ID: 1001277182

View in Genome Browser
Species Human (GRCh38)
Location 5:170359478-170359500
Sequence GCGAGCCAGGACTCGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 73}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001277182_1001277188 -2 Left 1001277182 5:170359478-170359500 CCACCATCCGAGTCCTGGCTCGC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1001277188 5:170359499-170359521 GCTCACTGTCCTGGCAGTGAGGG 0: 1
1: 0
2: 2
3: 16
4: 187
1001277182_1001277187 -3 Left 1001277182 5:170359478-170359500 CCACCATCCGAGTCCTGGCTCGC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1001277187 5:170359498-170359520 CGCTCACTGTCCTGGCAGTGAGG 0: 1
1: 0
2: 1
3: 12
4: 161
1001277182_1001277189 -1 Left 1001277182 5:170359478-170359500 CCACCATCCGAGTCCTGGCTCGC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1001277189 5:170359500-170359522 CTCACTGTCCTGGCAGTGAGGGG 0: 1
1: 0
2: 3
3: 22
4: 198
1001277182_1001277191 16 Left 1001277182 5:170359478-170359500 CCACCATCCGAGTCCTGGCTCGC 0: 1
1: 0
2: 0
3: 8
4: 73
Right 1001277191 5:170359517-170359539 GAGGGGCTGAGCAAGCACTCTGG 0: 1
1: 0
2: 2
3: 27
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001277182 Original CRISPR GCGAGCCAGGACTCGGATGG TGG (reversed) Intronic
906705870 1:47894985-47895007 CTGAGCCAGGACTGGGGTGGTGG - Intronic
908418651 1:63937984-63938006 GGGAGCCAGGATTTGGAAGGAGG - Intronic
920860721 1:209704268-209704290 GCCAGCCAGAACCCAGATGGCGG - Intronic
922721704 1:227903175-227903197 ACTAGCCAGGCCCCGGATGGTGG + Intergenic
923462094 1:234216355-234216377 GTGGGGCAGGACGCGGATGGTGG + Intronic
1067684164 10:48457216-48457238 GCGAGTCAGGACCAGGCTGGAGG - Intronic
1069942467 10:71964761-71964783 GCGCGCCTGGACGCGGAAGGCGG - Intronic
1071553674 10:86586202-86586224 GTCAGGCAGGACTGGGATGGAGG - Intergenic
1074943171 10:118254626-118254648 GGGAGCCAGGACTGGGATTGTGG + Intergenic
1084024341 11:66438564-66438586 GGAAGCTAGGACGCGGATGGAGG - Intronic
1084245390 11:67853475-67853497 GGGAACCAAGACTAGGATGGGGG + Intergenic
1087263389 11:96035845-96035867 TGGAGCTAGGACTCGAATGGAGG - Intronic
1089289417 11:117428685-117428707 TCGAGCCAGGTTCCGGATGGAGG + Exonic
1089560484 11:119340807-119340829 GCGAACCAGGACTGGGGTGACGG - Exonic
1091492437 12:944646-944668 GAGAGCCTGGACTAGGATAGTGG + Intronic
1113028547 13:105968758-105968780 GGGAGCCATGACTAGGATGCTGG - Intergenic
1113246551 13:108402968-108402990 GGGAGCCAGGAAAGGGATGGGGG - Intergenic
1115577524 14:34725600-34725622 GCTGTCCAGGACTCGCATGGTGG - Intergenic
1135190586 16:20351024-20351046 GGGAGCCAAGACTGGGATGTTGG - Intronic
1137753534 16:50884241-50884263 GGGAGCCAGGACACGGATCCAGG + Intergenic
1146400018 17:32494706-32494728 GGGACCCAGGACTCGGAGTGTGG + Exonic
1147895059 17:43745161-43745183 GGGAGCCAGGGCTGGGCTGGGGG + Intergenic
1152781380 17:82228748-82228770 GCGAGCCTGGACTCCGGGGGAGG + Intronic
1155054588 18:22172137-22172159 GCGAGTAGGGGCTCGGATGGTGG - Exonic
1156471787 18:37381643-37381665 CCAGGCCAGGACTCGGATGCTGG + Intronic
1160200300 18:76790280-76790302 GCTACTCAGGACTCTGATGGGGG + Intergenic
1160623523 18:80187606-80187628 GGGAGCCAGGAGGTGGATGGGGG - Intronic
1162757171 19:12867356-12867378 CGGAGCCAGGCCTCGGAGGGTGG + Intronic
1163469211 19:17487027-17487049 GCGCCCCAGGCCTCGGAAGGCGG + Intronic
1163602923 19:18259505-18259527 GTGACCCATGCCTCGGATGGTGG + Intronic
1165329727 19:35134767-35134789 GCGTGCCAGCAGGCGGATGGAGG - Exonic
1167024323 19:46904118-46904140 GAGAGACAGCACTGGGATGGGGG + Intergenic
1167499298 19:49836355-49836377 GCGGGCCAGGACTGGGCAGGTGG - Exonic
926848769 2:17171636-17171658 GTGAGCCAGGGCTCTGCTGGTGG - Intergenic
934577893 2:95414523-95414545 GTGAGGCAGGACCAGGATGGGGG - Exonic
934601546 2:95662179-95662201 GTGAGGCAGGACCAGGATGGGGG + Intergenic
936534906 2:113304345-113304367 GTGAGGCAGGACTAGGATGGGGG + Intergenic
936656418 2:114493269-114493291 GGAAGCCAGGACAGGGATGGTGG + Intronic
1171122125 20:22577130-22577152 GCGAGCCGGGGCTCGGAGGGCGG + Intergenic
1172650854 20:36500431-36500453 TCGAGCCAGGGGTCGGGTGGGGG - Exonic
1172737070 20:37134870-37134892 GGGAGCAAGGACTGGGCTGGTGG - Intronic
1175945169 20:62555315-62555337 TCGGGTCAGGACTGGGATGGCGG - Intronic
1178833444 21:36075716-36075738 ACGAACCAGGACTCTGGTGGGGG - Intronic
1181583878 22:23842420-23842442 GCCAGCCAGGGCTGGGAGGGAGG + Intergenic
1181694089 22:24584442-24584464 GGGTCCCAGGACTGGGATGGAGG - Intronic
1183099654 22:35575953-35575975 GAGAGCCGGGACTCGGATGCAGG - Intergenic
1183122677 22:35742313-35742335 GCGAGACAGGATTCTGAAGGGGG + Intronic
1183377338 22:37472836-37472858 GCAAGCCTGGACTAGAATGGAGG + Intronic
1183382152 22:37495700-37495722 GGGAGCCAGGGCTCAGATGGGGG - Intronic
1183513677 22:38250791-38250813 CCGAGCCAGGGCTGGGATGTGGG + Intronic
949414329 3:3799635-3799657 GGGAGGCAGGACTGGGAAGGAGG - Exonic
962697426 3:137963834-137963856 AGGAGGCAGGACTCGGATGCTGG - Intergenic
968865350 4:3206904-3206926 GCGAGCCAGCACACGGAAAGGGG - Exonic
969438940 4:7206095-7206117 GCGAGGTAGGACTCGGCTGGAGG + Intronic
972736298 4:41844964-41844986 GAGAGCCAGGACTTGGATCATGG + Intergenic
983659278 4:170116843-170116865 TGGTGCCATGACTCGGATGGGGG + Intergenic
1001277182 5:170359478-170359500 GCGAGCCAGGACTCGGATGGTGG - Intronic
1004354449 6:14918999-14919021 GTGAGGCAGGACTCTGAAGGAGG - Intergenic
1005473929 6:26188957-26188979 GCGAGCCAGGCGGCGGATAGCGG + Exonic
1005649464 6:27873391-27873413 CCGTGCCAGGCGTCGGATGGCGG + Exonic
1012600583 6:101092087-101092109 GGGAGACAGGACTGGGCTGGTGG + Intergenic
1014272411 6:119349350-119349372 GCTCGCCAGGAGTCGGAGGGCGG - Intronic
1018190400 6:161305066-161305088 TGGAGCCAGGACGCGGTTGGGGG + Intergenic
1018656442 6:166041488-166041510 GGGAGCCAGGACTCAGGTCGGGG + Intergenic
1019518153 7:1448556-1448578 GGGAGCCAGGCCAAGGATGGGGG + Intronic
1019949700 7:4361463-4361485 GCTGGCCAGGATTCGGATGTGGG - Intergenic
1021393351 7:20121171-20121193 TGGTGCCAGGACTCGGATCGGGG + Intergenic
1027190827 7:75994644-75994666 GCGAGCCCGGAAGCGGACGGGGG - Exonic
1030095447 7:105894653-105894675 GGTAGCCTGGACTCGGGTGGAGG + Intronic
1031999221 7:128254001-128254023 GGGAGGGAGGACTCGGCTGGGGG + Intronic
1038124289 8:24654332-24654354 GGGAGCCAGGGGTGGGATGGTGG - Intergenic
1042274161 8:66985820-66985842 GCATGCCAGGACTCTGATGGAGG + Intronic
1042484690 8:69337017-69337039 GCGAGTCAGGGCTACGATGGCGG - Intergenic
1049308678 8:141921619-141921641 AAGAGCCAGGACTCCTATGGGGG + Intergenic
1051345113 9:16144428-16144450 TAGAGCCAGGACTCAGATTGAGG + Intergenic
1055422853 9:76162194-76162216 GGGAGCCAGGCCTTGGAAGGTGG - Intronic
1057315757 9:93967287-93967309 GCCAGCCAGGCCTGGGCTGGAGG + Intergenic
1057337334 9:94166285-94166307 CCGCGCCAGGACCCGGATGGAGG - Intergenic
1057707977 9:97411820-97411842 GCGAGCCGGGACTCAGCAGGGGG - Intergenic
1058792106 9:108458276-108458298 GTGAGCCAGGACCCTGGTGGAGG + Intergenic
1058896965 9:109408898-109408920 GCGAGCGAGGCCTGGGAAGGGGG + Intronic
1200146230 X:153927760-153927782 ACCAGTCAGGGCTCGGATGGAGG - Intronic