ID: 1001278750

View in Genome Browser
Species Human (GRCh38)
Location 5:170370678-170370700
Sequence CTCCCATCTGTCCCTCAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001278750 Original CRISPR CTCCCATCTGTCCCTCAAGG AGG Intronic
902623609 1:17664428-17664450 CTCCCCTCTCTCCCTGCAGGAGG + Exonic
904832277 1:33312716-33312738 CTGCCCTCCATCCCTCAAGGAGG + Intronic
905298706 1:36971541-36971563 CTCCCCTCTGTGCCTTAAGAAGG + Intronic
911470871 1:98316690-98316712 CTTCCATCTGTCACTAAAGTGGG - Intergenic
913393923 1:118345411-118345433 CTCCCACCTGTGGCTGAAGGAGG + Intergenic
915298958 1:154941316-154941338 CTCCCAGGTCTCCCTTAAGGTGG - Intergenic
915466920 1:156103535-156103557 CTCCCATCTCCTCCTCAAGGGGG - Intronic
921260055 1:213378329-213378351 CTCCCACCAGTCCCATAAGGAGG - Intergenic
921619242 1:217308343-217308365 ATCCCAGCTGTACCTCAAGTAGG + Intergenic
922617934 1:226974139-226974161 CTCCCAAAAGTCCCTCTAGGAGG - Intronic
923070819 1:230562880-230562902 CTCCCATCTTTCCCTAAAGCTGG + Intergenic
923527149 1:234781299-234781321 CTCTCCTCCTTCCCTCAAGGTGG - Intergenic
924206271 1:241714132-241714154 CTCCCAGAGGTTCCTCAAGGAGG + Intronic
1063726888 10:8646988-8647010 CTCCCAGCTGTCCATTAACGTGG - Intergenic
1063861716 10:10316180-10316202 TTCCCATCTCTACCTGAAGGTGG - Intergenic
1068045718 10:51883850-51883872 ATCCCATGTGTCCTTCCAGGAGG + Intronic
1068167666 10:53352161-53352183 CTCTCCTCTGTCCCTCAGGCTGG - Intergenic
1069631252 10:69898255-69898277 CTCCCTTCTGTCCCCCAAGCAGG + Intronic
1071430085 10:85600598-85600620 CCCACATCTGTCACTGAAGGAGG - Exonic
1071458672 10:85870815-85870837 CTCCCATCTGGCCCTGAATGGGG - Intronic
1072722968 10:97792112-97792134 CTCCCATGTCTCCGGCAAGGAGG + Intergenic
1074452748 10:113572418-113572440 CTCCCATCTCTCCCACAGGTTGG - Intronic
1075054510 10:119207546-119207568 CTCCCCTCAGTCCCTCCCGGGGG - Intergenic
1077132211 11:978787-978809 CCCCCATGTGTCCTTCAGGGAGG + Intronic
1077331260 11:1984733-1984755 GTCCCCTCTGTCCCTCAGGTAGG + Intergenic
1077670291 11:4151290-4151312 AACCCATCTGTCCCTCAGAGAGG + Intergenic
1078938652 11:15976097-15976119 CTCCCTTCATTTCCTCAAGGTGG - Intronic
1079096015 11:17510664-17510686 GTTCCAACTGGCCCTCAAGGAGG + Intronic
1081430988 11:42976471-42976493 CCCCCATCTCAGCCTCAAGGAGG - Intergenic
1081790097 11:45776359-45776381 CTCACATCCATCCCTCAGGGAGG - Intergenic
1081874720 11:46400855-46400877 CTGCCCTCCATCCCTCAAGGTGG + Intronic
1081963390 11:47154631-47154653 CTGCCATCTGTGCCCCAGGGTGG + Intronic
1082196610 11:49314221-49314243 TTCCCATCTTTGCCTCAAGCTGG - Intergenic
1083583089 11:63837836-63837858 CTCCCATCAGTGGCTTAAGGTGG - Intergenic
1083639854 11:64139625-64139647 TTCCCATCTGTTCCTTATGGGGG - Intronic
1084905271 11:72341268-72341290 CTCCCTTCTGTCTATTAAGGAGG - Intronic
1085056072 11:73404790-73404812 CTCCCATGTCTCCCTAAGGGAGG - Intronic
1086659213 11:89393986-89394008 TTCCCATCTTTGCCTCAAGCTGG + Intronic
1090089547 11:123682901-123682923 TTCCCAGCCATCCCTCAAGGAGG + Intergenic
1091271248 11:134313295-134313317 CTCCCATGTGTCTCTCCATGTGG + Intronic
1202814241 11_KI270721v1_random:39909-39931 GTCCCCTCTGTCCCTCAGGTAGG + Intergenic
1092540848 12:9419073-9419095 CTCCCATCTGTCCACCCAGCTGG + Intergenic
1095267174 12:40174138-40174160 CTTCCAACTCTCCCTCAAGTGGG - Intergenic
1096231488 12:49899235-49899257 CTCCCATGTGCCCCTCATCGTGG + Intronic
1098225063 12:68312808-68312830 CTTCTAGCTGTTCCTCAAGGGGG + Intronic
1102200649 12:111055627-111055649 CTCCCGCCTGGCCCCCAAGGTGG + Intronic
1102245903 12:111355623-111355645 CTCCCCTCTGTCCCTCCCTGGGG - Intergenic
1103701835 12:122852150-122852172 CTCCCAATTTTCCCTTAAGGAGG - Intronic
1104791586 12:131485642-131485664 CCCTCATCTGTCTCTCCAGGGGG + Intergenic
1106955737 13:34936692-34936714 CACTAATCTGTCCATCAAGGTGG + Intergenic
1108385052 13:49892226-49892248 CTCTCACCTTTCCCTCCAGGGGG + Intergenic
1110141005 13:72129457-72129479 CTCCCATATGACCCCCAGGGAGG + Intergenic
1113868866 13:113546074-113546096 CTCCCACCTCTCCCCAAAGGGGG - Intronic
1119432030 14:74574837-74574859 CTCCCATTTGAGCCTGAAGGCGG - Intronic
1119756157 14:77121174-77121196 CTCCCATCTGTCCACCCAGCAGG - Intronic
1121966317 14:98309751-98309773 CTTTCATCTGTCCCTCAAGATGG - Intergenic
1122384164 14:101332688-101332710 CTCCCATCTGATCCCAAAGGTGG + Intergenic
1122672534 14:103383700-103383722 CTCCCATCTAACCCTCAGAGAGG - Intergenic
1122722089 14:103727853-103727875 CGCCCTCGTGTCCCTCAAGGAGG + Exonic
1125473839 15:40030622-40030644 TTCCCATCTGTCCTTCAGAGAGG + Intronic
1126507847 15:49428632-49428654 TCCACATCTGTCTCTCAAGGCGG - Intronic
1127984069 15:64055045-64055067 TCCCCCTCTGTCCCTCATGGAGG - Intronic
1128718124 15:69925072-69925094 CTCCTGACTGTCGCTCAAGGTGG + Intergenic
1133527277 16:6617830-6617852 CTCACATCACTTCCTCAAGGAGG - Intronic
1134095402 16:11415381-11415403 CTCCCATCTGGCCAGCAGGGTGG + Intronic
1136026979 16:27474889-27474911 GTCCCATGTGTCCCTGCAGGAGG + Intronic
1139399815 16:66672373-66672395 CTCCCATCTGTCTCCCAGGCTGG - Intronic
1141628034 16:85271776-85271798 ATCCCATCTCTCCCTCCAGGCGG - Intergenic
1142031969 16:87843050-87843072 CCCCCATCTGGCACTCATGGTGG + Intronic
1142133404 16:88441129-88441151 CTCCCGTCTGTTCCTCCTGGGGG - Intergenic
1142559719 17:802873-802895 CACCCATCTGTACCTCCAGTTGG - Intronic
1143176637 17:4959405-4959427 CTACCAGCTGTCCCTCAGGCTGG - Exonic
1143181507 17:4986991-4987013 CTCCCATCTGTTCCCCGAGGAGG - Exonic
1144996321 17:19271709-19271731 TTCCCACCTGTGCCTCCAGGAGG - Intronic
1145934035 17:28704674-28704696 CTGCCATGGGTCCCCCAAGGGGG + Intronic
1146296212 17:31652734-31652756 CTTCCATCAGTCCCACAGGGAGG + Intergenic
1146607345 17:34272069-34272091 CTCCCTTCTCTACCTCATGGGGG + Exonic
1146884487 17:36462034-36462056 CCCTCTTCTGTCCCTCCAGGAGG + Intergenic
1148443852 17:47725993-47726015 CCCCTTTCTGTCCCTTAAGGAGG - Intergenic
1149569959 17:57665321-57665343 CTCCCATTGGTCAGTCAAGGAGG - Intronic
1155536859 18:26827759-26827781 TTCCCCTCTGAGCCTCAAGGAGG - Intergenic
1155767892 18:29658704-29658726 CTTCCAACTGTTCTTCAAGGTGG - Intergenic
1156379733 18:36547097-36547119 CTCCAACCTGCCCCTGAAGGCGG - Intronic
1156453690 18:37280993-37281015 CTCCCATGGGTCCCTCCATGAGG + Intronic
1157115229 18:44856275-44856297 CTCCCATCTGTCAGAAAAGGTGG + Intronic
1157624870 18:49042777-49042799 GTCCCAACTGGCCCTCAATGTGG + Exonic
1160991355 19:1861616-1861638 TTCCCGTCTGTGTCTCAAGGTGG + Intronic
1161611504 19:5245701-5245723 CTCCCACCTGTGCCTGAAGTCGG + Intronic
1161627241 19:5334419-5334441 CTCCTAACAATCCCTCAAGGTGG + Intronic
1161709971 19:5842145-5842167 CTCCCACCTGGGCCTCAGGGAGG + Intergenic
1161857513 19:6773974-6773996 CTCCCATCTGGTCCTCAGGCTGG + Intronic
1163420613 19:17211874-17211896 CTGCCATCTGTCTCTCAAAAGGG + Exonic
1163513911 19:17751623-17751645 CTCCCCTCTGTTCCTGAGGGGGG - Intronic
1165273075 19:34726840-34726862 CTGCTATTTGTCTCTCAAGGAGG + Intergenic
1165311940 19:35033785-35033807 CTGCCATCTGTCCCTCCATCTGG - Exonic
1166145156 19:40829187-40829209 CTCCCATCTTACCCTCAAGTAGG + Intronic
927150145 2:20190933-20190955 GTCTCATCTGTGCCTGAAGGTGG + Intergenic
929399766 2:41566514-41566536 CTTCCATCTGCCCCTCTAGTTGG + Intergenic
929835617 2:45394688-45394710 CTCCCATCTCTCACTTAAGTAGG + Intronic
929962478 2:46507007-46507029 CTCCCATCTGTTTCCCATGGAGG + Intronic
930283506 2:49399825-49399847 CTCCCATCTGGCACTCAAATGGG + Intergenic
935175345 2:100643986-100644008 CTCTCCTCTGTCCCTTCAGGAGG + Intergenic
1169710225 20:8552834-8552856 CTCCCAGCTGCCCATCCAGGTGG + Intronic
1170788683 20:19490174-19490196 CTCCCATCTTTCACTCTAGATGG + Intronic
1171132144 20:22663694-22663716 CTCCTCTCAGTCCCTCCAGGGGG - Intergenic
1172076818 20:32305116-32305138 CTCCCCTCTGTCCCCCAGGCTGG - Intronic
1173410300 20:42803940-42803962 CTCCCAGCTGGCCCTCACTGGGG - Intronic
1173678941 20:44862462-44862484 CACCCATCTGTCCCTCCCAGTGG + Intergenic
1174275109 20:49397909-49397931 CACCCCTCTGTCCCCCAAGAAGG - Intronic
1177420078 21:20845013-20845035 CTCCCATTTGTCCTTCTAGATGG + Intergenic
1179017084 21:37603302-37603324 CTCCCAGCTGGCCATCAAGTGGG - Intergenic
1179583711 21:42361531-42361553 CTCCCACCTGTCCCTCCATCTGG - Intergenic
1179987128 21:44928100-44928122 CTCAGCTCTCTCCCTCAAGGAGG - Intronic
1181818749 22:25459397-25459419 CTCCCCTCTGGCCCTGCAGGTGG + Intergenic
1182413155 22:30204184-30204206 CTACCATCTGTCTGTCAAGCTGG - Intergenic
1183331696 22:37225800-37225822 CTCCCCTCTGGCCCTCAGGAAGG + Exonic
1183430313 22:37761870-37761892 CTCCCTTCTCTGCCTCAGGGTGG - Intronic
1184468618 22:44683351-44683373 CTGCCAGGTGGCCCTCAAGGTGG - Intronic
1185215914 22:49599948-49599970 TTCCCATCCGTCTCTGAAGGAGG - Intronic
951285454 3:20807126-20807148 CTCCCATCTCTCCTCCAAAGAGG - Intergenic
953493391 3:43367601-43367623 CTCCCATCCTGCCCTCGAGGAGG - Intronic
953773149 3:45794141-45794163 CTCCCACCATTCCCTCCAGGTGG - Intronic
954154316 3:48676798-48676820 CCCCCATCTGTCACCCAAGCTGG + Intronic
954878264 3:53817497-53817519 TCCCCTTCTGTCCCTCCAGGAGG + Exonic
954971209 3:54653068-54653090 CTCCCATATGTCCGGCACGGTGG - Intronic
956442334 3:69292620-69292642 ATTCCATCTCTCCCTCAAGGGGG + Intronic
961086816 3:124075359-124075381 CTCGCTCCTGTCCATCAAGGAGG + Intergenic
961493422 3:127273548-127273570 CTCCCAACTGCCCTTCCAGGCGG - Intergenic
965419970 3:168446039-168446061 CTTCACTCTGTCACTCAAGGTGG + Intergenic
965470246 3:169081311-169081333 CTCCCCTCTGTCCCCCAGGCTGG - Intergenic
967984824 3:195086959-195086981 CTCCCACCTGTACCACAAGGAGG + Intronic
968580088 4:1385708-1385730 CGCCCATCTGTCTCTGAAGGTGG + Intronic
969454616 4:7294298-7294320 CTCACATCTGTCCCCCAAATAGG - Intronic
973961024 4:56109885-56109907 CTCCCATTTGTCCCTCTCTGTGG - Intergenic
980772126 4:137388413-137388435 CCAACATCTGTCCTTCAAGGTGG + Intergenic
982046286 4:151449686-151449708 CTCCCATCCTTTCCCCAAGGAGG + Intronic
982099362 4:151953253-151953275 CGCCCTTCTCTCCCTCAAGCTGG + Intergenic
982780361 4:159483950-159483972 CTCCCTTCTGTCCCCCTAGTGGG - Intergenic
983237278 4:165193737-165193759 CTCCTATGTGTCCCTCAAGAAGG + Intronic
984331230 4:178321651-178321673 CTCCCATCTCTCCTTCAAAGGGG + Intergenic
985822063 5:2167128-2167150 CTCCCATGGGCCCCTCAAAGTGG + Intergenic
992841781 5:80702396-80702418 CTCCCATATGGCCATCAGGGAGG - Intronic
996681500 5:126232307-126232329 CTCCCACCTCTACCTCAAGTAGG - Intergenic
997413513 5:133707928-133707950 CTCCCATCTGTACTCCCAGGAGG + Intergenic
998011294 5:138697500-138697522 TCCCCATCTGTGCATCAAGGAGG - Intronic
998162287 5:139820337-139820359 CTCCCATCTGTCCCCCAGCCTGG - Intronic
998176961 5:139907467-139907489 CACTTATCTGTCCCACAAGGAGG - Intronic
999290186 5:150419862-150419884 CTTGCAATTGTCCCTCAAGGAGG - Intergenic
999327143 5:150650370-150650392 TCTCCATCTGGCCCTCAAGGAGG - Exonic
1000368439 5:160512070-160512092 CCCAAAGCTGTCCCTCAAGGAGG + Intergenic
1000604304 5:163311959-163311981 CTCCAATCTGTCCCTTATGTGGG - Intergenic
1001278750 5:170370678-170370700 CTCCCATCTGTCCCTCAAGGAGG + Intronic
1001436199 5:171701441-171701463 CTCTCATCTGTCCCTCTAATGGG + Intergenic
1006075528 6:31529824-31529846 CTCCCTCCTGCCCTTCAAGGAGG - Exonic
1007718077 6:43868969-43868991 CACCCATCCATCCTTCAAGGTGG - Intergenic
1011736290 6:90313678-90313700 CACCCCTCTGTCCCTTAAGATGG - Intergenic
1015232108 6:130927026-130927048 CTTCCATCAATTCCTCAAGGTGG + Intronic
1017807051 6:157955013-157955035 CTCCCACGTGTCCCCCTAGGTGG - Intergenic
1018406216 6:163485341-163485363 CTCCCACCTGTTTCTAAAGGTGG - Intronic
1018641785 6:165910341-165910363 TTCCCATCTGTTCGTCAGGGAGG - Intronic
1019055773 6:169222268-169222290 CTCCGGCGTGTCCCTCAAGGTGG - Exonic
1022007597 7:26280419-26280441 CTCAAATCTGTCTCTCAAGCAGG - Intergenic
1022523673 7:31023685-31023707 CCCCTATATGTGCCTCAAGGAGG - Intergenic
1023121482 7:36913645-36913667 CTCCAAACTGTCCTCCAAGGTGG - Intronic
1023926668 7:44674650-44674672 CTCACAACTGGCACTCAAGGAGG - Intronic
1024225319 7:47321997-47322019 CTCCCAGCTGTCCTGGAAGGAGG + Intronic
1024577422 7:50775858-50775880 ATCCCAGCTGTAGCTCAAGGGGG - Intronic
1032622624 7:133552560-133552582 CTGCCATCTCTCCCTAGAGGTGG - Intronic
1033433586 7:141312024-141312046 CTGCCATCCCTACCTCAAGGTGG + Intronic
1034691244 7:153015838-153015860 CTCTCATCTGTACGACAAGGAGG + Intergenic
1034691478 7:153017736-153017758 CTCTCATCTGTACGACAAGGAGG + Intergenic
1035113383 7:156503779-156503801 CTCCCATCTGTCCCTGAGCGTGG + Intergenic
1037359459 8:18057972-18057994 CTGCCAGCTGTGCGTCAAGGAGG - Intronic
1037392014 8:18403159-18403181 CTCCCATTTTTCCCTCCAGAAGG - Intergenic
1042114213 8:65413862-65413884 TTCCCATCAGTCCCTCAACCTGG - Intergenic
1047208026 8:122819098-122819120 CTCCCATCTGGCCTTCAAGAAGG - Intronic
1048334826 8:133494722-133494744 CTCCATGCTGTCCCTCAAGCAGG + Intronic
1048603764 8:135946464-135946486 CTGCCATCTGTCACCCGAGGAGG + Intergenic
1049128730 8:140817059-140817081 ATCCCATCTGGCCCCCAGGGAGG + Intronic
1049835923 8:144735537-144735559 CCCACATCTGTCCCTCAATGTGG + Intronic
1050182043 9:2933297-2933319 CTCCCTACTCTCCCTCCAGGGGG - Intergenic
1052958364 9:34272868-34272890 CTCTCCTCGGTCCCTCAAAGTGG + Intronic
1053539010 9:38954339-38954361 TACCCACCTGTCACTCAAGGTGG + Intergenic
1054627130 9:67409580-67409602 TACCCACCTGTCACTCAAGGTGG - Intergenic
1056707009 9:88959898-88959920 CCCCCATGTGTCCCTCCACGTGG - Intergenic
1058583744 9:106485238-106485260 CTTCCTGCTGTCCCTCAAGAGGG + Intergenic
1059049202 9:110904378-110904400 CCCCCATGTGTCACTCAAAGTGG + Intronic
1059352738 9:113677084-113677106 CTCCCAGCTGTCCATCTACGTGG - Intergenic
1060278240 9:122198355-122198377 CTGCCATTTGTCACCCAAGGAGG + Intronic
1060470216 9:123942434-123942456 CTCCCCTCTCAGCCTCAAGGAGG - Intergenic
1060826086 9:126688853-126688875 GCCCCATCTGATCCTCAAGGGGG - Intronic
1062023908 9:134331806-134331828 CTCCCAGCTGGAGCTCAAGGCGG - Intronic
1062287823 9:135780945-135780967 CACCTCTCTGTCCCACAAGGTGG + Intronic
1062411058 9:136424666-136424688 CTCCCATCGGTCCTGCAAAGAGG - Intergenic
1186193529 X:7089162-7089184 CTCCCACCTGTGCCCCCAGGTGG - Intronic
1190090575 X:47433704-47433726 CTCCCCTCTGTCGCTCAGGCGGG + Intergenic
1193187203 X:78527576-78527598 CTCCCATCTGTTGCTCATCGGGG - Intergenic
1200968512 Y:9124931-9124953 CTTCCATCTGTCCCCCAGTGAGG - Intergenic