ID: 1001276800

View in Genome Browser
Species Human (GRCh38)
Location 5:170357201-170357223
Sequence CCGGACCCTGCACTGTGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 217}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001276793_1001276800 24 Left 1001276793 5:170357154-170357176 CCACGAATGCAGTGAGGAGCACA 0: 1
1: 0
2: 0
3: 12
4: 123
Right 1001276800 5:170357201-170357223 CCGGACCCTGCACTGTGGCTCGG 0: 1
1: 0
2: 1
3: 22
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001276800 Original CRISPR CCGGACCCTGCACTGTGGCT CGG Intronic
900307848 1:2019667-2019689 CCGGACGCTGCCCTTGGGCTCGG + Intronic
900676544 1:3890741-3890763 CCGGACCCGGCACTGTGTTTTGG + Exonic
901643379 1:10704397-10704419 CCGCGCCCTGCACTCTCGCTGGG - Intronic
901920296 1:12531468-12531490 CTGGGCCCTGCCCTGTGGCCAGG - Intergenic
903404259 1:23083226-23083248 GAGCACCATGCACTGTGGCTGGG - Exonic
904629682 1:31831492-31831514 CCGGACCCTGAGCCCTGGCTGGG + Intergenic
905591710 1:39169560-39169582 CCTGTCACTGCACTGTAGCTTGG + Intronic
907594648 1:55708211-55708233 CCGTACCCTGAACTGTGAGTGGG - Intergenic
909173379 1:72322585-72322607 CTGGATCCTGCATTGTGTCTTGG - Intergenic
911561704 1:99414513-99414535 TCTGACTCTGCACTGTGGCGAGG + Intergenic
913016641 1:114743434-114743456 CCGGCCCCTGCACTGCGCCCTGG + Intronic
913150864 1:116041586-116041608 CCCTTCCCTGCACTGTGGTTTGG - Intronic
915248634 1:154572927-154572949 CCCGACCCCGCACTTTGGGTAGG + Intronic
915528263 1:156489240-156489262 CCCGCCCCTTCCCTGTGGCTGGG + Intronic
918139628 1:181709511-181709533 CCTTTCCCTGCACTGTAGCTGGG + Intronic
919984161 1:202661270-202661292 CTGGACCCTGCCCTCTAGCTTGG - Intronic
920717101 1:208350269-208350291 TTGCACCCTGCCCTGTGGCTTGG + Intergenic
1063379404 10:5574999-5575021 CTGGTCCCTGCAGTGTGGGTGGG - Intergenic
1065326462 10:24554188-24554210 CTGGACCCTGTACTGGGGATAGG + Intergenic
1070769054 10:79071633-79071655 CCGGCCCCTGCACTGGGGCCAGG - Intronic
1072009784 10:91292704-91292726 AGGGAGCTTGCACTGTGGCTGGG - Intergenic
1072016861 10:91356529-91356551 CAGCTCCCTGCACCGTGGCTGGG + Intergenic
1072760780 10:98054842-98054864 CAGCACCCTGCACTGGGGGTTGG - Intergenic
1072803896 10:98412103-98412125 AGGGACCCTGCAGTGTGGCAAGG + Intronic
1076354419 10:129841653-129841675 CAGGACACTGCACTGTGGGATGG + Intronic
1076943327 10:133625188-133625210 CAGGACCTGGCAGTGTGGCTGGG + Exonic
1076992761 11:284370-284392 CTGCACCCTGCACTGCGGCCAGG - Exonic
1077919935 11:6634159-6634181 CCGGACCCTGGACCGTGACCAGG - Exonic
1078031481 11:7755924-7755946 CGCGCCCCTGCACTGTGGCCTGG + Intergenic
1078328331 11:10398320-10398342 CCTGACTCTGCAGTGTGGCCAGG + Intronic
1078755192 11:14202424-14202446 CCGGACCATGCACTTGTGCTAGG - Intronic
1081852321 11:46282253-46282275 GCAGACCCTGCACTGTCTCTGGG + Intronic
1081935989 11:46904190-46904212 CTGGACCCTGCCCTCAGGCTGGG + Intronic
1083202930 11:61131316-61131338 CCTGCCCATGCACTGTGGCAGGG - Exonic
1084383568 11:68828555-68828577 CCAGACTGGGCACTGTGGCTGGG + Intronic
1084515590 11:69636727-69636749 CCGGACCCTGGGCCGTGGCTCGG - Intergenic
1085012603 11:73151827-73151849 CCACACCCTGCACTGTGCCCTGG + Intergenic
1085260909 11:75204171-75204193 CTGGACTCTGCTCTGTGGCCTGG - Intronic
1085618865 11:78022681-78022703 CCTGCCCCTGCCCTCTGGCTGGG - Intronic
1088158168 11:106834792-106834814 CCAGTCTCTGCACTGTGGTTTGG + Intronic
1090462623 11:126905609-126905631 CCTCATCCTGCACAGTGGCTTGG + Intronic
1090481348 11:127071482-127071504 CCGGCACCATCACTGTGGCTCGG - Intergenic
1095802198 12:46281116-46281138 CTGGACCCAGCAGTGTGGCCAGG + Intergenic
1098508572 12:71284321-71284343 CTGCACCCTGCTCTGTGCCTTGG + Intronic
1102351183 12:112193513-112193535 CCGGACCCTGCACCAGGGCGAGG - Exonic
1102474655 12:113180821-113180843 CTGGGCCCAGCACTGTGGTTGGG - Intronic
1103480031 12:121244898-121244920 CGGGAACTTGCACTGTAGCTGGG - Intronic
1103621401 12:122189528-122189550 CCTGCCCCTGCCCTGTGTCTTGG + Intronic
1103897981 12:124286498-124286520 CAGGACCCTGCCCTCCGGCTGGG + Intronic
1103973403 12:124686556-124686578 CAGGACCCTGCCCTGGAGCTGGG - Intergenic
1104978455 12:132562357-132562379 CGGGGCCCTGGACTGGGGCTGGG + Intronic
1105799164 13:23888911-23888933 CCGGACCCGACACTCTGGGTAGG + Intronic
1106313196 13:28571707-28571729 ACGGACCCTGCTCTGGGCCTTGG + Intergenic
1106322836 13:28658642-28658664 CCGAACCCTGTGCTGAGGCTAGG - Intergenic
1106971129 13:35143289-35143311 CCTCACCTTGCACTGTTGCTTGG + Intronic
1107964957 13:45589714-45589736 CAGGCCCCTTCACTGTGTCTGGG + Intronic
1109869890 13:68321061-68321083 CCCTCACCTGCACTGTGGCTGGG - Intergenic
1110040175 13:70744845-70744867 CCAAACCCTCCACTGTGGTTTGG + Intergenic
1110384316 13:74891098-74891120 CCAGGCACTGCACTGTGTCTAGG + Intergenic
1113950008 13:114066524-114066546 CCTGGCCCTGAGCTGTGGCTGGG - Intronic
1116683640 14:48010303-48010325 CTGGACTCTGCAATGTGGCCTGG - Intergenic
1119170990 14:72536446-72536468 CTGGACCTTGCAGTGGGGCTGGG - Intronic
1119407414 14:74407330-74407352 CCGGGCCCTGCTCTGGGGCTGGG + Exonic
1122613802 14:103003070-103003092 CGGGTCCCTGCTCTGAGGCTTGG + Intronic
1122799099 14:104221014-104221036 CAGGACCCTGCTCTGTAGCGGGG + Intergenic
1122846661 14:104503991-104504013 CTGGGCCCAGCACTGTGGCTCGG - Intronic
1124612095 15:31215831-31215853 CCGCCGCCTGCACTGGGGCTCGG - Intergenic
1126069005 15:44849458-44849480 CAGGACCCTGAAGTGAGGCTGGG - Intergenic
1126089813 15:45041315-45041337 CAGGACCCTGAAGTGAGGCTGGG + Intronic
1127187460 15:56494127-56494149 CAGCACCCAGCACAGTGGCTTGG + Intergenic
1129038014 15:72662732-72662754 CTCGAAGCTGCACTGTGGCTCGG - Exonic
1129211875 15:74074499-74074521 CTCGAAGCTGCACTGTGGCTCGG + Exonic
1129270513 15:74417081-74417103 GGGGACCCTGCACTGGGTCTGGG + Intronic
1129398528 15:75266585-75266607 CTCGAAGCTGCACTGTGGCTCGG - Exonic
1129402136 15:75290861-75290883 CTCGAAGCTGCACTGTGGCTCGG - Exonic
1129475683 15:75783321-75783343 CTCGAAGCTGCACTGTGGCTCGG - Intergenic
1129728993 15:77918771-77918793 CTCGAAGCTGCACTGTGGCTCGG + Intergenic
1129839507 15:78735095-78735117 CTCGAAGCTGCACTGTGGCTCGG - Intergenic
1132153182 15:99476565-99476587 CCGGAGCCTGCACAGAGGCCAGG - Intergenic
1132436786 15:101812453-101812475 CTGGAGTCTGCACTGTGGCTTGG + Intronic
1132603112 16:782669-782691 CCGGTCCCGGACCTGTGGCTGGG - Intronic
1132958380 16:2608687-2608709 CTGGACCCTGCACTGTGGGGAGG + Intergenic
1132970992 16:2688783-2688805 CTGGACCCTGCACTGTGGGGAGG + Intronic
1133389189 16:5395475-5395497 CCAGGTCCTCCACTGTGGCTTGG + Intergenic
1134069828 16:11254283-11254305 ACGGGGCCTGCCCTGTGGCTGGG - Intronic
1134089947 16:11386229-11386251 GCGGCCCCTGAGCTGTGGCTTGG + Intronic
1134557356 16:15177014-15177036 CCGTACCCAGCCCTGTGGATGGG - Intergenic
1134917928 16:18088723-18088745 CCGTACCCAGCCCTGTGGATGGG - Intergenic
1135772688 16:25229229-25229251 CCAGACCCTGGACTCTGCCTGGG - Intergenic
1138383170 16:56617630-56617652 AGGGACACTGTACTGTGGCTGGG - Intergenic
1139275427 16:65723455-65723477 CCGTACTCTGCCCTGTGGCCAGG + Intergenic
1139442180 16:66973885-66973907 GAGGACCCGGCACTGGGGCTGGG - Exonic
1139487772 16:67268368-67268390 CCGGCCACTGCACTCTTGCTTGG - Intronic
1139915356 16:70424931-70424953 CTGGACCAGGCACTGTGGCTGGG + Intronic
1140903370 16:79390793-79390815 CTGGACCAAGCACTGTGGCCCGG - Intergenic
1141522834 16:84592889-84592911 CCTGACCCTGGACTGCAGCTAGG - Intronic
1142154630 16:88527480-88527502 CCCCACCCTGCACTGGGGCCAGG - Intronic
1142264927 16:89059419-89059441 CCGCACCCTCCACAGTAGCTGGG - Intergenic
1142291955 16:89197259-89197281 CTGGACCCTGCTGTGTGGCCGGG + Intronic
1142870243 17:2815091-2815113 CCGGACCCCACCCTGGGGCTTGG + Intronic
1144584352 17:16479037-16479059 CCGGACCCTGCAGTATTGCAGGG - Intronic
1145933502 17:28701963-28701985 CCGGACTCTGGGCTGTGACTGGG + Exonic
1148440158 17:47708133-47708155 CCTGTCCCTGCACTTAGGCTGGG + Intronic
1151954432 17:77373414-77373436 CCGGGCCCTGCGCGCTGGCTGGG - Intronic
1152253399 17:79223548-79223570 CCCGACCCTGCACTTGGGCCAGG + Intronic
1152306838 17:79526052-79526074 CAGTCTCCTGCACTGTGGCTGGG - Intergenic
1152338973 17:79714066-79714088 CCGGCCGCTTCACTGTGGGTTGG - Intergenic
1152529674 17:80910203-80910225 CCCGTCTCTGCACTGTGGCCTGG + Intronic
1152727893 17:81956641-81956663 CCCGACCCTGCGCTGTGAGTGGG - Exonic
1158503871 18:58028729-58028751 CTGAACCCATCACTGTGGCTGGG + Intergenic
1160827800 19:1088829-1088851 CCGGCCTCTGCACTGCGGCCTGG - Intronic
1161237711 19:3206098-3206120 CAGGCCCCTGCAGTGGGGCTGGG - Intronic
1161270498 19:3387020-3387042 CCAGACACTGCACTCTGGCTGGG - Intronic
1161274430 19:3407755-3407777 CAGCACCCTGGACTGTGTCTGGG - Intronic
1161579330 19:5072092-5072114 CGGGAGCCTGTACTGAGGCTGGG - Intronic
1161698276 19:5782315-5782337 CCGGACCCCGAAGTGTGGCCGGG + Intergenic
1162417220 19:10545042-10545064 CCTGACCTCGGACTGTGGCTGGG + Exonic
1162550970 19:11357923-11357945 CAGCACCCTGCAGTGTGGATGGG - Intronic
1162802393 19:13118562-13118584 CCGCAGCCTGCACTGTGCCCGGG + Intronic
1163420752 19:17212344-17212366 ACGGCCCCTGCACTGGAGCTGGG + Exonic
1166638046 19:44469326-44469348 CCTGTACCTGCACTGTAGCTAGG - Intergenic
1166833705 19:45653899-45653921 GTGGTCCCTGCACTGAGGCTGGG - Intergenic
927929562 2:27035477-27035499 AAGGCCCCTGCACTGAGGCTGGG - Intronic
928072576 2:28232086-28232108 CCTGACCAGGCACAGTGGCTTGG - Intronic
928263309 2:29787285-29787307 CAGCACCCAGCACTGTGTCTCGG - Intronic
929149055 2:38731621-38731643 CTTGTCCCTGCTCTGTGGCTGGG + Intronic
931845614 2:66200918-66200940 CCAGACCCTGTACTTTGGCTGGG + Intergenic
933721835 2:85401923-85401945 CTGGATCCTGCACTGAGCCTGGG + Exonic
936115127 2:109696005-109696027 CAGGCCACTGCACTGTGGCCTGG - Intergenic
938702644 2:133893165-133893187 CGGGACCCTTCACTGGGGCCAGG - Intergenic
939504375 2:143027519-143027541 CCTGTCCCTGCTCTGTAGCTGGG + Intronic
940851415 2:158690995-158691017 CCTGACACTGCACTGTCACTTGG - Intergenic
941006423 2:160251739-160251761 CAGGCCCATGCACTGTGGCCAGG + Intronic
942784919 2:179689649-179689671 CCTCACCCTGCACTGTGCCCAGG + Intronic
947405600 2:229773117-229773139 CGTGCCCCTGCACTCTGGCTTGG - Intronic
948480992 2:238250346-238250368 CCTGGCCCTGCAGTGTGGCCAGG - Intronic
948856878 2:240734360-240734382 CCACACCCTGCCCTGTGGATGGG - Intronic
948869721 2:240791923-240791945 CCAGGCCCTGCACTGGGGCTGGG + Intronic
948869762 2:240792033-240792055 CCACACCCTGTGCTGTGGCTGGG + Intronic
1170111491 20:12808708-12808730 CTGAACCCAGCAGTGTGGCTGGG + Intergenic
1170388590 20:15848297-15848319 CCAGATCCTGCACGGGGGCTGGG - Intronic
1171123122 20:22582506-22582528 CTGGACCCTGCACCCTGACTCGG - Exonic
1171780704 20:29415351-29415373 CAGGACCAGGCAGTGTGGCTGGG + Intergenic
1172762438 20:37332074-37332096 CCTGAGCCAGCACTGGGGCTGGG + Intergenic
1174037878 20:47679195-47679217 CCTGAGGCTGCACTGTGCCTGGG - Intronic
1174145803 20:48451682-48451704 CCTGACACTGCAATCTGGCTGGG + Intergenic
1174485777 20:50860345-50860367 CGGGACCCTGCTCAGTGTCTTGG - Intronic
1174707779 20:52674776-52674798 CTGGACCCATCACTGTGGCCAGG + Intergenic
1174786589 20:53438523-53438545 CTGGACCAATCACTGTGGCTAGG + Intronic
1175781387 20:61684417-61684439 CCTGCCCCTGCATTTTGGCTTGG - Intronic
1175931655 20:62496480-62496502 CCGGACCCTGCTGGGTGGGTTGG + Intergenic
1176061190 20:63173671-63173693 CCTGGCCATGCACTGTTGCTGGG - Intergenic
1177208297 21:18036522-18036544 CCTTTCCCTGCACTGTGGCCTGG + Intronic
1178376021 21:32068007-32068029 CAGGGCCCTGCACTGTGAATAGG + Intergenic
1179526485 21:41980262-41980284 CGGGACCCTGCAAGGTGGGTGGG - Intergenic
1180026807 21:45169161-45169183 CATGACTCTGCACTGTGGCGTGG + Intronic
1180906857 22:19419668-19419690 CAGGACCCAGAGCTGTGGCTTGG + Intronic
1183044784 22:35211069-35211091 CAGGAGCCTGCACTGTTGCAGGG - Intergenic
1184679280 22:46061682-46061704 CCGCACCCTGGACTCTGCCTGGG + Intronic
1185420991 22:50734340-50734362 CAGGACCCAGCACTGAGGCCAGG + Intergenic
949341425 3:3034837-3034859 CTGGACACAGCACTGTGGCAAGG + Intronic
949892379 3:8743124-8743146 GCGGACCCTTCACCATGGCTTGG - Intronic
951072724 3:18351326-18351348 CCGACCCCTGCACCATGGCTCGG - Exonic
952341418 3:32450703-32450725 CAGTACCCTGCACTGTAGCTGGG - Intronic
954067229 3:48116490-48116512 CTTGACACTGCACTCTGGCTTGG - Intergenic
955073473 3:55591333-55591355 TGGGACCCAGCACTGTGACTGGG + Intronic
957078499 3:75619194-75619216 CCTGACCCTGCTCTGGGGCTGGG + Intergenic
957084303 3:75665921-75665943 CAGGACCAGGCAGTGTGGCTGGG - Exonic
958855199 3:99376610-99376632 CTGGACACTCTACTGTGGCTAGG - Intergenic
960938141 3:122915853-122915875 CCGGGACCCGTACTGTGGCTGGG - Exonic
961575414 3:127831991-127832013 CAGCAGCCTGCACTGAGGCTGGG + Intergenic
961646100 3:128393583-128393605 TCAGATCCTGCATTGTGGCTGGG - Intronic
962346524 3:134623195-134623217 CCACTCCCTGCTCTGTGGCTGGG + Intronic
966315971 3:178645685-178645707 CCAGAACCGGCTCTGTGGCTGGG - Intronic
968665833 4:1821964-1821986 CCGGGCTCCGCACTGTGCCTGGG - Intronic
968881532 4:3302717-3302739 GGGGCCCCTGCTCTGTGGCTAGG + Intronic
969021582 4:4143167-4143189 CCTGACCCTGCTCCGGGGCTGGG + Intergenic
969319950 4:6405656-6405678 CCTGACCCTCCCCTGTGGCCTGG - Intronic
969732286 4:8964249-8964271 CCTGACCCTGCTCCGGGGCTGGG - Intergenic
978284902 4:107064984-107065006 CAGGACTCAGCACCGTGGCTTGG - Intronic
979813113 4:125064638-125064660 CTGGACCCAGCAATGTGGCTGGG + Intergenic
985446683 4:190025650-190025672 CAGGACCTGGCAGTGTGGCTGGG + Exonic
988684543 5:33514426-33514448 CCTGTCCATGCACTGTGGCAGGG - Intergenic
994382286 5:99085490-99085512 CTGAACCATTCACTGTGGCTGGG + Intergenic
996457156 5:123697737-123697759 CCGCACTTTGCACTGTGGGTAGG - Intergenic
997752977 5:136366823-136366845 CCTCACCCTCCACAGTGGCTGGG + Intronic
999804272 5:155067396-155067418 CAGGACCCTGCACTCTGCCATGG - Intergenic
1001276800 5:170357201-170357223 CCGGACCCTGCACTGTGGCTCGG + Intronic
1001661013 5:173393400-173393422 CTGCAACCTACACTGTGGCTTGG + Intergenic
1002958886 6:1895939-1895961 TCAGTGCCTGCACTGTGGCTCGG - Intronic
1003483012 6:6550355-6550377 CCGGTCCCTGCACTGTTGCTCGG + Intergenic
1004441969 6:15662712-15662734 ACGGACCCTGGACCGTGGCGCGG + Intronic
1007717384 6:43865161-43865183 CCAGACCCTGCCCTGAAGCTGGG - Intergenic
1017448222 6:154528768-154528790 CCCCACCCTGCAGTGTGGATGGG - Intergenic
1017825164 6:158076334-158076356 TCGGACCCTGCACTGTCTCCTGG + Intronic
1019214932 6:170437437-170437459 CAGGACCCTGCCCTGTGGAGAGG - Intergenic
1020104849 7:5418003-5418025 GGAGACCCTGCACTCTGGCTTGG - Intronic
1020111918 7:5452249-5452271 TCGGCCCCTGCAGTGTGGCCAGG - Intronic
1020141135 7:5612548-5612570 CCAGACTCTGAACTGTGGCTGGG + Intergenic
1021464834 7:20930512-20930534 CCTGAGCCTCCACTGTGGCTGGG - Intergenic
1023983520 7:45082614-45082636 CCGGAGCCTGTACTGGGTCTGGG - Exonic
1024126464 7:46302675-46302697 GCTGAGCCTGCACTGTGGGTTGG + Intergenic
1026675245 7:72423376-72423398 CTGGTCCCTGCCCTGGGGCTAGG - Intronic
1033398958 7:141003541-141003563 CCTGACCCTGCAGTGAGCCTTGG - Intergenic
1035763471 8:2086577-2086599 CCAGACCCTGCACCGTTGCTGGG + Intronic
1035836744 8:2762775-2762797 CCTCACCCTGCGCTCTGGCTGGG - Intergenic
1036650464 8:10639098-10639120 TCGGACCCTGCACTCTAGCCTGG + Intronic
1038027640 8:23606451-23606473 CAGAACCCTGCAGTGTTGCTGGG + Intergenic
1038041646 8:23728338-23728360 CCAGAACCTGCACTGTGACAAGG - Intergenic
1038406563 8:27326567-27326589 TCGGAAGCTGCGCTGTGGCTGGG + Intronic
1040275892 8:46013487-46013509 GCAGACCCTGCACTGGGCCTGGG - Intergenic
1041820773 8:62030279-62030301 CAGGACACTGCACTCTGGCCTGG + Intergenic
1044912865 8:97080009-97080031 CCGGAGCCTGCCCAGTGGCTAGG - Intronic
1046906673 8:119581356-119581378 CCACACCCTGCTCTGTGGCCTGG + Intronic
1047646742 8:126877951-126877973 CCGGAACCTCTCCTGTGGCTGGG + Intergenic
1048553229 8:135453394-135453416 CTGGACCAGGCACTGGGGCTGGG + Intergenic
1049372541 8:142274672-142274694 CCAGGCCCTGCCCTGTGCCTGGG - Intronic
1049538533 8:143194470-143194492 CCGGCCCCTGCACTGGTCCTGGG - Intergenic
1049538588 8:143194671-143194693 CCGGCCCCTGCACTGGTCCTGGG - Intergenic
1049705804 8:144041428-144041450 GGGGACCCTGCACTCTGGCCAGG + Intronic
1051199066 9:14597326-14597348 CTGGACTCAGCAGTGTGGCTGGG + Intergenic
1052995341 9:34549132-34549154 CCCGACAATACACTGTGGCTGGG - Intergenic
1056814799 9:89793260-89793282 GGGGATCCTGCACTGTGCCTGGG - Intergenic
1056970234 9:91195410-91195432 GAGCACCCTGCTCTGTGGCTGGG + Intergenic
1058672271 9:107369532-107369554 CTGGATCCTGCACTGTCTCTGGG + Intergenic
1060508238 9:124214448-124214470 CCGGACCCTGTGCTGGGGCCAGG - Intergenic
1060523857 9:124309472-124309494 CCAAACCCTTCACTGTGCCTGGG + Intronic
1061895495 9:133644749-133644771 CCCGTCCCTGCACTCTGGCCAGG - Intronic
1062618949 9:137411001-137411023 CCGAAATCTGCACTGAGGCTGGG - Intronic
1186349885 X:8730947-8730969 CGGGACTCTGCCCTGTGGCGCGG - Intronic
1187864756 X:23713992-23714014 CACGACCCTGCACTGTAGCCTGG + Intronic
1190106731 X:47566642-47566664 CCGCACCCAGCACTGTGACCCGG + Exonic
1190559231 X:51671010-51671032 CAGAGCCCTGCCCTGTGGCTTGG + Intergenic
1190565060 X:51722311-51722333 CAGAGCCCTGCCCTGTGGCTTGG - Intergenic
1190569597 X:51768174-51768196 CAGAGCCCTGCCCTGTGGCTTGG + Intergenic
1192186745 X:68952237-68952259 GCGGGCCCTGCACTGTGGGCTGG + Intergenic
1198740122 X:139833419-139833441 CTGGACCTGGCACAGTGGCTTGG + Intronic
1199601754 X:149545251-149545273 CCGGACTCTCCACTCTGGCTAGG + Intronic
1200971956 Y:9162182-9162204 CTTGGCCCTGCACTTTGGCTGGG + Intergenic
1201416478 Y:13752897-13752919 CCGGACCCTGCCCCGTGGCATGG + Intergenic
1202139073 Y:21702108-21702130 CCTGGCCCTGCACTTTGGCTGGG - Intergenic