ID: 1001278226

View in Genome Browser
Species Human (GRCh38)
Location 5:170366386-170366408
Sequence CCTGGAAGGGAGAAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 559
Summary {0: 1, 1: 1, 2: 3, 3: 50, 4: 504}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001278217_1001278226 -7 Left 1001278217 5:170366370-170366392 CCCCTGAGGACACCACCCTGGAA 0: 1
1: 0
2: 1
3: 23
4: 187
Right 1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 3
3: 50
4: 504
1001278216_1001278226 -6 Left 1001278216 5:170366369-170366391 CCCCCTGAGGACACCACCCTGGA 0: 1
1: 0
2: 2
3: 33
4: 212
Right 1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 3
3: 50
4: 504
1001278214_1001278226 6 Left 1001278214 5:170366357-170366379 CCTGGGTCAGAGCCCCCTGAGGA 0: 1
1: 0
2: 2
3: 55
4: 441
Right 1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 3
3: 50
4: 504
1001278212_1001278226 7 Left 1001278212 5:170366356-170366378 CCCTGGGTCAGAGCCCCCTGAGG 0: 1
1: 0
2: 5
3: 107
4: 853
Right 1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 3
3: 50
4: 504
1001278218_1001278226 -8 Left 1001278218 5:170366371-170366393 CCCTGAGGACACCACCCTGGAAG 0: 1
1: 0
2: 2
3: 43
4: 346
Right 1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 3
3: 50
4: 504
1001278219_1001278226 -9 Left 1001278219 5:170366372-170366394 CCTGAGGACACCACCCTGGAAGG 0: 1
1: 0
2: 2
3: 20
4: 189
Right 1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG 0: 1
1: 1
2: 3
3: 50
4: 504

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001278226 Original CRISPR CCTGGAAGGGAGAAGCTGGC TGG Intronic
900083205 1:874577-874599 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic
900332679 1:2144067-2144089 CCCGGAAGGGACAAGGTGCCGGG + Intronic
900366417 1:2313645-2313667 GCTGTCAGGGAGAATCTGGCAGG - Intergenic
900373546 1:2343294-2343316 CCTGGAGGCGAGGAGCGGGCGGG - Intronic
900552923 1:3265488-3265510 CCTGGCAGCGAAAAGCAGGCAGG - Intronic
900580246 1:3405153-3405175 TGTGGAAGGAAGAGGCTGGCGGG + Intronic
900643532 1:3698491-3698513 CCTGGAAGGGAGGGGCTGGTGGG + Intronic
900720166 1:4170849-4170871 CCAGGAAGGGACAAGGAGGCAGG - Intergenic
901752032 1:11416260-11416282 CCTGGAAGAGGGAACCTGGGTGG - Intergenic
901754744 1:11434729-11434751 CCTGTAAGGGAGAAGAGAGCAGG + Intergenic
901879244 1:12184559-12184581 CCTGGAGGGGAGGAGGTGGGAGG + Intronic
902134756 1:14295380-14295402 CATGAGAGGGAGAAGCTGGGAGG - Intergenic
902374075 1:16022098-16022120 CCTGGAAGGGCCAGGCAGGCAGG + Intronic
902466742 1:16623334-16623356 CCAGGAAGGGAAATGCTGGTGGG - Intergenic
902507868 1:16949439-16949461 CCAGGAAGGGAAATGCTGGTGGG + Intronic
902819649 1:18936198-18936220 GCTGGCAGGGAGGGGCTGGCAGG - Intronic
902936687 1:19769692-19769714 CCTGGCAGAGAGGAGCTGGTGGG + Intronic
903142277 1:21345693-21345715 CCTGGAGGGCAGGAGCAGGCGGG + Intergenic
903177374 1:21589097-21589119 CTTGGAGTGGAGACGCTGGCTGG + Intergenic
903179429 1:21597897-21597919 CCGGGAGGGGATGAGCTGGCGGG - Intronic
903414175 1:23170082-23170104 TCTGGCTGGGAGAAGCTGGGAGG - Intronic
903654775 1:24942571-24942593 CCAGGAAGGGAGAAGGGGGCTGG + Intronic
903904312 1:26672985-26673007 CTTTGAAGGGAGAAGGTGGGAGG - Intergenic
904130564 1:28272559-28272581 CCTGGAAGGGACAAGGGGGGAGG - Exonic
904373251 1:30064120-30064142 CATGGAATGTAGGAGCTGGCAGG - Intergenic
904409886 1:30319072-30319094 CCTGGGAGGAGGAAGCTGGGTGG + Intergenic
905851725 1:41279751-41279773 ACTGGAGGTGACAAGCTGGCAGG - Intergenic
906214935 1:44033213-44033235 GCTGGAAGGGAGAAGGAGGGAGG - Intergenic
906635748 1:47409374-47409396 CCTGGAAATGAGAAGCAGGAAGG + Intergenic
907263371 1:53238675-53238697 GCTGGAGGGGCGGAGCTGGCTGG - Intergenic
907479957 1:54738608-54738630 CTTTGAAGGGAAAAGCTGCCTGG + Intronic
907718080 1:56946328-56946350 CATGGCAGGGAGCAGCTGGAGGG + Intronic
908452493 1:64269704-64269726 CCTGTAAGGGAGCAGCAGGGAGG - Intergenic
909756310 1:79230280-79230302 CCTGGAACGGAGAGACTGGCTGG + Intergenic
910119201 1:83766601-83766623 CATGGAAGTGAGAAGTTTGCAGG - Intergenic
911115968 1:94247327-94247349 GCAGCAGGGGAGAAGCTGGCCGG - Intronic
911793333 1:102046409-102046431 ACTGGAAGGGAGAAATTGCCAGG - Intergenic
912091350 1:106080711-106080733 CCAGGAAGGGAGAAGGAGGACGG + Intergenic
912368537 1:109154659-109154681 CCTGGCAGGAAGAAGAAGGCTGG + Intronic
912474210 1:109925353-109925375 CCTGGAAAGGAGAGGGTGGCTGG - Intronic
912491259 1:110064022-110064044 CCTGGCTGGGAAAGGCTGGCTGG - Intronic
912649504 1:111425333-111425355 CCTGGGAGGGTGGAGCAGGCTGG - Intronic
912926554 1:113918236-113918258 CCTCTATGTGAGAAGCTGGCTGG - Intergenic
912965660 1:114235068-114235090 CCTGGAAGAGAGAAGCCGACTGG - Intergenic
914679986 1:149932274-149932296 CCTGGAAGGAACACGATGGCTGG - Exonic
914852656 1:151326722-151326744 CTTGGAAGCCAGGAGCTGGCTGG + Intronic
915163186 1:153933695-153933717 CCTGGAAGGGCTAAGTGGGCGGG - Exonic
916745260 1:167680275-167680297 CCTGGAGGGTAGATGCTGGCAGG + Intronic
916973489 1:170049349-170049371 CCTGGGATAGAGAACCTGGCAGG + Intronic
918082406 1:181217782-181217804 CCTGGAAGAGAGGGGCTGGCAGG + Intergenic
919781849 1:201226134-201226156 CCTGAGAGGGAGGAGCAGGCAGG + Intronic
920032730 1:203047134-203047156 CTCGGAAGGGAGAGGCTGGCCGG + Intronic
920043014 1:203116156-203116178 CCTGGCAGGTGGAAGTTGGCGGG + Intronic
920212332 1:204337237-204337259 CTGGGAAGGGAGGAGCTGGCTGG - Intronic
920331094 1:205208981-205209003 CCTGGGAGGGTGCAGATGGCAGG - Intronic
920491224 1:206416817-206416839 AGTGGAAGGGAGAAGCTGCAGGG + Intronic
921836845 1:219787209-219787231 CCTGGCAGGGAGAATGGGGCTGG - Intronic
922009698 1:221570296-221570318 TCTGGAAGGGAGAAGCAAGGTGG + Intergenic
922507166 1:226133300-226133322 CCAGGAAGGGAGGAGGTGGAGGG - Intergenic
923145227 1:231193013-231193035 CCTGGAAGGCTGGCGCTGGCTGG + Intronic
1062763850 10:46803-46825 CCTGCAAGGCGGAAGCTGTCTGG - Intergenic
1062887483 10:1028791-1028813 CCTGCAAAGGAGTAGCTTGCTGG - Intergenic
1064154325 10:12891083-12891105 GTAGGAAGGGGGAAGCTGGCAGG + Intergenic
1064155165 10:12897856-12897878 GCTGGAAGGAAAATGCTGGCTGG + Exonic
1064576256 10:16748839-16748861 CATGGAAGGGAGAGCCCGGCTGG - Intronic
1065795449 10:29303291-29303313 CCAGGAAGGTAGAACCAGGCAGG - Intronic
1065849567 10:29775978-29776000 CCAGTAAGGAAGAAGCAGGCAGG - Intergenic
1065916598 10:30358542-30358564 CCTGGAAGAGAGGGGCTGGAAGG - Intronic
1065918509 10:30371388-30371410 CCTGGAAGGCAGAGGCTGCAGGG + Intronic
1065953947 10:30677093-30677115 CCTGGAAGGGAGACCTTGCCTGG + Intergenic
1066117477 10:32253465-32253487 CCTATGAGGGAGAAGCTGCCAGG - Intergenic
1066758890 10:38736732-38736754 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1066962746 10:42236036-42236058 CCTGGCACGGAGCAGCTGGGCGG + Intergenic
1069951840 10:72024425-72024447 CCTGGCAGGGAAGAGCTGGTGGG - Intergenic
1070778216 10:79122585-79122607 GTTGGAAGGGAGGAGCTGGGGGG - Intronic
1070977070 10:80614012-80614034 CTTGGAAAGGAGAAGCTGTGGGG + Intronic
1072459425 10:95605584-95605606 ACTGGCAGGGAGGAGCTGGGGGG + Intergenic
1073441788 10:103556550-103556572 CCTGGAAGGGAGAAGCCACCTGG - Intronic
1074730152 10:116363234-116363256 GGAGGAAGGGAGATGCTGGCAGG + Intronic
1075396061 10:122128035-122128057 ACTGCAAGGCAGAAGGTGGCAGG + Intronic
1075405003 10:122188940-122188962 CATGGAAGGCAGTACCTGGCTGG + Intronic
1075512196 10:123081524-123081546 CCTGGACAGCAGAACCTGGCTGG - Intergenic
1075913461 10:126146273-126146295 CCTGTGAGGGAGAGGCAGGCAGG + Intronic
1076082816 10:127598952-127598974 ATTGGCAGGGAGAAGCTGGCTGG + Intergenic
1076569045 10:131420371-131420393 CAAGGGAGGAAGAAGCTGGCTGG + Intergenic
1076909138 10:133378864-133378886 CCATGGAGGGAGAAGCCGGCCGG - Intergenic
1077021346 11:418453-418475 CATGGAAGGCAGAGGCTGGGTGG - Exonic
1077168787 11:1157211-1157233 CCAGGGAGGGTGAGGCTGGCTGG + Intergenic
1077442197 11:2574097-2574119 CCCCGAGGGGAGTAGCTGGCTGG + Intronic
1077504761 11:2924818-2924840 ACTGGAGGTTAGAAGCTGGCAGG + Intronic
1078083250 11:8218756-8218778 GGTGGCAGGGAGAAGCTGGAGGG - Intergenic
1080008957 11:27438406-27438428 CTTGGCAGGCAGAAGCTGGGAGG + Intronic
1081508666 11:43745067-43745089 GCCGGAAGGGAGGATCTGGCTGG + Intronic
1081570820 11:44289790-44289812 CCTTGAGGAGAGAAGCTGACAGG - Intronic
1081600412 11:44488683-44488705 CCTGGGAGGAAGGATCTGGCAGG + Intergenic
1081602217 11:44503424-44503446 CTTGGAAGGGCAAAGCTGGAAGG + Intergenic
1082812864 11:57489170-57489192 CCTGGAAGGCAGGTGCTGGATGG + Intronic
1083428107 11:62599728-62599750 CCTGGAAGTTAGAAGATGGCTGG - Intronic
1083961074 11:66015384-66015406 CCTGGGAGTGAGAAGCTGAGGGG + Intergenic
1084113412 11:67027870-67027892 CCGGCAAGGCAGAAGCAGGCTGG + Intronic
1084358136 11:68652841-68652863 CCTGGAAAGGAGAAGAGGGCGGG + Intergenic
1084440653 11:69170939-69170961 TCTGGAGGTGGGAAGCTGGCTGG - Intergenic
1084737265 11:71113616-71113638 CCTGCAGGTGAGAAGCTGGGAGG + Intronic
1085350066 11:75792556-75792578 CCAGGAAGGGAGTAGGTGGGCGG - Intronic
1085483408 11:76841607-76841629 GCTGGAAGGGAGAGACTGGTGGG - Intergenic
1086464458 11:87038371-87038393 CCTGCAAGGGAGAAGGAGGAGGG + Intronic
1088933738 11:114378077-114378099 CCTGGTAGGAGGGAGCTGGCTGG + Intergenic
1089127758 11:116189409-116189431 GCTGGAAAGGAGAGGCTGGATGG - Intergenic
1090187764 11:124749456-124749478 CCTGGAAGAGAGTAGAGGGCAGG - Intronic
1090287548 11:125512868-125512890 CCTGGGAGGGTGAAGCTGCAGGG + Intergenic
1090771341 11:129922044-129922066 GGTTGAAGGGAGAAGCTGGGAGG - Intronic
1091016615 11:132056930-132056952 CCTGGAACCAAGAAGCTGTCTGG - Intronic
1091283965 11:134397790-134397812 CCTGGCAGAGAGGAGCAGGCAGG - Intronic
1091636363 12:2199917-2199939 CCTGGGAGTGAGGAGCTGGGAGG - Intronic
1091911255 12:4232361-4232383 CCAGGCTGGGAGAAACTGGCTGG + Intergenic
1092615238 12:10210975-10210997 CCCGGAAGGGAGAACCCGGGAGG - Intergenic
1092743195 12:11649733-11649755 CCTGGAAGAGAGAAACTGAAAGG - Intergenic
1094813693 12:34164516-34164538 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1096988292 12:55776943-55776965 CCTGAAAGGGAGAAGAGTGCTGG - Intronic
1097249889 12:57626687-57626709 CCTGGCAGGGACAAGGAGGCAGG + Exonic
1097694425 12:62762874-62762896 CCGAGAAGGGAGAGGCTGGCAGG + Intronic
1098600330 12:72323862-72323884 GGTGGAAAGGAGAATCTGGCTGG + Intronic
1098611445 12:72463413-72463435 ACTGGAAGGCAGAAATTGGCTGG + Intronic
1101376007 12:104172216-104172238 CCTGGAGGGGAGCAGGGGGCGGG + Intergenic
1101467236 12:104960456-104960478 CCTGGGAGGGAGAGGTGGGCGGG + Intergenic
1102190516 12:110984412-110984434 CCTGGAGAGGAAAGGCTGGCTGG + Intergenic
1102533069 12:113561241-113561263 CCTGGAAGGCACACGCCGGCCGG + Intergenic
1103561983 12:121797602-121797624 CAGGGAGGGGAGAAACTGGCTGG + Intronic
1104074378 12:125376651-125376673 CCTGCAGGGGAGAAGCTCCCAGG + Intronic
1104720240 12:131041321-131041343 CCTGGAAGGAGGAAGTTGTCTGG + Intronic
1104769764 12:131354049-131354071 CCAGGGAGGGAGCAGCTGGAAGG + Intergenic
1104950988 12:132439927-132439949 CCGGAAATGGAGAAGGTGGCTGG + Intergenic
1105446561 13:20462151-20462173 TGTGGAAGGGATAAGGTGGCAGG + Intronic
1105628448 13:22136935-22136957 GAGGGAAGGGAGAAGCTGGGAGG + Intergenic
1106483503 13:30154251-30154273 CCAGGGAGGGGGAAGCAGGCAGG - Intergenic
1106927424 13:34628031-34628053 CCTGGAAGGGTGAGGCTGATTGG + Intergenic
1108171622 13:47747958-47747980 CCTGACAAGGAGAAGCTGGCAGG - Intergenic
1108935146 13:55873467-55873489 CCTGTAAGGTAAAACCTGGCAGG + Intergenic
1110031418 13:70619247-70619269 ACTTGAAGGGAGAGGCAGGCAGG + Intergenic
1110700167 13:78537769-78537791 CATGGAAGGGGGATGCCGGCAGG + Intergenic
1111354519 13:87080507-87080529 GCTGGAAGGGGGAAGATGCCAGG + Intergenic
1112384872 13:98930363-98930385 ACTGGATGGGAGAAACTGGAGGG - Intronic
1113676776 13:112213223-112213245 CCTGGAATGGAGCAGGTGCCAGG - Intergenic
1118028254 14:61793203-61793225 CCTGGAAGAGAGCAGCAGTCAGG - Intronic
1118327621 14:64792280-64792302 CCAGGAATGGAGCACCTGGCTGG - Intronic
1118734831 14:68693912-68693934 CCAGGGAGAGAGAAGCTTGCAGG - Intronic
1119085295 14:71733441-71733463 GCTGGAAGGGAGATGATGGGAGG + Intronic
1119268114 14:73277084-73277106 CTTGGAAAGGTGATGCTGGCTGG + Exonic
1119413718 14:74455770-74455792 TCTGGAAGGGAGAGGATGGGAGG - Intergenic
1119428212 14:74549780-74549802 CCTGGAGGGGAAACCCTGGCAGG + Intronic
1119845453 14:77826185-77826207 CCTGGGAAGGGGGAGCTGGCTGG + Intronic
1121427918 14:93865938-93865960 CCTGGAAGGGAGATGGAGGCGGG - Intergenic
1121655024 14:95588632-95588654 CCGGGAAGGGGGAATCTGGCTGG + Intergenic
1121701633 14:95958965-95958987 TCTGTAATGGAGCAGCTGGCAGG + Intergenic
1122233930 14:100321631-100321653 TCTGGAAGGAAGGAGGTGGCTGG - Intergenic
1122314081 14:100815533-100815555 CCTGGAAGGGGTAAGAAGGCAGG - Intergenic
1122314386 14:100817244-100817266 CCTGGCAGGGCGAAGTGGGCAGG + Intergenic
1122634903 14:103125237-103125259 TCTGAAAGGGGGAAGCAGGCAGG - Intronic
1123004883 14:105316357-105316379 CCTGGAATGGAGAAGCAGCCAGG - Intronic
1202929611 14_KI270725v1_random:26303-26325 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1123422686 15:20144920-20144942 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1123442320 15:20301429-20301451 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1123531912 15:21151460-21151482 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1124431818 15:29614735-29614757 CTGGGAAGGTAGAAGGTGGCAGG + Intergenic
1126517035 15:49550079-49550101 CCTGGACGGGGGCGGCTGGCCGG + Intronic
1128204286 15:65837134-65837156 CCTGAAATGGAAAAGCTGTCTGG - Intronic
1129069899 15:72942058-72942080 CCTGGTGTGGAGAAGCTGCCCGG + Intergenic
1129210442 15:74065001-74065023 CCTGGAAAAGAGAGGCTGGAAGG - Intergenic
1129294396 15:74591929-74591951 CCTGGAAGGCAGAACCTGGAGGG - Intronic
1129460688 15:75698707-75698729 CAGGCAAGGGAGAAGCTGTCTGG + Intronic
1129703278 15:77780287-77780309 ACTGAAAGGGAGAACATGGCAGG + Intronic
1129724181 15:77893333-77893355 CAGGCAAGGGAGAAGCTGTCTGG - Intergenic
1129941975 15:79506042-79506064 CCTGGAAGAGAGAAGGGAGCTGG - Intergenic
1129952274 15:79602311-79602333 GCTGGAAAGGAGAAGATGGTTGG + Intergenic
1130514616 15:84616782-84616804 TCTAGAAGAGAGATGCTGGCAGG + Intronic
1132292712 15:100714464-100714486 CCTGGTAGGAAGGAGGTGGCAGG + Intergenic
1133225476 16:4338463-4338485 ACAGGAAGGGGGAGGCTGGCTGG + Exonic
1133864222 16:9626793-9626815 CCTGCAAGGGAGACACTGGATGG + Intergenic
1135468950 16:22712212-22712234 CCTTGAAGGGTGGAGCTGGAAGG + Intergenic
1135859144 16:26038977-26038999 CCTTGAAGGAAGAACCAGGCTGG - Intronic
1136718897 16:32304121-32304143 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136723918 16:32342477-32342499 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136773019 16:32857837-32857859 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1136837270 16:33510385-33510407 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136842246 16:33548521-33548543 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1136862060 16:33710421-33710443 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1136897596 16:34003682-34003704 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1136995744 16:35187198-35187220 CCTGGAATGGCCAAGCAGGCAGG - Intergenic
1137915345 16:52424088-52424110 CCAGGAAGGGATAAGCTGATTGG + Intergenic
1138381751 16:56607648-56607670 CCTGGGAGGGAGGAACTAGCGGG - Intergenic
1138580724 16:57939130-57939152 GCTGGCAGGGAGAGGCTGGAAGG + Intronic
1138580727 16:57939144-57939166 GCTGGAAGGAAGGAGTTGGCTGG + Intronic
1139395822 16:66638092-66638114 TCTGGCAGGGAGAAGCAGTCAGG - Intronic
1139708004 16:68755198-68755220 CCTGGGAGGTTGAAGCTGCCTGG + Intronic
1141284728 16:82660989-82661011 CCAGGAGGGGAGAAGGTGGTGGG - Intronic
1141461279 16:84180028-84180050 CCTGGAAGGAAGAGACTGGGGGG + Exonic
1141615999 16:85209718-85209740 GCTGGGAGGGAGAGTCTGGCAGG + Intergenic
1141627194 16:85267416-85267438 CCTGGCATGGAGGGGCTGGCAGG + Intergenic
1142179605 16:88661701-88661723 CCTGGTAGGGATGTGCTGGCAGG - Intronic
1142440795 16:90096421-90096443 CCTGCAAGGCGGAAGCTGTCTGG + Intergenic
1203002513 16_KI270728v1_random:175288-175310 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203007534 16_KI270728v1_random:213650-213672 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203075444 16_KI270728v1_random:1119947-1119969 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1203123554 16_KI270728v1_random:1558604-1558626 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203134118 16_KI270728v1_random:1711694-1711716 CCTGGCATGGAGCAGCTGGGTGG - Intergenic
1203147446 16_KI270728v1_random:1810664-1810686 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1203152411 16_KI270728v1_random:1848818-1848840 CCTGGCATGGAGCAGCTGGGTGG + Intergenic
1142612217 17:1115309-1115331 CCTGGAAGTGAGAACGTGCCAGG - Intronic
1142894358 17:2964365-2964387 CCTGGGGGAGAGGAGCTGGCGGG + Intronic
1143016296 17:3892848-3892870 CCTGCAAGGGAGAGGCGGGGGGG - Intronic
1143524185 17:7462857-7462879 GCTGGAACGGAGGAGCTGGGAGG - Exonic
1143563543 17:7708718-7708740 CCTGGGAAGGAGAACCTGCCAGG + Exonic
1143652062 17:8269246-8269268 CCTGGAAGGGAGCTGCTGACTGG + Exonic
1144624149 17:16836209-16836231 CCTGGAATGGGGAACTTGGCGGG - Intergenic
1144639777 17:16930993-16931015 CCTGGAAGGGCCAGGGTGGCCGG - Intronic
1144780692 17:17807055-17807077 CCTGGAAGGGACAAAATAGCAGG + Intronic
1144834198 17:18148412-18148434 CCTGAAAGGAAGAAGCAAGCAGG + Intronic
1144882277 17:18436510-18436532 CCTGGAATGGGGAACTTGGCGGG + Intergenic
1145149957 17:20507876-20507898 CCTGGAATGGGGAACTTGGCGGG - Intergenic
1145289298 17:21530596-21530618 CCTGGAAGTTACAAGCAGGCAGG - Exonic
1145984539 17:29036484-29036506 CCTGGAAGTGAGGGGCAGGCAGG - Intronic
1146161886 17:30564514-30564536 CCTGGAATGGGGAACTTGGCGGG - Intergenic
1146275515 17:31513427-31513449 CCTGGAGGGGAGATGCTGGAAGG - Intronic
1146573780 17:33974539-33974561 CTAGGAAAAGAGAAGCTGGCTGG - Intronic
1147161027 17:38569481-38569503 CCTGGCAGGGAGGAGTTGGAAGG + Intronic
1147952016 17:44112652-44112674 CCTGACTGGCAGAAGCTGGCTGG - Intronic
1148052878 17:44777791-44777813 AGTTGAAGGCAGAAGCTGGCAGG - Exonic
1148093875 17:45039230-45039252 CCTGACAGGGAGCTGCTGGCAGG - Intronic
1148615628 17:48997998-48998020 CCGGGAAGAGAGGAGTTGGCGGG - Intronic
1149298983 17:55286847-55286869 CATGGAAGGAAGAAGCAGCCTGG - Intronic
1150207717 17:63421379-63421401 GCTGGATGGAAGAAGATGGCCGG - Exonic
1150213150 17:63452568-63452590 CCTGGAGGGGAGAGGCGGCCAGG - Intergenic
1150681687 17:67289800-67289822 CCTGGAAGGGAGCAGCAGGCTGG + Intergenic
1151318456 17:73338176-73338198 GCTGGAAGGGGGCAGCTGGCTGG + Exonic
1151646208 17:75433763-75433785 CCTGGAAGGCAGCAGCAAGCAGG + Intergenic
1151733313 17:75923533-75923555 CCAGGAAGGGAGGAGCTGACTGG - Exonic
1151816558 17:76474142-76474164 CCTGGAGGGCAGAAGAAGGCTGG + Exonic
1151963680 17:77420240-77420262 TCAGGAAGAGAGAAGCGGGCCGG + Intronic
1152307051 17:79527221-79527243 CCTGGCAGGGAAGAGGTGGCAGG - Intergenic
1152471244 17:80491095-80491117 CCTGGAAGGGCTAAGCTACCTGG + Intergenic
1152636106 17:81431126-81431148 TCTGGCTGAGAGAAGCTGGCGGG - Intronic
1152956758 18:47136-47158 CCTGCAAGGCGGAAGCTGTCTGG - Intergenic
1154415802 18:14174624-14174646 CCTGGCACGGAGCAGCTGGGAGG + Intergenic
1155047755 18:22117842-22117864 ACTGGAAGAGAGAAGCTTGAAGG - Intergenic
1155956730 18:31960982-31961004 CCCGGAAGGGGGCGGCTGGCCGG - Intergenic
1156479392 18:37426623-37426645 CCTGGAAGGAAGAAGGAGGCTGG - Intronic
1157173963 18:45433867-45433889 CCTGGAAGGGGGAAGATGGATGG + Intronic
1157446042 18:47747658-47747680 GCTGGAAGGGAAAGGCAGGCAGG - Intergenic
1157584638 18:48793241-48793263 CCTGCCAGGGAGAAGCAGGGAGG + Intronic
1157594241 18:48854222-48854244 CCTGGGAGTGAGAAGCAGGGAGG + Intronic
1157694169 18:49707795-49707817 ACTGCAGGGCAGAAGCTGGCTGG - Intergenic
1157885862 18:51365673-51365695 TCTGGAAAGGAGAAGAGGGCTGG + Intergenic
1158227761 18:55218352-55218374 GAAGGAGGGGAGAAGCTGGCTGG - Intergenic
1158564756 18:58545391-58545413 CCTGGTAGGGATTAGCTGGAAGG + Intronic
1158675771 18:59516740-59516762 CTTGGAAGGCAGAATGTGGCAGG + Intronic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160514819 18:79472422-79472444 CCTGGGAAGGAGAGGCTGCCGGG - Intronic
1160662198 19:306349-306371 GCTGGAAGGGACTAGGTGGCCGG + Exonic
1160748555 19:722922-722944 CCAGGAAGGGAGGAGCCGGTGGG + Intronic
1160874711 19:1291596-1291618 CCTGGAAGAGAGATGCAGACGGG + Intronic
1160898051 19:1412055-1412077 CCTGGGAGGGCGGGGCTGGCAGG + Intronic
1161010377 19:1956973-1956995 CCTGGAAGAGAGAAGGAGGGAGG + Intronic
1161494235 19:4578991-4579013 CCGGAAAGGGAGATGCTGGAGGG - Intergenic
1161498626 19:4600850-4600872 CTGAGAAGGGAGCAGCTGGCAGG - Intergenic
1162346193 19:10119439-10119461 CCTGGAGGGGAACAGCTGGGAGG + Intronic
1162359577 19:10210460-10210482 CCTGGCAGGCAGAAGGAGGCTGG - Intronic
1162826377 19:13254902-13254924 GCTGGGAAGAAGAAGCTGGCCGG + Intronic
1163102703 19:15107678-15107700 CCTGGAAGGAAGGGGCTGGGAGG + Intronic
1163158671 19:15452433-15452455 CCTGGATGAGAGAATCTGCCAGG + Intronic
1163515257 19:17759014-17759036 CCTGGGAGGGTGAACCTGGTAGG + Intronic
1163584898 19:18158190-18158212 TCAAGAAGGGAGAAGCGGGCCGG + Intronic
1163632930 19:18426310-18426332 CCTAGAGGCGAGAAGCAGGCAGG - Intronic
1164577128 19:29412051-29412073 TCTGGAAAGGGGAAGCTGGGAGG - Intergenic
1164809761 19:31146924-31146946 GCTGGAAGGAAGATGCTGTCAGG + Intergenic
1164912800 19:32026267-32026289 CATGGGAGGGAGGAGCTGCCAGG - Intergenic
1164925799 19:32129104-32129126 CCTGGAAGGCAGAACTTGGTGGG - Intergenic
1165069331 19:33246834-33246856 CCCAGAAGGGAGGAGCTGCCAGG - Intergenic
1165469757 19:35996406-35996428 CCTGGAAGGGACCATCTGGGAGG + Intergenic
1165489644 19:36115728-36115750 CCCGGAAGGGGGAGGCTGGGAGG + Intronic
1165691219 19:37865171-37865193 CCTTGAAAGGAGAAGCTGATTGG + Intergenic
1165951563 19:39476387-39476409 CCTGGAAGCCTGAAGCAGGCAGG + Exonic
1166082408 19:40452249-40452271 GCTGGGAGGCAGAACCTGGCTGG - Intronic
1166225538 19:41392793-41392815 GCTGGTAGGGAGGAGCTGGGGGG + Intronic
1166369101 19:42291559-42291581 CCTGCACGGGAGAAACTGACTGG - Exonic
1166701725 19:44886065-44886087 CCTGGCAGGGAGAAGCTGGCTGG + Intronic
1166835285 19:45664041-45664063 GGGGGAAGGGAGAGGCTGGCAGG - Intergenic
1168246548 19:55115553-55115575 CCTGGGAGGGAGAGCTTGGCAGG - Intronic
925108091 2:1310220-1310242 CCTGGAAAGGAGGAGCTCACAGG - Intronic
925179383 2:1807089-1807111 TCTGGAAGGCAGAAACTGACAGG + Intronic
925326738 2:3028244-3028266 CCTGGAAAAGAGAAGCTTCCTGG - Intergenic
925412371 2:3647432-3647454 GCAGGATGGGAGAAGCAGGCAGG - Intergenic
926109729 2:10174111-10174133 CGTGGCAGAGAGAAGGTGGCAGG - Intronic
926295416 2:11565309-11565331 CCTGTGGGGGAGACGCTGGCAGG - Intronic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
928212825 2:29336340-29336362 CCTGGAAGGGAGAAGGCTTCAGG - Intronic
928377792 2:30790041-30790063 TGGGGAAGGGAGAAGCAGGCAGG + Intronic
928892795 2:36223957-36223979 TCTGGAAGCCAGAAGTTGGCAGG - Intergenic
929819268 2:45260303-45260325 CCTGAAAGGAAGAGGCTGGAAGG - Intergenic
929961900 2:46503249-46503271 TCTGGAAGGTAGAAGGAGGCAGG + Intronic
930021862 2:47006570-47006592 CCTGGAAGGGTGCGGATGGCTGG + Intronic
932252589 2:70257899-70257921 CATCGAAGGCAGAAGCTGGCCGG - Intronic
932731777 2:74226857-74226879 ACAGGAAGGCAGAAGGTGGCAGG + Intronic
932877082 2:75463973-75463995 TCTGTAAGTGAGAAGCTGGTGGG - Intergenic
934322217 2:91981072-91981094 CCTGGCATGGAGTAGCTGGGCGG - Intergenic
934460505 2:94211863-94211885 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
934523341 2:95033427-95033449 CCAGGGAGGGAGAAGCCGGCTGG + Intronic
935617822 2:105103669-105103691 GCTGGAATGGAGCAGATGGCCGG - Intergenic
937509431 2:122577457-122577479 CCAGAAAGGTAGAAGCTCGCTGG + Intergenic
938058249 2:128233085-128233107 CCTGGAAGGGAAGAGCAGGGAGG - Intergenic
938114891 2:128596256-128596278 CCTGGCAGGAAGAATCTGGAGGG + Intergenic
938262419 2:129905371-129905393 CCAGGAAGGGCAAAGCTGGAGGG + Intergenic
938291673 2:130153935-130153957 CCTGCAAGGGAGGCGCGGGCAGG + Exonic
938370773 2:130767125-130767147 CCATGAAGGGAGAAGGTGGCTGG + Exonic
938770178 2:134494974-134494996 CCTGGGAGGGAGAACCTGGGAGG - Intronic
940065235 2:149620308-149620330 CCTGGAAGGAAGAAGATCTCAGG - Intergenic
940944199 2:159597750-159597772 CATAGAAGGGAAAACCTGGCTGG - Intronic
941840334 2:170076105-170076127 CCTGGGAGAGAGAATCTGGTTGG + Intronic
943645820 2:190407789-190407811 CCCGGGAGGGAGGAGCCGGCGGG - Intergenic
945068407 2:205966722-205966744 TCTGGAGGGGAGAGGCTGGAGGG + Intergenic
945072983 2:206009595-206009617 ACTGGCAGTGAGACGCTGGCGGG + Exonic
945305363 2:208254690-208254712 CCTGGGAGGGAGAAACTGGGCGG - Intronic
946865335 2:224037366-224037388 CCCGGAAGGAAGGAGCTTGCGGG + Intronic
947140634 2:227016705-227016727 CATGGAGGGGAGAGACTGGCTGG - Intronic
947543084 2:230991768-230991790 CCTGGCAGGGTGGAGCTGGCAGG - Intergenic
948979112 2:241483748-241483770 CCTGGAATGAAGAAGGAGGCTGG - Intronic
1168892114 20:1301307-1301329 CTTGGAGGGTAGAAGCTGGGAGG - Intronic
1169553239 20:6722836-6722858 CCCTGAAGGGAGAATTTGGCTGG + Intergenic
1169815479 20:9651702-9651724 CCTGGGAGGAAGTAGTTGGCAGG + Intronic
1170488077 20:16840499-16840521 CCTAGAAGAGAGAAGCTGGTTGG + Intergenic
1171346785 20:24471168-24471190 CCTAGCACGGAGAAGTTGGCCGG - Intronic
1172134733 20:32679313-32679335 GCTGGAGGGAAGAAACTGGCAGG + Intergenic
1172529264 20:35618879-35618901 CCTGGAGGGGCGAGGCTTGCGGG - Intronic
1172875334 20:38160688-38160710 CATGGAAGGCTGAAGCTAGCTGG + Intronic
1173120230 20:40282377-40282399 CCTGGAAGGAGGCAGCTGGAAGG - Intergenic
1174713969 20:52737029-52737051 CAAGAAAGGGAGAAGCTGGAGGG + Intergenic
1175115178 20:56677013-56677035 CGAGCAATGGAGAAGCTGGCGGG - Intergenic
1175162676 20:57020736-57020758 CCTGCAGGGGAGGAGCTGGGAGG - Intergenic
1175563522 20:59953859-59953881 CATGGCAGGCAGAAGCTGGAAGG - Intergenic
1175743600 20:61437575-61437597 TCAGGGAGGGAGATGCTGGCTGG + Intronic
1175908253 20:62392325-62392347 ACTGGAGAGGAGAGGCTGGCAGG + Intronic
1175995814 20:62811948-62811970 CCTGGTGGGGAGGAGCTGGCTGG - Intronic
1176030751 20:63010000-63010022 CCTGCAGGCAAGAAGCTGGCTGG - Intergenic
1176158850 20:63638340-63638362 TCTGCAAGGGAGAAGATGGCAGG - Intergenic
1176191311 20:63811407-63811429 CCTGGAAGTCAGAAGCTGGGAGG - Intronic
1176243257 20:64084740-64084762 CCGGGAAGGGAGGAGCCAGCTGG - Intronic
1176286356 21:5021250-5021272 CCTGGGAGGGGGAAGCCGCCCGG + Intergenic
1176591633 21:8654902-8654924 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1176857538 21:13984680-13984702 CCTGGCACGGAGCAGCTGGGAGG - Intergenic
1177195330 21:17898714-17898736 TCTGGAAGGCAGCAGATGGCTGG + Intergenic
1179126532 21:38595776-38595798 CCTGGAGGGCAGAACCTCGCTGG + Intronic
1179163866 21:38919921-38919943 CCAGGAAGGAAGAAACTGGTGGG - Intergenic
1179494066 21:41760657-41760679 TGTGGAGGGGAGAAGCTTGCAGG + Intronic
1179722747 21:43324744-43324766 CCTGGCAGGGAGGAGCTGAAGGG + Intergenic
1179870825 21:44242225-44242247 CCTGGGAGGGGGAAGCCGCCCGG - Intergenic
1180060501 21:45382599-45382621 CCTGGTAGGGAGCAGCCTGCGGG + Intergenic
1180172472 21:46066986-46067008 CGTGGAAGTGAGAAGCCAGCAGG + Intergenic
1180274481 22:10632014-10632036 CCTGGCACGGAGCAGCTGGGTGG - Intergenic
1180548970 22:16526991-16527013 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1180901312 22:19375429-19375451 CCTTGAAGTGGGAAGGTGGCTGG - Intronic
1181179475 22:21056751-21056773 CCTGGGAGGGAAAGGCTGGGAGG - Intronic
1181616952 22:24061431-24061453 CCTGGTGGGCAGAAGCTGCCAGG - Intronic
1181645069 22:24226531-24226553 CCTGGTAGGGGGAAGTTGGAGGG - Intronic
1181776195 22:25161612-25161634 GCTGGAAGGGAGCTGCTGGAGGG + Intronic
1182127408 22:27826130-27826152 GCTGGAATGGAGCAGCTTGCGGG - Intergenic
1182360807 22:29745349-29745371 GCTGGAAGGGAGAGGCCGGCAGG + Intronic
1182418846 22:30238819-30238841 CTTGGGAGGGAGAGGCCGGCAGG - Intergenic
1183809044 22:40238506-40238528 GGTGTAAGGGAGAAGGTGGCAGG - Intronic
1184369507 22:44073743-44073765 TCTGAAAGGGAGAAGCAGGTAGG + Intronic
1184388682 22:44190732-44190754 CCTGCATGGGTGGAGCTGGCTGG + Intronic
1184980084 22:48089710-48089732 CCTGGGACGGAGACGCTGGGAGG - Intergenic
1185160704 22:49227914-49227936 CCAGGAAGAGAGAAGCTGGCAGG + Intergenic
949119100 3:364002-364024 GGTGGAAGTGAGAAGCAGGCTGG - Intronic
949608892 3:5683533-5683555 TCTGAAATGGAGATGCTGGCAGG + Intergenic
950672405 3:14535186-14535208 CATGGTGGGGCGAAGCTGGCTGG - Intronic
950712056 3:14819831-14819853 CCTGAGAAGGAGGAGCTGGCCGG + Exonic
950856083 3:16106628-16106650 GCAGGAAGGCAGATGCTGGCAGG - Intergenic
952900680 3:38109790-38109812 CCTGGCAGGCAGGAGATGGCAGG + Intronic
953412670 3:42698993-42699015 GCTGGCAGGGAGAGGCTGGGTGG + Intronic
954383684 3:50233203-50233225 ACTGGAAAGGAGCAGCTGACTGG + Intronic
954400031 3:50314671-50314693 CCTGGGATAGAAAAGCTGGCAGG + Intergenic
954584297 3:51720462-51720484 CTTGGGATGGGGAAGCTGGCGGG - Intergenic
956153403 3:66267562-66267584 CCTGAAGGTGAGAAGCTGGTTGG + Intronic
956656657 3:71559101-71559123 AGAGGAAGAGAGAAGCTGGCTGG - Intronic
957792694 3:84959943-84959965 CGTGGGAGGGGGATGCTGGCGGG - Intronic
957921087 3:86749101-86749123 TTTGGAATGGAGGAGCTGGCTGG - Intergenic
958059614 3:88462660-88462682 CTTGGGAGGGTGAAGCTGCCAGG + Intergenic
958828047 3:99055879-99055901 CTTGGGAGGGGGACGCTGGCAGG + Intergenic
959693900 3:109229342-109229364 CTTGAAAGAGAGAAGTTGGCTGG + Intergenic
959786583 3:110306161-110306183 CATGGAAGGGAGAAATTTGCAGG + Intergenic
960749915 3:120937072-120937094 CCTGGAAGGCTGGAGATGGCTGG + Intronic
960947072 3:122974138-122974160 GCGGGGAGGGAGAAGCCGGCAGG + Intronic
961058894 3:123811812-123811834 CCTGGAGGGGCCTAGCTGGCTGG - Intronic
961627283 3:128272792-128272814 GCTGGAAGGGACAAGGTGGGAGG + Intronic
961774265 3:129272725-129272747 CCTGCAGGGGACAAGCAGGCAGG - Intronic
961831219 3:129623872-129623894 GCTGGAGGTGAGAACCTGGCTGG - Intergenic
962262908 3:133926392-133926414 CTTGGAAGAGGGAACCTGGCTGG - Intergenic
962859808 3:139389378-139389400 CCAGGAAGGGAGAAGGCGGTGGG - Intronic
963076756 3:141354438-141354460 CCAGGGAAGAAGAAGCTGGCTGG - Intronic
963788754 3:149561860-149561882 CCTGGAAAGGAGAAAAGGGCTGG + Intronic
963814340 3:149813006-149813028 CCTGGAAGGGAAGAGCAGGGTGG - Exonic
964502474 3:157363657-157363679 TCTGAAAGAGAGATGCTGGCTGG + Exonic
967758932 3:193202286-193202308 CCTGGGAAGGAGAAGATGGAAGG + Intergenic
968075993 3:195816401-195816423 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076105 3:195816820-195816842 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076118 3:195816864-195816886 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076156 3:195816998-195817020 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076181 3:195817081-195817103 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076205 3:195817165-195817187 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076218 3:195817209-195817231 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076267 3:195817387-195817409 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968076305 3:195817520-195817542 CCTGGTAAGGAGAAGGAGGCCGG - Intergenic
968091258 3:195899791-195899813 CCCTGAAGGGAGAACCTGGCAGG + Intronic
968357555 3:198121010-198121032 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
968966337 4:3770807-3770829 GCTGCAGGGGAGAAGCTGGTGGG + Intergenic
969857733 4:10013838-10013860 GCTGGAAAGGCGAAGCTGGCTGG + Intronic
969947689 4:10801327-10801349 CCTGTAGGGGACAGGCTGGCTGG - Intergenic
970160166 4:13180218-13180240 TCTGAAATGGAGATGCTGGCAGG + Intergenic
970944543 4:21675293-21675315 GCTGGAAGGGAGAAGTTGTGGGG + Intronic
971287898 4:25307985-25308007 ACTGGAAGGCAGAGGCTGCCGGG + Intergenic
972678151 4:41280093-41280115 CCTGGAAGGCGGAAGGTGGAAGG - Intergenic
973271170 4:48264582-48264604 CATGGTAGGGGGAATCTGGCTGG - Intronic
973731003 4:53822238-53822260 CCAGGCAGGGAGAAGGTTGCAGG + Intronic
975811697 4:78176547-78176569 CCTGGAAATGAGAAGGTGTCAGG - Intronic
978644656 4:110915601-110915623 CATGGAAGGGAGATGGTAGCCGG + Intergenic
981532425 4:145765268-145765290 CCTGGAAGGGTATAGCTGTCAGG - Intronic
981748012 4:148069367-148069389 CCTGGAAGGCAGAAGCCAGTAGG - Intronic
981748605 4:148073150-148073172 CCTGGAAGGCAGAGGCATGCTGG - Intergenic
983192879 4:164773192-164773214 CTTGGTAGGGAGAAGGAGGCTGG + Intergenic
984884312 4:184436652-184436674 CTAGGCAGGGAGAAGGTGGCAGG + Intronic
985133891 4:186766266-186766288 CCTGTTAGGGAGCAGCTAGCAGG + Intergenic
985440986 4:189982254-189982276 CCTGCAAGGCGGAAGCTGTCTGG - Intergenic
985876455 5:2602323-2602345 CCTGGAAGGACGAATCTGGTTGG - Intergenic
985926696 5:3024827-3024849 CCTTGAAGGGAGAGGACGGCTGG - Intergenic
986221485 5:5772585-5772607 CCTGGAGGGAAGGATCTGGCAGG - Intergenic
987508318 5:18800898-18800920 TCTGTAATGGAGCAGCTGGCAGG + Intergenic
988124877 5:27017785-27017807 CTTGGGAGGTAGAAGCTGGCAGG + Intronic
988329838 5:29821756-29821778 CCTGGAAAGGATAAGCTACCAGG - Intergenic
989195239 5:38709845-38709867 GCTGGAAGAGAGGAGCTGGAAGG - Intergenic
996760306 5:126980190-126980212 CCTGGAAGTGACAAGTGGGCTGG + Intronic
996830258 5:127732834-127732856 CCTGCAAGGGTGAGGGTGGCAGG + Intergenic
997369463 5:133348857-133348879 CCTGGAACAGAGAAACTGCCTGG + Intronic
997537224 5:134632404-134632426 CCTGGTAAGGTGAAGGTGGCGGG - Intronic
997632180 5:135377192-135377214 CCTGGGAAGGAGAAGGTGCCTGG + Intronic
998703988 5:144737915-144737937 CCAGGAAGGGTGAGGTTGGCCGG + Intergenic
1000726061 5:164772624-164772646 CCTGTAAGAAAGAAGTTGGCCGG + Intergenic
1001278226 5:170366386-170366408 CCTGGAAGGGAGAAGCTGGCTGG + Intronic
1001592872 5:172878326-172878348 CCTGGAAGAGGGAAACAGGCTGG - Intronic
1002307737 5:178293685-178293707 TCTGGCATGGGGAAGCTGGCAGG + Intronic
1003114926 6:3277357-3277379 CCTGGAAGGGTGAGGGTGGGCGG - Intronic
1003864080 6:10347753-10347775 GGTGGAAGGGAGAGGGTGGCTGG + Intergenic
1003882482 6:10491123-10491145 CATTGAAGGGAGATGCTGGCTGG - Intergenic
1004281422 6:14282597-14282619 CAGGGATGGGAGAAGCAGGCAGG + Intergenic
1005445693 6:25920226-25920248 CCTAGGAGTGAGAAGCTGGATGG + Intronic
1005806168 6:29476170-29476192 CCTGCAATGGAGAATCTGGGAGG - Intergenic
1006188297 6:32192516-32192538 CCTAGAGGGGAGAAACTGGTGGG + Exonic
1007402390 6:41610815-41610837 CCTGGGTGTGAGAAGCTGGATGG + Intergenic
1007995373 6:46302236-46302258 CCTGAAATGGAGAAAATGGCAGG + Intronic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008595272 6:53035717-53035739 GCTGGAATGAAGCAGCTGGCAGG + Intronic
1009439281 6:63657083-63657105 CCTGGAAGACAGATGTTGGCTGG + Intronic
1010428220 6:75749362-75749384 CCTGTACGGGTGAAGCTGGAGGG - Exonic
1014035739 6:116765356-116765378 CCTGGGAGGGAGGAGGTTGCGGG - Intronic
1014314735 6:119849477-119849499 ACTTGAAGGGAGAAGCTCTCAGG - Intergenic
1015688778 6:135896822-135896844 GCTGGAAGGAAGGAGCTGGAAGG - Intronic
1016086358 6:139920126-139920148 CCAGGAAGGGGGACGCTGGTGGG - Intergenic
1017126595 6:151070389-151070411 ACTGAAAGAGAGAAGCTGGTTGG - Intronic
1017133936 6:151132009-151132031 CCTAGAAGAGAGCAGGTGGCCGG + Intergenic
1017250494 6:152275003-152275025 CTGGGATGGGAGAAGCTGGGAGG - Intronic
1018041382 6:159926024-159926046 CTAGGAAAGGAGAAGCAGGCTGG - Intergenic
1018474168 6:164123739-164123761 CCTGGAGGGGAGGAGCCGTCTGG - Intergenic
1018811962 6:167304941-167304963 CCTTGAGGGGAGAAGGTGGCAGG - Intronic
1018968639 6:168509041-168509063 CCTGGACGGGACTAGTTGGCCGG + Intronic
1019021100 6:168918414-168918436 CATGGCAGAGAGAAGCTGCCAGG - Intergenic
1019073872 6:169371249-169371271 CCTGGGAGAGAGAGGCTGGTAGG + Intergenic
1019167479 6:170108357-170108379 CCTGGAAGTGTGGAGGTGGCCGG - Intergenic
1019167498 6:170108430-170108452 CCTGGAAGTGCGGAGGTGGCCGG - Intergenic
1019524147 7:1473207-1473229 CCTGGGAGGAAGACGCTGGCAGG + Intronic
1019539026 7:1543317-1543339 ACTGGAAGGGAGAGGCTGCATGG - Exonic
1019619068 7:1980677-1980699 CCTGGAAGCCTGAAGCTGCCAGG + Intronic
1021483476 7:21143746-21143768 CCTGGATGGAGGAAGCTGGTTGG + Intergenic
1022728103 7:32998745-32998767 CCGGGGAGGGTGAAGCAGGCAGG + Intronic
1023568944 7:41552868-41552890 TCTGCAAGGCAGCAGCTGGCAGG - Intergenic
1023996040 7:45159382-45159404 TCTGGAAGGAAGGAGCTGGGTGG + Intronic
1024975344 7:55109048-55109070 GCTGCAAGGGAGAAGGTGGGAGG + Intronic
1027201897 7:76069251-76069273 CCTGGAAGGCAGGAGCTAGAGGG - Intergenic
1028521030 7:91731006-91731028 CCTGGGAGGCCGAGGCTGGCGGG - Intronic
1028794114 7:94885003-94885025 CCTAAAAGGAAGAAGCTGGCCGG - Intergenic
1030196725 7:106859957-106859979 CATGGAAGGGAGGGGCTGTCTGG + Intergenic
1034655423 7:152725656-152725678 CCTGGAAGGTAGAGGCTGCAGGG - Intergenic
1034718729 7:153267649-153267671 CCTGGAAAGGAGACCCTTGCAGG - Intergenic
1035177765 7:157064442-157064464 CCTGGAAGGTAGGCGATGGCTGG + Intergenic
1035665608 8:1377589-1377611 CCAGGAAAGGTGAAGCTGGGAGG + Intergenic
1036685676 8:10908411-10908433 CCTGGGAGGGGGAAGCAGGCTGG - Intronic
1037345237 8:17891793-17891815 GCTGGAAGGGTGAAGATGGAGGG - Intronic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1038454807 8:27666285-27666307 CCTGGAGGGGAAAAGATGTCAGG + Intronic
1039755595 8:40518788-40518810 CCTGGCAGGGAGGAGAGGGCTGG - Intergenic
1040576707 8:48658760-48658782 CCTGGAACGGATAGGCTGTCCGG + Intergenic
1042668684 8:71235455-71235477 TCAAGAAGGGAGAAGCTGGGAGG - Intronic
1043163922 8:76879770-76879792 CCAAGAAGGGAGATGCTGGCTGG - Intergenic
1043393334 8:79812290-79812312 CCTGGAAGGGAGAAGGGGAAGGG + Intergenic
1045343949 8:101277871-101277893 ATTGGAAGAGAGAAGCAGGCAGG - Intergenic
1045396948 8:101770535-101770557 CCTGCAAAGAAGAAGCAGGCTGG + Intronic
1045694925 8:104798174-104798196 ACTGGAAGGGAAGAGCAGGCAGG - Intronic
1047585587 8:126268712-126268734 GCTGGCTGGGAGAGGCTGGCTGG - Intergenic
1047681071 8:127254580-127254602 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1048199262 8:132358184-132358206 CCTTGAAGGGAGAAGTTTTCTGG - Intronic
1048493626 8:134917218-134917240 CCTGGAGGAGAGAACCTGACTGG - Intergenic
1049170073 8:141154386-141154408 CTTGGAGGGGCGGAGCTGGCTGG + Intronic
1049319739 8:141989736-141989758 CCTGGAGGGGAGAGGGTGGTGGG - Intergenic
1049334719 8:142077259-142077281 TCTGGGAGGGTGAGGCTGGCTGG - Intergenic
1049365017 8:142232908-142232930 CCTGGAAGGGAGGAGCTGCCTGG + Intronic
1049422432 8:142522895-142522917 GCTGCCAGGGAGAAGCTGGCTGG - Intronic
1049614175 8:143569064-143569086 CCTGGGAGGGAGAAACTGGAGGG + Intronic
1049614262 8:143569289-143569311 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049614294 8:143569364-143569386 CCTGGGAGGGAGAGACTGGAAGG + Intronic
1049696010 8:143984686-143984708 CCAGGATGTGTGAAGCTGGCAGG - Exonic
1049778388 8:144416534-144416556 GCTGGCAGGGCGGAGCTGGCGGG + Intronic
1049790395 8:144469743-144469765 CCTGGAGGAGAGAGGGTGGCTGG + Intronic
1052176731 9:25472103-25472125 CCTGGCTGGGAGGACCTGGCTGG + Intergenic
1052884749 9:33633960-33633982 CCCAGAAGGGAGGTGCTGGCCGG - Intergenic
1052926641 9:34022509-34022531 CCTGGAAGGCAGAAGTTGCTGGG - Intronic
1053691003 9:40587560-40587582 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054273802 9:63049931-63049953 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1054302263 9:63388531-63388553 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054401038 9:64715037-64715059 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054434644 9:65199351-65199373 CCTGGCATGGAGCAGCTGGGCGG - Intergenic
1054495745 9:65822330-65822352 CCTGGCATGGAGCAGCTGGGCGG + Intergenic
1056580324 9:87885043-87885065 GCTGGTGGGGACAAGCTGGCAGG - Exonic
1056689997 9:88799916-88799938 CATGGAAGGGAGAAGAAGCCAGG - Intergenic
1057603057 9:96475703-96475725 CCTGGAAGGTAAGAGCTGCCAGG + Intronic
1058887886 9:109336533-109336555 CCAGAAAGGGAGAATCTGACTGG + Intergenic
1059314118 9:113409995-113410017 CCTGGCTGGGAGTTGCTGGCTGG - Intronic
1059685669 9:116633386-116633408 CCTGGAAGGGGAAACCTGGCTGG + Intronic
1060495743 9:124117621-124117643 CTTGGAATGGAGAGGGTGGCTGG + Intergenic
1060552729 9:124493149-124493171 CCTGGAAGGAAGAGGCACGCGGG + Exonic
1060554478 9:124501212-124501234 CCTGGCAGGGAGATGGTGACCGG + Intronic
1061402920 9:130378285-130378307 GCTGGGAGGGAGAGGCTGGGAGG + Intronic
1062301838 9:135877996-135878018 CCTGGAAGAGAGAAGACAGCTGG + Intronic
1062583255 9:137237487-137237509 TCTGGAAGGGAGAACGTGACTGG - Intergenic
1062621419 9:137423933-137423955 CCGGGAAGGGGGAAGCTGCTGGG + Intronic
1062741403 9:138177500-138177522 CCTGCAAGGCAGAAGCTGTCTGG + Intergenic
1203621660 Un_KI270749v1:133666-133688 CCTGGCACGGAGCAGCTGGGCGG - Intergenic
1187234735 X:17456673-17456695 CCTGCAAGGTAGCAGCTGGTGGG - Intronic
1187319296 X:18226086-18226108 CTGGGAAGAGAGAAGCTCGCTGG + Intergenic
1189376511 X:40470940-40470962 CCTGGAAGGGAGACATTGGTTGG - Intergenic
1197249393 X:124199125-124199147 TCTGGTAGGGAGAAGCCCGCAGG - Intronic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1200234500 X:154461765-154461787 CCTGGGAGGGAGAAACAGGTGGG - Intronic
1201176833 Y:11314863-11314885 ACTGGCAGAGAGAGGCTGGCGGG - Intergenic
1201758789 Y:17516575-17516597 CCTGCAAGGCTGAAGCTGTCTGG - Intergenic
1201784875 Y:17764286-17764308 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1201816677 Y:18141701-18141723 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1201842766 Y:18389415-18389437 CCTGCAAGGCTGAAGCTGTCTGG + Intergenic
1201853441 Y:18514867-18514889 CCTGGAAGGCAGAGGCTGCTGGG + Intergenic
1201879880 Y:18805517-18805539 CCTGGAAGGCAGAGGCTGCTGGG - Intronic
1202344692 Y:23909107-23909129 CCTGGAAGGCAGAGGCTGCAGGG - Intergenic
1202526076 Y:25760976-25760998 CCTGGAAGGCAGAGGCTGCAGGG + Intergenic
1202583938 Y:26405712-26405734 CCTGGCATGGAGCAGCTGGGCGG + Intergenic