCTGTGGGG - Intergenic
1129620212 15:77137256-77137278 GCCTCAGTAGGGACTCTGTGTGG - Intronic
1130324195 15:82865976-82865998 GCCCCAGTAGGGACTCTGTGGGG - Intronic
1130738998 15:86577980-86578002 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1130824756 15:87532689-87532711 GCCCCAGGAGGGACTCTGTGTGG + Intergenic
1130849911 15:87782782-87782804 GACATAGAAGGCACTCAGAGAGG + Intergenic
1132215679 15:100060023-100060045 GACCCAGAAAGCACTCCATGGGG + Intronic
1132634352 16:936164-936186 GAGACAGAGGGGGCACCGTGTGG + Intronic
1132638086 16:963143-963165 GACACAGAGGGGACTCGGGGTGG + Intronic
1132651395 16:1022872-1022894 GCGACAGGAAGGACTCCGTGGGG - Intergenic
1132679141 16:1132618-1132640 GACGCAGAGGGGACTCAGTGGGG + Intergenic
1133102814 16:3489503-3489525 GAGTCAGCAGGGACTCCATGTGG + Intergenic
1133258631 16:4534239-4534261 GGCACAGAAGGGGCTGGGTGCGG - Intronic
1133375476 16:5283308-5283330 GCCACAGTAGGGACTCTATGTGG - Intergenic
1134367767 16:13595183-13595205 GACACAGAAAGGTCTTTGTGAGG + Intergenic
1134476112 16:14575186-14575208 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1137981624 16:53074861-53074883 GTCCCAGTAGGGACTCTGTGTGG - Intronic
1138024727 16:53513433-53513455 GCCCCAGCAGGGACTCTGTGTGG + Intergenic
1138383853 16:56622569-56622591 GCCCCAGTAGGGACTCTGTGAGG - Intergenic
1138805648 16:60085909-60085931 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1139133893 16:64178496-64178518 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1141118277 16:81330396-81330418 CACCCAGAAGGGACTCCCAGAGG + Intronic
1141420503 16:83912298-83912320 GACCCAGCAGGGACTCCAAGGGG + Exonic
1143542025 17:7574587-7574609 CACGGAGAAGGGACTCCGAGAGG - Exonic
1144368795 17:14570380-14570402 GCCACAGTAAGGACTCTGTGGGG + Intergenic
1145358172 17:22182680-22182702 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1145753691 17:27374235-27374257 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1146451911 17:32981442-32981464 GCCCCAGTGGGGACTCCGTGTGG + Intronic
1147748237 17:42709331-42709353 GATACAGAAGGAAATCCCTGTGG - Intronic
1148644432 17:49211031-49211053 GAGACAGAAGGGGCACAGTGGGG - Intronic
1149110190 17:53019242-53019264 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
1149234065 17:54570317-54570339 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1150687409 17:67331817-67331839 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1152139217 17:78526415-78526437 GACACAGAGGGGACACCATGTGG + Intronic
1152739805 17:82013882-82013904 CACACAGAAGTGACTGTGTGAGG - Intronic
1152989441 18:349513-349535 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1153539045 18:6134891-6134913 GCCCCAGTAGGGACTCGGTGTGG + Intronic
1153685247 18:7538596-7538618 GGCCCAGTGGGGACTCCGTGTGG + Intergenic
1154313124 18:13282786-13282808 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1156583805 18:38409739-38409761 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1156817549 18:41328835-41328857 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1156904422 18:42336778-42336800 GCCTCAGCAGGGTCTCCGTGTGG + Intergenic
1156941015 18:42767089-42767111 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1157377855 18:47182556-47182578 GCCCCAGGAGGGACTCTGTGTGG - Intergenic
1158056382 18:53285618-53285640 GCCCCAGCAGGGACTCTGTGTGG - Intronic
1158071472 18:53475739-53475761 GACCCAGTAGGGACTCTGTGTGG - Intronic
1159508050 18:69360943-69360965 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1159731614 18:72034524-72034546 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1159767652 18:72509672-72509694 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1159838838 18:73372837-73372859 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1162296206 19:9815488-9815510 GACCCAATAGGGACTCTGTGTGG + Intronic
1165366495 19:35370735-35370757 GTGACAGACTGGACTCCGTGAGG - Intergenic
1165888360 19:39095662-39095684 AACCCAGTAGGGACTCTGTGTGG + Intronic
1166410066 19:42550744-42550766 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1166631482 19:44411215-44411237 GACACAGAGGAGAGTCCCTGAGG - Intergenic
1168348913 19:55664648-55664670 GACACAGATGTGCCTCCGTCTGG - Intronic
925087206 2:1117533-1117555 GCCACACACAGGACTCCGTGAGG - Intronic
925805129 2:7641117-7641139 GGCCCAGTAGGGACTCTGTGTGG + Intergenic
926448488 2:12973367-12973389 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
926465056 2:13177342-13177364 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
926816683 2:16804697-16804719 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
926939350 2:18118564-18118586 GCCAAAGTAGGGACTCTGTGTGG - Intronic
926947465 2:18203697-18203719 GCCCCAGTAGGGACTCTGTGTGG - Intronic
927136592 2:20101163-20101185 GAAACAGAAGGGAACCAGTGTGG - Intergenic
927329150 2:21841907-21841929 GGCCCAGAGGGGACTCTGTGTGG - Intergenic
927360228 2:22224017-22224039 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
927641118 2:24846152-24846174 GGCCCAGTAGGGACTCTGTGTGG - Intronic
928465608 2:31519835-31519857 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
928582796 2:32725729-32725751 GCCTCAGTAGGGACTCTGTGTGG + Intronic
928812700 2:35248394-35248416 GCCCCAGTAGGGACTCTGTGGGG + Intergenic
928927328 2:36593323-36593345 GCCCCAGTAGGGACTCTGTGTGG + Intronic
929415300 2:41741178-41741200 GAGACAGATGGGACACTGTGAGG - Intergenic
929528790 2:42732133-42732155 GCCCCAGTAGGGACTCTGTGTGG + Intronic
930006805 2:46904284-46904306 GCCCCAGTAGGGACTCTGTGTGG - Exonic
930076178 2:47407422-47407444 GCCCCAGTAGGGACTCTGTGGGG - Intronic
930310340 2:49732117-49732139 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
931033478 2:58211060-58211082 GCCTCAGTAGGGACTCTGTGTGG + Intronic
931734700 2:65182996-65183018 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
932524024 2:72444456-72444478 GCCCCAGTAGGGACTCTGTGTGG + Intronic
932537694 2:72617341-72617363 GTCCCAGTAGGGACTCTGTGTGG + Intronic
932552449 2:72785363-72785385 GCCCCAGTAGGGACTCTGTGTGG + Intronic
932606759 2:73170503-73170525 CACACAGTAGGGGCTCCATGGGG + Intergenic
932821604 2:74906296-74906318 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
932904382 2:75733740-75733762 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
932912250 2:75818208-75818230 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
933047615 2:77558391-77558413 GCCCCAGTAGGGACTCTGTGTGG - Intronic
933268108 2:80203755-80203777 GCCCCAGTAGGGACTCTGTGTGG + Intronic
933423931 2:82086486-82086508 GCCCCAGTAGGGACTCCTTGTGG + Intergenic
933790790 2:85882268-85882290 GCCCCAGTAGGGACTCTGTGTGG - Intronic
933925669 2:87089939-87089961 CACACAGTAGGGGCTCCATGAGG - Intergenic
933966721 2:87435978-87436000 GACACAGAAGTGACAAGGTGGGG - Intergenic
934610547 2:95732240-95732262 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
934918525 2:98321318-98321340 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
936543886 2:113373822-113373844 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
936683787 2:114804341-114804363 GACCCAGTAGGGACTCTGTGTGG - Intronic
936821819 2:116530636-116530658 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
937547117 2:123036188-123036210 GCCACAGTAGGGACTCTGTGTGG + Intergenic
938686354 2:133742060-133742082 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
939052976 2:137330251-137330273 GCCCCAGTGGGGACTCCGTGTGG - Intronic
939137597 2:138315486-138315508 GCCCCAGGAGGGACTCTGTGTGG + Intergenic
939190587 2:138912585-138912607 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
939287672 2:140154131-140154153 GCCACAGTAGGGACTCTGTGTGG + Intergenic
939334224 2:140804122-140804144 GAAACAGAAGAGACTCCTTAAGG + Intronic
939559251 2:143714027-143714049 GCCCCAGAAGGGACTCTGTGTGG + Intronic
939583769 2:143982762-143982784 GACACAGGAGAACCTCCGTGTGG + Intronic
939667523 2:144969419-144969441 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
939694918 2:145312126-145312148 GACCCAGTAGGGACTCTGCGTGG + Intergenic
940251779 2:151685666-151685688 GACAATGAAGGGAGTCCTTGAGG - Intronic
940381319 2:153018044-153018066 GCCCCAGTAGGGACTCCGTGTGG + Intergenic
941142779 2:161805882-161805904 GTCCCAGTAGGGACTCTGTGGGG + Intronic
941468177 2:165854836-165854858 GACACAGAATGGTGTCAGTGGGG + Intergenic
941477605 2:165968241-165968263 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
941741923 2:169044401-169044423 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
941967306 2:171312717-171312739 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
941977763 2:171424288-171424310 GTCCCAGTAGGGACTCTGTGTGG - Intronic
942054315 2:172168184-172168206 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
942062376 2:172239665-172239687 GACAGGGAAGGGACGCAGTGCGG + Intergenic
942319583 2:174724767-174724789 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
942367060 2:175239085-175239107 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
942380546 2:175386194-175386216 GCCCCAGAAGGGACTCGGTGTGG - Intergenic
942517962 2:176773302-176773324 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
942649772 2:178154546-178154568 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
942805773 2:179929832-179929854 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
942950114 2:181712396-181712418 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
943205270 2:184886478-184886500 GCCCCAGTAGGGACACCGTGTGG + Intronic
943219857 2:185090715-185090737 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
943478160 2:188385073-188385095 GCCCCAGTAGGGACTCTGTGTGG + Intronic
943483989 2:188456669-188456691 GCCCCAGTAGGGACTCTGTGTGG - Intronic
943998097 2:194797263-194797285 GCCCCAGCAGGGACTCTGTGTGG - Intergenic
944010118 2:194964980-194965002 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
944011434 2:194979413-194979435 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
944250235 2:197574075-197574097 GTCCCAGTAGGGACTCCATGTGG - Intronic
945073702 2:206016006-206016028 GTCCCAGTAGGGACTCTGTGTGG - Intronic
945484791 2:210382259-210382281 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
945593917 2:211768405-211768427 GCCTCAGTAGGGACTCTGTGTGG + Intronic
946108221 2:217390833-217390855 ACCACAGTAGGGACTCTGTGTGG + Intronic
946330004 2:219003563-219003585 GGCGCAGAAGGGACTGGGTGGGG + Intronic
946757582 2:222963011-222963033 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
946760562 2:222989274-222989296 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
946930091 2:224662523-224662545 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
947248583 2:228077241-228077263 GCCCCAGTAGGGACTCTGTGGGG - Intronic
947646924 2:231749028-231749050 GCCCCAGTAGGGACTCTGTGTGG - Intronic
948504002 2:238415614-238415636 GGCACAGGAGGGGCTCTGTGTGG + Intergenic
948685869 2:239669543-239669565 GAGACAGAGGGGACTCCCTCAGG - Intergenic
1169354849 20:4897710-4897732 GACACAGAAGGGAGGGCCTGGGG - Intronic
1170037544 20:12004880-12004902 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1170643848 20:18179302-18179324 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1170703074 20:18721805-18721827 GACACAGATGGGAAGCTGTGGGG + Intronic
1170875254 20:20244231-20244253 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1172200505 20:33122791-33122813 GCCACAGTAGGGACTCTGTGTGG - Intergenic
1172397231 20:34617178-34617200 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1173263910 20:41460783-41460805 GACCAAGTAGGGACTCTGTGTGG - Intronic
1173711067 20:45156120-45156142 GACCCAGTGGGGACTCTGTGTGG - Intergenic
1174951064 20:55041860-55041882 GCCCCAGTAGGGACTCAGTGAGG - Intergenic
1175008522 20:55710989-55711011 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1175010126 20:55726398-55726420 GACACTGAGGGGACACAGTGGGG + Intergenic
1175026424 20:55907354-55907376 GAGTCAGAAGGGGCTCCTTGTGG - Intergenic
1175760971 20:61562065-61562087 GAGAGAGAGGGGCCTCCGTGTGG + Intronic
1176358642 21:5973960-5973982 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1176704378 21:10101080-10101102 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1177067973 21:16464206-16464228 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1177139719 21:17344889-17344911 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1177188620 21:17824768-17824790 ATCACAGAGGGGACTCTGTGTGG + Intergenic
1177259617 21:18712839-18712861 GCCCCAGAGGGGACTCTGTGTGG - Intergenic
1177317425 21:19479275-19479297 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1177339744 21:19783777-19783799 GCCCCAGTAGGGACTCCGTGTGG + Intergenic
1177393169 21:20502163-20502185 GCCCCAGTAGGGACTCAGTGTGG + Intergenic
1177408357 21:20699163-20699185 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1177485063 21:21746183-21746205 GCCCCAGTAGGGACTCCGTGTGG - Intergenic
1177529061 21:22337056-22337078 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1177699247 21:24615128-24615150 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1177741161 21:25155049-25155071 GCTCCAGTAGGGACTCCGTGTGG - Intergenic
1178221858 21:30669349-30669371 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1178469000 21:32875039-32875061 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1179065160 21:38017949-38017971 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1179235283 21:39540252-39540274 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1179316390 21:40247782-40247804 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1179764876 21:43564590-43564612 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1179936707 21:44610614-44610636 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1180009008 21:45037479-45037501 AGCACAGACGGGGCTCCGTGTGG - Intergenic
1182182389 22:28363504-28363526 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1182797836 22:33004198-33004220 GCCACAGTGGGGACTCTGTGTGG - Intronic
1184157654 22:42678888-42678910 GCCCCAGTGGGGACTCCGTGTGG - Intergenic
1184311959 22:43651536-43651558 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1184713231 22:46265425-46265447 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
949292479 3:2482938-2482960 GCCACAGTGGGGACTCAGTGTGG - Intronic
949369397 3:3318264-3318286 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
949665346 3:6332136-6332158 GACCCAGTAAGGACTCTGTGTGG - Intergenic
949692357 3:6654791-6654813 GACCCAGTGGGGACTCTGTGTGG + Intergenic
949697111 3:6711101-6711123 AAAAAAGAATGGACTCCGTGTGG - Intergenic
950468529 3:13170406-13170428 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
950843225 3:15988020-15988042 GCCCCAATAGGGACTCCGTGTGG + Intergenic
950963383 3:17128882-17128904 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
951146075 3:19229260-19229282 GCCCCAGTAGGGACTCTGTGGGG + Intronic
952022497 3:29040419-29040441 GCCCCAGGAGGGACTCTGTGTGG - Intergenic
952029141 3:29120049-29120071 GACCCAGTAGGGACTCTGTGTGG - Intergenic
952105509 3:30065424-30065446 GCCCCAGCAGGGACTCTGTGTGG + Intergenic
952170240 3:30799134-30799156 GCCCCAGTAGGGACTCTGTGTGG + Intronic
952715045 3:36471945-36471967 GCCCCAGTAGGGACTCTGTGTGG + Intronic
952796539 3:37243755-37243777 GACCCAGAAGGAGCTCCGGGCGG + Intronic
953752069 3:45616553-45616575 CACACAGCAGGGACTCAGGGTGG - Intronic
954516962 3:51186978-51187000 GCCTCAGTAGGGACTCTGTGTGG - Intronic
955465227 3:59230240-59230262 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
955852496 3:63235664-63235686 GGTACAGAAGGGAGTCCATGGGG - Intronic
956169509 3:66421713-66421735 GCCGCAGTAGGGACTCTGTGTGG + Intronic
957527519 3:81396034-81396056 GTCACAGAAGAGTCTCCGTCTGG + Intergenic
957625236 3:82646774-82646796 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
957662867 3:83183889-83183911 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
957710221 3:83847671-83847693 TACACAGACGGGACTCATTGAGG + Intergenic
957945445 3:87057480-87057502 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
957987459 3:87590093-87590115 GACCCAGTGGGGACTCTGTGTGG + Intergenic
958160818 3:89815250-89815272 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
958577741 3:95974168-95974190 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
958650047 3:96926923-96926945 GCCCCAGTAGGGACTCTGTGTGG + Intronic
959004832 3:101008471-101008493 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
959319121 3:104848414-104848436 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
959439842 3:106361566-106361588 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
959624367 3:108432934-108432956 GCCCCAGCAGGGACTCTGTGTGG - Intronic
959968429 3:112381693-112381715 GGCCCAGTAGGGACTCTGTGTGG - Intergenic
959973446 3:112432171-112432193 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
960021845 3:112964219-112964241 GCCTCAGTAGGGACTCTGTGTGG - Intronic
960564380 3:119118160-119118182 GCCCCAGTAGGGACTCTGTGTGG + Intronic
961067605 3:123889748-123889770 GCCACAGTGGGGACTCTGTGTGG + Intergenic
961789336 3:129364642-129364664 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
962057372 3:131886474-131886496 GCCCCAGTAGGGACTCTGTGTGG - Intronic
962162148 3:133011541-133011563 GCCCCAGTAGGGACTCTGTGAGG + Intergenic
962369062 3:134805661-134805683 GAGTCAGAAGGGCCTCTGTGTGG - Intronic
962509511 3:136084519-136084541 GTCCCAGTAGGGACTCTGTGGGG - Intronic
962659358 3:137585691-137585713 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
963816617 3:149838326-149838348 GCCTCAGTAGGGACTCTGTGTGG + Intronic
964076655 3:152700640-152700662 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
964508587 3:157425363-157425385 GCCCCAGTAGGGACTCTGTGTGG - Intronic
964654585 3:159052254-159052276 GCCCCAGTAGGGACTCTGTGTGG - Intronic
965052033 3:163663394-163663416 GCCACAGTGGGGACTCTGTGTGG - Intergenic
965065383 3:163841127-163841149 GCCCCAGAGGGGACTCTGTGTGG + Intergenic
965146549 3:164912778-164912800 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
965404835 3:168255758-168255780 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
965857210 3:173103291-173103313 GACCCAGTAGGAACTCTGTGTGG + Intronic
965864091 3:173183522-173183544 GCCCCAGAAGGGACTCTGTGTGG - Intergenic
967154962 3:186683794-186683816 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
967462268 3:189760710-189760732 GCCCCAGTAGGGACTCTGTGTGG + Intronic
967505227 3:190245980-190246002 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
967566595 3:190980160-190980182 GGCCCAGTAGGGACTCTGTGTGG - Intergenic
967609184 3:191483409-191483431 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
967614352 3:191547208-191547230 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
967689565 3:192458221-192458243 GCCCCAGTAGGGACTCTGTGTGG - Intronic
969194659 4:5551113-5551135 GCCCCAGTAGGGACTCTGTGTGG - Intronic
969286344 4:6204729-6204751 GACACAGAAGGAAGCCCCTGTGG + Intergenic
969399970 4:6948037-6948059 CACAGAGGAGGGACTGCGTGGGG + Intronic
969622783 4:8287064-8287086 GACAGTGAAGAGCCTCCGTGGGG - Intronic
970127610 4:12832189-12832211 GCCCTAGAAGGGACTCTGTGTGG + Intergenic
970222550 4:13825549-13825571 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
970624377 4:17861120-17861142 GCCCCAGTAGGGACTCTGTGTGG + Intronic
970659188 4:18265016-18265038 GTCACAGTAGGGACTTTGTGTGG + Intergenic
970763299 4:19517209-19517231 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
971010699 4:22431158-22431180 GCCCCAGTAGGGACTCTGTGTGG - Intronic
971013966 4:22468474-22468496 GACAGAGATGGGACTCGGTGCGG + Intronic
971071972 4:23104757-23104779 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
971591362 4:28473410-28473432 GACCCAGTGGGGACTCTGTGTGG - Intergenic
971687427 4:29787344-29787366 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
972242050 4:37203950-37203972 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
972301269 4:37787644-37787666 GCCCCAGAAAGGACTCTGTGTGG - Intergenic
972370522 4:38419286-38419308 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
972413391 4:38815290-38815312 GCCACAGTGGGGACTCTGTGTGG + Intronic
972749398 4:41973383-41973405 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
972849872 4:43035653-43035675 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
972993628 4:44852414-44852436 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
973035179 4:45397111-45397133 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
973063844 4:45763370-45763392 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
973718405 4:53700279-53700301 GCCCCAGTAGGGACTCTGTGTGG + Intronic
973833763 4:54789040-54789062 GAGACAGAAGGGGCTGAGTGAGG - Intergenic
974013063 4:56624871-56624893 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
974037265 4:56827850-56827872 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
974202240 4:58656915-58656937 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
974214497 4:58827948-58827970 GTCCCAGCAGGGACTCTGTGTGG + Intergenic
974269587 4:59633302-59633324 GCCCCAGGAGGGACTCTGTGTGG + Intergenic
974271030 4:59651739-59651761 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
974322531 4:60369582-60369604 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
974394993 4:61322885-61322907 GCCCCAGTAGGGACTCTGTGTGG + Intronic
974517496 4:62936345-62936367 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
974555805 4:63446034-63446056 GCCCCAGCAGGGACTCTGTGTGG + Intergenic
974569667 4:63628297-63628319 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
974587304 4:63896149-63896171 CAACCAGTAGGGACTCCGTGTGG + Intergenic
974797128 4:66767036-66767058 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
975040417 4:69739208-69739230 GCCCCAGTAGGGACTCTGTGTGG + Intronic
975506982 4:75148647-75148669 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
976057118 4:81081595-81081617 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
976172457 4:82318231-82318253 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
976405578 4:84657989-84658011 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
976461166 4:85314410-85314432 GGCCCAGTAGGGACTCTGTGTGG + Intergenic
976672905 4:87673849-87673871 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
977014048 4:91670297-91670319 GATCCAGTAGGGACTCTGTGTGG + Intergenic
977014699 4:91678118-91678140 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
977089354 4:92651282-92651304 GCCACATCAGGGACTCAGTGTGG + Intronic
977463641 4:97356868-97356890 GTCCCAGTAGGGACTCTGTGTGG + Intronic
977512057 4:97973898-97973920 GCCCCAAAAGGGACTCTGTGTGG - Intronic
977545082 4:98367434-98367456 GCCCCAGTAGGGACTCTGTGCGG - Intronic
977592505 4:98842305-98842327 GCCCCAGGAGGGACTCTGTGTGG - Intergenic
977820988 4:101472383-101472405 GCCCCAGTAGGGACTCTGTGTGG - Intronic
978034514 4:103976727-103976749 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
978654798 4:111052329-111052351 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
978934115 4:114354821-114354843 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
978939108 4:114415685-114415707 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
979079129 4:116312093-116312115 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
979390088 4:120117844-120117866 GCCCCAGTAGGGACTCCATGTGG + Intergenic
979391874 4:120138013-120138035 GCCCCAGGAGGGACTCTGTGTGG + Intergenic
980083573 4:128369087-128369109 GCCCCAGAAAGGACTCTGTGTGG + Intergenic
980310693 4:131125941-131125963 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
980335580 4:131469117-131469139 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
980352401 4:131699528-131699550 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
980646137 4:135644372-135644394 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
981120964 4:141050879-141050901 GCCCCAGTAGGGACTCTGTGTGG + Intronic
981643063 4:146967417-146967439 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
981861522 4:149361800-149361822 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
982121225 4:152145471-152145493 GCCACAGTAGGGACTCTGTGTGG + Intergenic
982189045 4:152834803-152834825 GGCCCAGTAGGGACTCTGTGTGG + Intronic
982192972 4:152877082-152877104 GCCCCAGTAGGGACTCTGTGTGG - Intronic
982310030 4:153974932-153974954 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
982392872 4:154884790-154884812 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
982560858 4:156926860-156926882 GTCCCAGTAGGGACTCTGTGTGG + Intronic
982608096 4:157539103-157539125 GCCGCAGTAGGGACTCTGTGTGG + Intergenic
982730795 4:158953538-158953560 GCCCCAGTAGGGACTCTGTGGGG - Intronic
983020435 4:162669828-162669850 GCCACAGTGGGGACTCTGTGTGG + Intergenic
983083411 4:163414856-163414878 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
983419594 4:167500652-167500674 GCCCCAGTAGGGACTCAGTGTGG + Intergenic
983669103 4:170215412-170215434 GCCCCAGTAGGGACTCTGTGGGG - Intergenic
983723811 4:170893403-170893425 GACCCAGTAGGGATTCTGTGTGG + Intergenic
983785937 4:171729425-171729447 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
983863356 4:172735057-172735079 GCCACAGTGGGGACTCTGTGTGG - Intronic
984234753 4:177142415-177142437 GCCCCAGCAGGGACTCTGTGTGG - Intergenic
984553280 4:181185314-181185336 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
985159989 4:187034316-187034338 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
985201454 4:187489012-187489034 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
985304342 4:188522182-188522204 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
985538328 5:476493-476515 GACCCCGCAGGGACCCCGTGGGG - Intronic
985809225 5:2070800-2070822 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
986069813 5:4270746-4270768 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
986113902 5:4750472-4750494 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
986397259 5:7343293-7343315 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
986900214 5:12421930-12421952 GACCCAGTGGGGACTCTGTGTGG - Intergenic
986948000 5:13047855-13047877 GCCCCAGTAGGGACTCAGTGTGG + Intergenic
986980049 5:13437162-13437184 GATACAGGAGGAACACCGTGTGG - Intergenic
987000095 5:13651589-13651611 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
987097897 5:14566287-14566309 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
987260363 5:16196330-16196352 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
987478936 5:18428619-18428641 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
987511654 5:18847568-18847590 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
987531783 5:19130636-19130658 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
987602060 5:20084528-20084550 GACCCAGTAGGAACTCTGTGTGG + Intronic
987895634 5:23942952-23942974 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
987984930 5:25134195-25134217 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
987991528 5:25218350-25218372 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
988028183 5:25727189-25727211 GACCCAATAGGGACTCTGTGTGG + Intergenic
988149993 5:27364838-27364860 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
988335997 5:29909777-29909799 GTCCCAGTAGGGACTCTGTGAGG + Intergenic
988668912 5:33360188-33360210 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
988761106 5:34310613-34310635 GGCCCAGTAGGGACTCAGTGTGG + Intergenic
988825777 5:34932941-34932963 GACACAGAAGGGACTGCACAAGG + Intronic
988886029 5:35559000-35559022 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
989389215 5:40882812-40882834 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
989495050 5:42102198-42102220 GCCACAGTGGGGACTCTGTGTGG - Intergenic
989532592 5:42525058-42525080 GCCCCAGCAGGGACTCTGTGTGG - Intronic
989656742 5:43753279-43753301 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
989767477 5:45104088-45104110 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
989966899 5:50475376-50475398 GCCCCAGCAGGGACTCTGTGGGG - Intergenic
990309417 5:54523860-54523882 GACAGGGAAGGGTCTCCGTGTGG - Intronic
990329618 5:54713024-54713046 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
990701042 5:58475286-58475308 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
990844544 5:60122280-60122302 GCCCCAGTAGGGACTCTGTGTGG + Intronic
991009936 5:61872027-61872049 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
991104897 5:62832788-62832810 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
991183870 5:63785461-63785483 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
992375639 5:76185366-76185388 GCCACAGTGGGGACTCTGTGTGG + Intronic
992854837 5:80849373-80849395 GCCCCAGTAGGGACTCTGTGTGG + Intronic
993215849 5:85021746-85021768 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
993293837 5:86109261-86109283 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
993309722 5:86314041-86314063 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
993945945 5:94116875-94116897 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
994552816 5:101258886-101258908 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
994576516 5:101586134-101586156 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
994655934 5:102593240-102593262 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
994831262 5:104786291-104786313 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
995113543 5:108454103-108454125 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
995129315 5:108612996-108613018 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
995147805 5:108806382-108806404 GCCCCAGTAGGGACTCTGTGTGG - Intronic
995392382 5:111653309-111653331 GCCCCAGTAGGGACTCCGTGTGG + Intergenic
996177612 5:120378764-120378786 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
996196371 5:120611786-120611808 GCCCCAGTAGGGACTCTGTGTGG - Intronic
996214297 5:120848659-120848681 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
996243143 5:121227034-121227056 GCCCCAGTAGGGACTCAGTGTGG - Intergenic
996257760 5:121426485-121426507 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
996526834 5:124489071-124489093 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
997057325 5:130460052-130460074 GTCACAGTGGGGACTCTGTGTGG - Intergenic
997491987 5:134285204-134285226 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
999143391 5:149377453-149377475 AACTCAGCATGGACTCCGTGGGG + Intronic
999669343 5:153945038-153945060 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1000030467 5:157397085-157397107 GCCCCAGTAGGGACTCGGTGTGG + Intronic
1000492052 5:161926133-161926155 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1000741497 5:164974953-164974975 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1000777841 5:165442037-165442059 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1000947226 5:167437010-167437032 GCCCCAGTAGGGACTCTGTGAGG - Intronic
1001276603 5:170355792-170355814 GACACAGAAGGGACTCCGTGGGG + Intronic
1001352302 5:170980793-170980815 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1001361547 5:171091001-171091023 GTTCCAGAAGGGACTCTGTGAGG - Intronic
1001684893 5:173585992-173586014 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1003227416 6:4218762-4218784 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1003401723 6:5796220-5796242 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1003659336 6:8045431-8045453 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1005637340 6:27764843-27764865 GACGCAGAAGGGACTCCATGGGG - Intergenic
1005921752 6:30407758-30407780 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1006697173 6:35940915-35940937 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1007185945 6:39972403-39972425 GCCCCAGTAGGGACTCCATGTGG - Intergenic
1007856589 6:44864397-44864419 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1009396231 6:63203656-63203678 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1009396655 6:63207066-63207088 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1009481020 6:64157871-64157893 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1009490484 6:64284561-64284583 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1009538639 6:64924008-64924030 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1009550797 6:65089149-65089171 GCCACAGTGGGGACTCTGTGTGG - Intronic
1009804912 6:68590566-68590588 GCCCCAGTAGGGACTCTGTGCGG + Intergenic
1009825091 6:68857207-68857229 GCTACAGTAGGGACTCTGTGTGG - Intronic
1009980426 6:70720501-70720523 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1010248319 6:73682626-73682648 GACCCAGTAGGGAATCTGTGTGG + Intergenic
1010555595 6:77275190-77275212 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1010884396 6:81218293-81218315 GACTCAGTAGGGACTGTGTGTGG - Intergenic
1011088651 6:83570894-83570916 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1011122105 6:83965121-83965143 GTCCCAGTAGGGACTCTGTGAGG - Exonic
1011152495 6:84289920-84289942 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1011170972 6:84504040-84504062 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1011370323 6:86630320-86630342 AACACAGAATGGGCTCTGTGTGG - Intergenic
1011378617 6:86718758-86718780 GCCCCAGCAGGGACTCTGTGTGG + Intergenic
1011942261 6:92857302-92857324 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1012161302 6:95888623-95888645 GCCCCAGTAGGGACTCCATGTGG + Intergenic
1012195472 6:96335868-96335890 GCCACAGTGGGGACTCAGTGTGG - Intergenic
1012569101 6:100700430-100700452 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1012683242 6:102209754-102209776 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1012723884 6:102783932-102783954 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1013077045 6:106780894-106780916 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1013558735 6:111283520-111283542 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1013884454 6:114945602-114945624 GCCCCAGTAGGGACTCCGTGTGG + Intergenic
1013935396 6:115587581-115587603 GTCGCAGTAGGGACTCTGTGTGG - Intergenic
1014143583 6:117971485-117971507 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1014665376 6:124230876-124230898 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1014771820 6:125465834-125465856 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1014863209 6:126496473-126496495 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1015239632 6:131008491-131008513 GCCCCAGAGGGGACTCTGTGTGG - Intronic
1015523212 6:134151809-134151831 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1016106573 6:140171122-140171144 GCCACAGTAGGGACTCCGTGTGG + Intergenic
1016139798 6:140594520-140594542 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1016411138 6:143785563-143785585 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1016424194 6:143916419-143916441 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1016477339 6:144441671-144441693 GCCACAGTAGGGACTCTGTTTGG + Intronic
1016649570 6:146448388-146448410 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1017388011 6:153908184-153908206 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1017525359 6:155237471-155237493 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1017547512 6:155468145-155468167 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1017580486 6:155859471-155859493 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1018407719 6:163505288-163505310 GACCCAGTGGGGACTCTGTGTGG - Intronic
1018554600 6:165036576-165036598 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1018676415 6:166226231-166226253 GACAAAGAAGGGAGGCAGTGAGG + Intergenic
1018721607 6:166577249-166577271 GCCACAGTAAGGACTCTGTGTGG - Intronic
1019150398 6:170001659-170001681 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1020456018 7:8374426-8374448 GCCCCAGTAGGGACTCGGTGTGG - Intergenic
1020470144 7:8525922-8525944 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1020551034 7:9604941-9604963 GACACAAAAGGCACTCCATCAGG + Intergenic
1020611272 7:10401136-10401158 GCCCCAGTGGGGACTCCGTGTGG + Intergenic
1020631815 7:10649323-10649345 GCCCCAGTAGGGACTCAGTGTGG + Intergenic
1021036814 7:15809818-15809840 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1021646671 7:22795928-22795950 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1022352324 7:29577758-29577780 GCCACAGTGGGGACTCTGTGTGG - Intergenic
1022549741 7:31227517-31227539 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1022678421 7:32522147-32522169 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1023626008 7:42115670-42115692 CACACAGCAGGGACACAGTGGGG + Intronic
1023650494 7:42364248-42364270 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
1023682604 7:42702913-42702935 GAAACAGAAGGGCCTCAGTTTGG + Intergenic
1023786919 7:43717124-43717146 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1024137902 7:46429612-46429634 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1024291366 7:47806986-47807008 CACACAGACGGGACTCTGTCGGG + Intronic
1024383502 7:48725328-48725350 GCCCCAGAAGGAACTCTGTGTGG + Intergenic
1024416020 7:49107955-49107977 GCCCCAGTAGGGACTCCATGTGG - Intergenic
1024814879 7:53256988-53257010 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1026127761 7:67594493-67594515 GACCCAGAAAGGACCCAGTGGGG - Intergenic
1026532603 7:71212467-71212489 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1027300380 7:76827799-76827821 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1027556509 7:79670516-79670538 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1027560199 7:79719518-79719540 GCCCCAGAGGGGACTCCGTGTGG + Intergenic
1027624787 7:80532226-80532248 GCCCCAGTAGGGACTCCATGTGG - Intronic
1027626036 7:80545761-80545783 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1027834178 7:83219421-83219443 GCCCCAGTAGGGACTCTGTGGGG - Intergenic
1028126132 7:87115207-87115229 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1028189195 7:87825541-87825563 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1028493682 7:91441338-91441360 GCCCCAGAGGGGACTCTGTGTGG - Intergenic
1028624497 7:92862942-92862964 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1028738601 7:94246909-94246931 GACAAAGAAGGGATTCAGGGGGG + Intergenic
1028790195 7:94844714-94844736 GCCCCAGCAGGGACTCTGTGTGG - Intergenic
1029047500 7:97645521-97645543 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
1029435762 7:100563243-100563265 GACACAGAAGGGACTGGGGCTGG - Intronic
1029642778 7:101831690-101831712 AAGACAGAAGTGACTCTGTGGGG - Intronic
1030144655 7:106341147-106341169 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1030357295 7:108556792-108556814 GTCCCAGTAGGGACTCTGTGTGG + Intronic
1030440170 7:109579421-109579443 GACACAGCATGGCCTCCCTGGGG + Intergenic
1030559076 7:111063023-111063045 GCCCCAGTAGGGACTCTGTGGGG + Intronic
1030722360 7:112884824-112884846 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1030868783 7:114731647-114731669 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1030904257 7:115162952-115162974 CACACAGTAGGGACTCTATGTGG + Intergenic
1030970078 7:116045678-116045700 GCCCCAGGAGGGACTCTGTGTGG - Intronic
1031301641 7:120068252-120068274 GCCCCAGCAGGGACTCTGTGTGG - Intergenic
1031779032 7:125939508-125939530 GACCCAGTGGGGACTCTGTGTGG - Intergenic
1031792011 7:126118290-126118312 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1031803266 7:126275667-126275689 GCCACAAAGGGGACTCTGTGTGG + Intergenic
1032053195 7:128662619-128662641 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1032153679 7:129451331-129451353 GAGACAGAGGGAACTCCTTGAGG + Intronic
1033555960 7:142488726-142488748 GCCACAGGAGAGACTACGTGAGG - Intergenic
1034417293 7:150971850-150971872 CAGAGAGAAGGGACTCTGTGAGG + Intronic
1034750019 7:153559900-153559922 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1034751021 7:153569185-153569207 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1035104364 7:156429702-156429724 GGCACGGCAGGGACTCCTTGTGG - Intergenic
1035135401 7:156698366-156698388 GCCCCAGTAGGGACTCCGTGTGG + Intronic
1035460001 7:159032677-159032699 TACACAGAAAGGACCTCGTGTGG + Intronic
1035951793 8:4030211-4030233 GCCCCAGTAGGGACTCTGTGGGG + Intronic
1036026604 8:4915815-4915837 GTGACAGATGGGTCTCCGTGTGG - Intronic
1037975663 8:23209327-23209349 GCCCCAGTAGGGACTCCGTGTGG - Intronic
1038298997 8:26324612-26324634 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1038732343 8:30138759-30138781 GAAAGAGAAGGGACACCTTGGGG + Intronic
1039642714 8:39241376-39241398 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1040885191 8:52255167-52255189 CACACAGAATGGTCTCTGTGCGG + Intronic
1041793070 8:61717057-61717079 GACCCAGTATGGACTCTGTGTGG + Intergenic
1042073902 8:64967493-64967515 GACCCAGTAGGGACTCTGTGTGG + Intergenic
1042169798 8:65980324-65980346 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1042412544 8:68481396-68481418 GCCCCAGTAGGGACTCAGTGTGG - Intronic
1042432775 8:68727505-68727527 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1042602562 8:70512762-70512784 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
1043262518 8:78220063-78220085 GCCACAGTGGGGACTCTGTGTGG + Intergenic
1043834680 8:85033085-85033107 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1044087168 8:87955687-87955709 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1044188468 8:89284060-89284082 GCCCCAGTGGGGACTCCGTGTGG - Intergenic
1044443044 8:92243296-92243318 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1044887413 8:96794103-96794125 GCCACAGTAGGGACTCTGTGTGG + Intronic
1045139862 8:99268251-99268273 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1045214139 8:100130056-100130078 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1045423969 8:102044660-102044682 GAGTCAGAAGGGACTCAGAGAGG + Intronic
1045940042 8:107728374-107728396 GCCCCAGTAGGGACTCTGTGGGG + Intergenic
1046231496 8:111364382-111364404 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1046232333 8:111373838-111373860 GACCCAGTGGGGACTCTGTGTGG - Intergenic
1046243738 8:111532008-111532030 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1046400915 8:113702634-113702656 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
1046492231 8:114967933-114967955 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1047099590 8:121661906-121661928 GACACAGCAGTGACTGAGTGTGG - Intergenic
1047335840 8:123935295-123935317 CAAACAGAAGGGGCTCCCTGTGG - Intronic
1047535104 8:125712418-125712440 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1047628087 8:126677401-126677423 GCCACAGTAGGGACTCTATGTGG - Intergenic
1048046128 8:130775022-130775044 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1048366632 8:133744180-133744202 GAAACAGAAGAGACTCTGGGAGG - Intergenic
1048478887 8:134769654-134769676 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1048746006 8:137615701-137615723 GCCCCAGTAGGGACTCTGTGCGG + Intergenic
1048772747 8:137912831-137912853 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1048782998 8:138022038-138022060 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1049076333 8:140399251-140399273 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1050079828 9:1904481-1904503 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1050156030 9:2667119-2667141 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1051309829 9:15758043-15758065 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1051771370 9:20583436-20583458 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1051946251 9:22573145-22573167 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1051957469 9:22713393-22713415 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1051967355 9:22845080-22845102 GCCACAGTGGGGACTCTGTGTGG + Intergenic
1052351734 9:27465556-27465578 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1052846380 9:33340091-33340113 GCCCTAGTAGGGACTCCGTGTGG + Intronic
1053641638 9:40088093-40088115 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1054322526 9:63685482-63685504 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1054543113 9:66288548-66288570 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1054551292 9:66606457-66606479 GCCACAGTGGGGACTCTGTGTGG - Intergenic
1055080784 9:72266043-72266065 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1055083417 9:72290257-72290279 GTCCCAGTAGGGACTCCATGTGG + Intergenic
1055167923 9:73219420-73219442 GTCCCAGTAGGGACTCTGTGGGG - Intergenic
1055364006 9:75524981-75525003 GGCCCAGTATGGACTCCGTGTGG - Intergenic
1055595635 9:77862246-77862268 GCCCCAGGAGGGACTCTGTGTGG + Intronic
1055691102 9:78831674-78831696 GACACAGTAGGCATTCTGTGGGG + Intergenic
1055794097 9:79955466-79955488 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1056087083 9:83161104-83161126 GCCCCAGTAGGGACTCTGTGGGG - Intergenic
1056148969 9:83765421-83765443 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1056329686 9:85511141-85511163 GACACAGAGGGGCCACAGTGAGG - Intergenic
1056702002 9:88918673-88918695 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1056924360 9:90820287-90820309 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1058141177 9:101358093-101358115 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1058181757 9:101807930-101807952 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1058274598 9:103024224-103024246 GCCCCAATAGGGACTCCGTGTGG - Intergenic
1058401577 9:104625426-104625448 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1058834430 9:108848593-108848615 GCCCCAGAAGGGACTCTCTGTGG + Intergenic
1059482273 9:114600741-114600763 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1059562404 9:115347975-115347997 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1059870129 9:118563538-118563560 GCCACAACAGGGACTCAGTGAGG - Intergenic
1060178329 9:121514162-121514184 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1060311976 9:122470534-122470556 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1060348767 9:122839174-122839196 GACCCAGTGGGGACTCTGTGTGG + Intergenic
1060449412 9:123722871-123722893 GCCTCAGTAGGGACTCTGTGTGG - Intronic
1060492791 9:124097328-124097350 GACCCAGCAGGGACTCTGTGGGG + Intergenic
1061970160 9:134040527-134040549 GGCACAACAGGGACTCGGTGAGG + Intronic
1062220722 9:135413694-135413716 GAAGCAGAAGGCCCTCCGTGGGG - Intergenic
1062558533 9:137128572-137128594 GACACAAAAGGGACTCAGAAAGG + Intergenic
1062616854 9:137401112-137401134 GTCCCAGTAGGGACTCTGTGTGG + Intronic
1202789414 9_KI270719v1_random:71179-71201 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1185617706 X:1433373-1433395 GACCCAGAAGGGACCGCGCGCGG + Intronic
1185721863 X:2388685-2388707 GACAGAGGAAGGACTCTGTGAGG + Intronic
1185893665 X:3840927-3840949 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1185898780 X:3879351-3879373 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1185903897 X:3917780-3917802 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1185987956 X:4857071-4857093 GACACCATAGGGACTCCCTGAGG + Intergenic
1186165270 X:6820894-6820916 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1186742641 X:12534374-12534396 GCCCCAGTAGGGACTCTGTGGGG - Intronic
1186797622 X:13062172-13062194 GCCCCAGGAGGGACTCTGTGTGG + Intergenic
1186898287 X:14027304-14027326 GACACAGGAGGGAGGCCATGAGG - Intronic
1186954709 X:14669401-14669423 GTCTCAGTAGGGACTCTGTGTGG + Intronic
1186992473 X:15084699-15084721 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1187072328 X:15900887-15900909 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1187505505 X:19875360-19875382 CTCATAGAAGGGACTCTGTGAGG + Intronic
1187555217 X:20344787-20344809 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1188325500 X:28796812-28796834 GCCCCAGTAGGGACTCTGTGCGG + Intronic
1188753792 X:33935967-33935989 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1188804467 X:34570311-34570333 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1189087974 X:38047180-38047202 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1189228763 X:39435593-39435615 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1189253711 X:39621137-39621159 GCCCCAGAAGGGACTCTGTGTGG + Intergenic
1189371312 X:40431703-40431725 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1189637169 X:43023461-43023483 GTCCCAGTAGGGACTCTGTGAGG + Intergenic
1189788742 X:44583491-44583513 GCCACAGTGGGGACTCTGTGTGG - Intergenic
1190357254 X:49617257-49617279 GACAGAGAAGGGACCCTGGGAGG + Intergenic
1190513256 X:51195536-51195558 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1190514335 X:51207189-51207211 GGCCCAGTAGGGACTCTGTGTGG - Intergenic
1190702693 X:53000099-53000121 GACAGAGAAGGGACCCTGGGAGG + Intergenic
1191856094 X:65628184-65628206 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1191923196 X:66279178-66279200 GCCACAGTGGGGACTCTGTGTGG + Intergenic
1192054133 X:67756220-67756242 GACACAGAAGGGACACAGCTCGG - Intergenic
1192162493 X:68798916-68798938 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1192846316 X:74910073-74910095 GCCCCAGTAGGGACTCTGTGTGG - Intronic
1193175561 X:78388508-78388530 GCCACAGTGGGGACTCTGTGGGG + Intergenic
1193221204 X:78928937-78928959 GACCCAGTAGGGACTCTGTGTGG + Intergenic
1193271858 X:79537862-79537884 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1193519563 X:82512213-82512235 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1193662476 X:84274189-84274211 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1194034541 X:88854449-88854471 GACCCAGTGGGGACTCTGTGTGG - Intergenic
1194042765 X:88962464-88962486 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1194199877 X:90941484-90941506 GCCCCAGATGGGACTCTGTGTGG + Intergenic
1194294783 X:92114326-92114348 CACGGAGAAGGGACTCCGAGAGG + Intronic
1194313220 X:92340343-92340365 GCCCCAGTAGGGACTCTGTGGGG + Intronic
1194364441 X:92996539-92996561 GCCACAGTAGGGACCCTGTGTGG - Intergenic
1194473996 X:94335779-94335801 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1194496306 X:94621206-94621228 GCCCCAGTAGGGACTTCGTGTGG + Intergenic
1194503788 X:94708429-94708451 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1194525289 X:94969832-94969854 GCCCCAGAGGGGACTCTGTGTGG - Intergenic
1194566449 X:95494558-95494580 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1194625962 X:96227270-96227292 GCCTCAGTAGGGACTCTGTGTGG + Intergenic
1194756334 X:97743508-97743530 GTCCCAGTAGGGACTCTGTGTGG - Intergenic
1194838702 X:98713504-98713526 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1194855161 X:98918927-98918949 GCCACAGTGGGGACTCTGTGTGG - Intergenic
1194874923 X:99174968-99174990 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1194905971 X:99576578-99576600 GCCTCAGTGGGGACTCCGTGTGG - Intergenic
1194916495 X:99715292-99715314 GCCCCAGTAGGGACTCAGTGTGG + Intergenic
1195522735 X:105849975-105849997 GCCCCAGTAGGGACTCTGTGTGG + Intronic
1195823578 X:108972908-108972930 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1196223531 X:113139211-113139233 GCCCCAGAGGGGACTCTGTGTGG + Intergenic
1196246320 X:113404166-113404188 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1196368265 X:114947024-114947046 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1197075022 X:122343426-122343448 GTCCCAGTAGGGACTCTGTGTGG + Intergenic
1197092586 X:122556376-122556398 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1197109537 X:122756339-122756361 GCCACAGTGGGGACTCTGTGCGG + Intergenic
1197112203 X:122789622-122789644 GAAAAAGAAGGAACTCAGTGGGG - Intergenic
1197202357 X:123759280-123759302 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1197368813 X:125600654-125600676 GCCACAGTGGGGACTCTGTGTGG - Intergenic
1197379453 X:125721823-125721845 GCCACAGTAGGGACTCTGTGTGG - Intergenic
1197387700 X:125821406-125821428 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1197536200 X:127691605-127691627 GCCCCAGAGGGGACTCTGTGTGG - Intergenic
1197547028 X:127838226-127838248 GCCCTAGTAGGGACTCCGTGTGG + Intergenic
1197583189 X:128310771-128310793 GACCCAGTGGGGACTCTGTGTGG + Intergenic
1197642909 X:128986283-128986305 GCCACAGTAGGGACTCTGTGTGG - Intergenic
1197911008 X:131482580-131482602 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1197975699 X:132163584-132163606 GCCCCAGGAGGGACTCTGTGTGG - Intergenic
1198608721 X:138373298-138373320 GCCACAGTAGGGATTCTGTGTGG - Intergenic
1198919332 X:141708188-141708210 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1199020350 X:142870749-142870771 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1199044029 X:143147721-143147743 GCCACAGGAGGTACTCTGTGTGG - Intergenic
1199060534 X:143350775-143350797 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1199480948 X:148297843-148297865 GCCTCAGTAGGGACTCTGTGTGG - Intergenic
1200545868 Y:4517900-4517922 GCCCCAGATGGGACTCTGTGTGG + Intergenic
1200612280 Y:5338829-5338851 CACGGAGAAGGGACTCCGAGAGG + Intronic
1200621484 Y:5454457-5454479 GCCCCAGTAGGGACTCTGTGGGG + Intronic
1200672668 Y:6112804-6112826 GCCACAGTAGGGACCCTGTGTGG - Intergenic
1200887727 Y:8286215-8286237 GACATAGATGGGACTACATGTGG + Intergenic
1200970425 Y:9146838-9146860 GCCAAGGAAGAGACTCCGTGAGG - Intergenic
1201469502 Y:14318005-14318027 GCCCCAGTAGGGACTCTGTGTGG - Intergenic
1201924073 Y:19265991-19266013 GCCCCAGTAGGGACTCTGTGTGG + Intergenic
1202140583 Y:21717483-21717505 GCCAAGGAAGAGACTCCGTGAGG + Intergenic
1202146282 Y:21786314-21786336 GCCAAGGAAGAGACTCCGTGAGG - Intergenic