ID: 1001280126

View in Genome Browser
Species Human (GRCh38)
Location 5:170380777-170380799
Sequence CTTAAATAGCAGTGTGGCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001280118_1001280126 25 Left 1001280118 5:170380729-170380751 CCTGAGTCTCTCCAATGCCTCTG 0: 1
1: 0
2: 0
3: 27
4: 243
Right 1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 147
1001280117_1001280126 30 Left 1001280117 5:170380724-170380746 CCTGGCCTGAGTCTCTCCAATGC 0: 1
1: 0
2: 1
3: 29
4: 249
Right 1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 147
1001280122_1001280126 -5 Left 1001280122 5:170380759-170380781 CCTTGGCTAACCTAGCTCCTTAA 0: 1
1: 0
2: 0
3: 7
4: 72
Right 1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 147
1001280121_1001280126 8 Left 1001280121 5:170380746-170380768 CCTCTGACTGTGACCTTGGCTAA 0: 1
1: 0
2: 0
3: 27
4: 225
Right 1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 147
1001280119_1001280126 14 Left 1001280119 5:170380740-170380762 CCAATGCCTCTGACTGTGACCTT 0: 1
1: 0
2: 10
3: 113
4: 712
Right 1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001280126 Original CRISPR CTTAAATAGCAGTGTGGCTA TGG Intronic
903496778 1:23774024-23774046 CTTAATTAGTAGTTTGGCTGTGG - Intergenic
910160610 1:84268270-84268292 ATTGCACAGCAGTGTGGCTATGG + Intergenic
911852459 1:102836597-102836619 GTTTAATAGCATTGTGCCTATGG + Intergenic
912157928 1:106945343-106945365 CTTACAGTTCAGTGTGGCTAGGG + Intergenic
918614406 1:186527867-186527889 CTTTATTAGCAGTGTGGGAATGG + Intergenic
920594062 1:207250851-207250873 AATAAATAGCAGTATGGCCAGGG - Intergenic
922402855 1:225278417-225278439 CTTAAATAGCGTGGTGGCTGTGG - Intronic
922788956 1:228299313-228299335 CTCACATTGCAGTGTGGCTGTGG - Exonic
923552455 1:234974923-234974945 CTGTAATGGAAGTGTGGCTATGG + Intergenic
923984435 1:239365138-239365160 CTTTATTAGCAGTGTGGGAATGG - Intergenic
1066546768 10:36508620-36508642 CTTATAAGGCAGTGTGCCTAGGG + Intergenic
1068123981 10:52815040-52815062 ATTAAATTCCAGTTTGGCTAAGG - Intergenic
1068869605 10:61928917-61928939 CTCAAATTGCAGTGTGTCTGAGG + Intronic
1070186679 10:74070264-74070286 TTTTAATAGCAGTGTGTATAGGG + Intronic
1070571411 10:77641805-77641827 CTAAAAAAGCAGAGTGACTAAGG + Intergenic
1071266309 10:83967859-83967881 CTTTAATAGCAGTGTGAGAATGG - Intergenic
1073593128 10:104775196-104775218 CTTAAATTGCTGTGTGCCCAAGG - Intronic
1073723955 10:106208358-106208380 CTTAAATAGCTGAAGGGCTAAGG - Intergenic
1074504774 10:114059942-114059964 CTTAGAAATCAGTGTGGCTGGGG - Intergenic
1074653923 10:115560209-115560231 CTTTATTAGCAGTGTGAATATGG - Intronic
1074686581 10:115967682-115967704 CTTTATTAGCAGTGTGGGAACGG - Intergenic
1074959556 10:118429076-118429098 CTGAAATAGCAGCCTGGCTCGGG + Intergenic
1078797418 11:14606664-14606686 ATTAAAAAGCAGAGAGGCTAAGG + Intronic
1079390014 11:20014103-20014125 CTTAAGTCGCAGTCTGCCTAGGG + Intronic
1081215914 11:40397825-40397847 TTTAAATACCAGTGTGGGAAAGG + Intronic
1090918240 11:131186023-131186045 CATGAAGAGCAGTGTGGCTCTGG + Intergenic
1090959165 11:131540453-131540475 CTTAAATAGCTGGCTGGCCATGG - Intronic
1097998435 12:65915468-65915490 CAGAAATCACAGTGTGGCTATGG + Intronic
1100888428 12:99098452-99098474 CTTTAATAGCAGTGTGACTCAGG + Intronic
1101514555 12:105422231-105422253 TTTAAAAAGCAGTGTGGCAAGGG + Intergenic
1103162036 12:118737334-118737356 CATAAATTGCAGTGGGGTTAGGG - Intergenic
1103180729 12:118909015-118909037 ATTAAATACCTGTGTGGCAATGG - Intergenic
1106118684 13:26839230-26839252 ATAAAATAGCAGTGCGGCGATGG + Intergenic
1108504757 13:51102715-51102737 CTTTAATAGCAGTGTGAACATGG - Intergenic
1115437723 14:33394871-33394893 TTTAAATACCAGTGGGGCTTTGG - Intronic
1116936318 14:50744242-50744264 ATTAAATAGCTGTGTCGATAAGG - Exonic
1118983936 14:70737572-70737594 CATACATGGCAGTGTGGCTATGG + Intronic
1120312697 14:82851072-82851094 CTTTATTAGCAGTGTGAATATGG + Intergenic
1120341896 14:83231547-83231569 CTCAAACATCAGTGTGGATAAGG + Intergenic
1120695204 14:87637096-87637118 CTGAAACAGCAGTGTAGCTGGGG + Intergenic
1123059088 14:105586352-105586374 CGTACAGAGCAGTGTGGTTAAGG + Intergenic
1123083417 14:105706583-105706605 CGTACAGAGCAGTGTGGTTAAGG + Intergenic
1123818334 15:24001572-24001594 CTTAACTACCTGGGTGGCTATGG + Intergenic
1125185194 15:36922021-36922043 CTTAAATAACATTTTGGCTTAGG + Intronic
1130176803 15:81581490-81581512 TTAAAATAGCAGTGTGGCTTGGG - Intergenic
1133855703 16:9547436-9547458 ATTATCTAGCACTGTGGCTAAGG + Intergenic
1137328035 16:47461204-47461226 CTAAAAAAGCAGTGGAGCTAGGG + Exonic
1140334749 16:74094836-74094858 ATTAAATAGCACAGTGGCTCAGG + Intergenic
1141004454 16:80339172-80339194 CTTCAATAGCTGTGTGGTTTGGG - Intergenic
1148224182 17:45886893-45886915 CTTAACTATCTGTGTGGGTATGG - Intergenic
1149289364 17:55201194-55201216 TTTAAATACCAGTGTGACTGTGG - Intergenic
1149724826 17:58882728-58882750 GTTAAATAGTAGTATTGCTACGG - Intronic
1150872670 17:68930869-68930891 ATTAAATAACAGAGAGGCTAGGG - Intronic
1154297345 18:13162329-13162351 CTTAAATAGCAGTGATGCCAGGG - Intergenic
1158260253 18:55598647-55598669 CTGAAATAGGGCTGTGGCTATGG + Intronic
926300957 2:11601899-11601921 CCTAAATAGCACAGTGGTTAAGG - Intronic
926840312 2:17072268-17072290 CTTTATTAGCAGTGTGGGAATGG + Intergenic
927803819 2:26126731-26126753 CTCAAATAGCTGTGCTGCTATGG - Intronic
929234864 2:39594838-39594860 ATTAATTAGCAGTGTGACTTAGG + Intergenic
931631691 2:64307727-64307749 GTTAAATATCACTGTGGCTGTGG - Intergenic
937617751 2:123945664-123945686 CTTTAATAGCAGAATGGATAAGG + Intergenic
939543871 2:143528265-143528287 CTTAACTTGCTGTGTGGTTATGG - Intronic
940370425 2:152895155-152895177 CTTAAATAGTAATGTTGTTATGG + Intergenic
941469495 2:165866817-165866839 CTTATATAGCATTATGGCCAGGG + Intronic
943959627 2:194246343-194246365 CCTAAACACCACTGTGGCTAGGG - Intergenic
945959978 2:216123053-216123075 TTTACATAGCAGTATGGCTTGGG + Intronic
946797977 2:223376474-223376496 CTTATATTTCAGTGTTGCTATGG + Intergenic
947345815 2:229188109-229188131 CAAAAAAAGCAGTGTGGCTGAGG + Intronic
1170934174 20:20795691-20795713 CTTAAATAGCAATGTTTTTATGG + Intergenic
1174879434 20:54262764-54262786 TTTCAATAACAGTGTGACTATGG + Intergenic
1175979735 20:62732214-62732236 GTTAAATAGGAGTGAGGATAGGG + Intronic
1177091656 21:16776966-16776988 CTTAAAAGGCAGTGTGGAAAAGG + Intergenic
1177228872 21:18293242-18293264 CTTAAATATCTATGTGGGTAAGG + Intronic
1177774370 21:25551564-25551586 CTTTAATAGCAGTGTGAGAATGG - Intergenic
1180249008 21:46567248-46567270 CTTAAATAGCTGTGTGACATTGG + Intronic
1182416232 22:30223134-30223156 CCTAAATAGCACCGTGTCTAGGG + Intergenic
955217323 3:56995129-56995151 CTTTAATAGCAGTGTGAAAATGG + Intronic
955419394 3:58721607-58721629 CCTAAAGAGCAGTGTGGCTGGGG + Intronic
955992936 3:64647644-64647666 CTAAAATTACAGTGTGCCTATGG - Intronic
956445261 3:69320076-69320098 ATTAACTAGCTGTGTGGCTTTGG - Intronic
956966105 3:74462596-74462618 CCTAAAGAACAGTGGGGCTACGG - Intronic
957372591 3:79314599-79314621 CTTTATTAGCAGTGTGGGAATGG + Intronic
958853950 3:99362050-99362072 CATAAATAGCAGTGTGTAGAGGG - Intergenic
959219554 3:103499280-103499302 TTAAAATACCAGTGTGGTTATGG - Intergenic
960106294 3:113801308-113801330 CTTCAACAGAAGTGTGGCCAAGG + Intronic
961763764 3:129191754-129191776 CTCTAAAAGCAGTGTGCCTAGGG - Intergenic
962222016 3:133572422-133572444 CTTTAATAGCAGTGTAAGTAGGG + Intergenic
963649877 3:147965579-147965601 CTTAAACATCAGTGTGAATAAGG - Intergenic
966586692 3:181634323-181634345 CTTACACAGCTGTATGGCTATGG - Intergenic
969200445 4:5600142-5600164 CTTAACTAGCTGTGTGACCAAGG + Intronic
969827040 4:9765742-9765764 CTAAAATTGAAGTGTTGCTAGGG - Intergenic
969853531 4:9980835-9980857 ATTAAATAGCACTGTAGCCACGG + Intronic
970038708 4:11771245-11771267 CTTAAACACCATTTTGGCTATGG - Intergenic
970602026 4:17648078-17648100 ATTTAATAGCTGTGTGGCTTTGG - Intronic
971546183 4:27890320-27890342 CTTAATTAGCAGTGTGAGAATGG + Intergenic
974184077 4:58423511-58423533 CTTAAATATCAGTCTAGCCAGGG - Intergenic
974694110 4:65342355-65342377 ATTACATAGCAATGAGGCTAAGG + Intronic
975816741 4:78224892-78224914 TTTAAAAAGCAGTGTCTCTATGG + Intronic
977076721 4:92462212-92462234 CTAAAATAGAAGTGTGCTTATGG + Intronic
979210903 4:118100753-118100775 CTTAAATAGCTTTGTGACCAAGG + Intronic
979909086 4:126337322-126337344 ATTAAATAGCATGGTGACTATGG + Intergenic
981349503 4:143712495-143712517 CTTAAAATGCAGTGTGGGTTTGG - Intergenic
984617179 4:181912095-181912117 CTTAAATAGCTTTGTGGCCCTGG - Intergenic
985257564 4:188085122-188085144 CTTATATATTACTGTGGCTAGGG - Intergenic
987216429 5:15742739-15742761 CTTTATTAGCAGTGTGGGAATGG - Intronic
987461627 5:18218492-18218514 CTTTATTAGCAGTGTGGCAATGG + Intergenic
993015251 5:82528182-82528204 CTTTATTAGCAGTGTGGGAATGG - Intergenic
994046405 5:95315475-95315497 CTTATATAGCAATGTTTCTAAGG - Intergenic
994873604 5:105384681-105384703 TTTACATGTCAGTGTGGCTAGGG - Intergenic
995996275 5:118304317-118304339 CTTTATTAGCAGTGTGGGAATGG + Intergenic
996511733 5:124323912-124323934 GTTAAATAGCAGTTTGGAGAAGG - Intergenic
996591004 5:125147673-125147695 ATTCGAGAGCAGTGTGGCTAGGG - Intergenic
996831448 5:127744571-127744593 TTTAAATAAAAGTGTGGTTATGG - Intergenic
998701102 5:144700989-144701011 ATTAACAAGGAGTGTGGCTATGG + Intergenic
1000005733 5:157182808-157182830 CACAAATAGCAGTTGGGCTAAGG - Intronic
1001268311 5:170291275-170291297 CTTCAATAGCAGAGTGGCCCTGG + Intronic
1001280126 5:170380777-170380799 CTTAAATAGCAGTGTGGCTATGG + Intronic
1004330396 6:14715654-14715676 CTTTCATAGCAGTGTCCCTAAGG + Intergenic
1005122196 6:22402023-22402045 CTTTAATAGCAGTGTGAAAATGG + Intergenic
1008010918 6:46466881-46466903 ATTAAATAGCTGTGTAGCTTTGG + Intronic
1011737920 6:90331261-90331283 CTTATAAAGCAATGTGCCTAAGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1016041010 6:139431947-139431969 CTTAAATATCAGTGTCCCTAAGG + Intergenic
1017044785 6:150337329-150337351 GTGAAAGAGCAGTGTGGCTGCGG + Intergenic
1017236377 6:152120907-152120929 CTTAAATACCTCTGGGGCTAGGG + Intronic
1017425007 6:154311363-154311385 CTTAAATATCAGTGTTCCTTAGG + Intronic
1017695021 6:157005929-157005951 TTAAAATAGCAATGTCGCTATGG - Intronic
1019810692 7:3163115-3163137 CTTTAATAGCAGTGTGACAATGG + Intronic
1021925692 7:25531721-25531743 CTTCACTAGCTGTGTGGCTTTGG - Intergenic
1022849830 7:34248731-34248753 CCTTACTAGCTGTGTGGCTATGG + Intergenic
1025940161 7:66070778-66070800 AGTAAATGGCAGTGTGGCTCTGG + Intergenic
1026302452 7:69109698-69109720 CTTTAATAGCAGTGTGAAAATGG - Intergenic
1030862386 7:114650776-114650798 CTAAAATAGCAAGGTGGATAAGG - Intronic
1031172340 7:118308083-118308105 CTTCATTAGCAGTGTGGGAATGG - Intergenic
1035901914 8:3465808-3465830 CTTGCATAGCAGTTTGTCTAGGG + Intronic
1036113910 8:5936940-5936962 CATATATAGCAGGGTGGGTAAGG - Intergenic
1038701479 8:29853347-29853369 CTTAAAGAGCAGGGAGGCTGAGG + Intergenic
1040741225 8:50578860-50578882 CTTAATTAGCAGTGTGAAGATGG + Intronic
1042025247 8:64416016-64416038 CTTAAATAGAAACATGGCTAGGG - Intergenic
1046411820 8:113854732-113854754 CTTAGATAACTGAGTGGCTATGG - Intergenic
1052036424 9:23686402-23686424 TTTTAATTGCAGTGTGGCAAAGG - Intergenic
1052065136 9:24009419-24009441 TTTAAAAGGCAGGGTGGCTAGGG - Intergenic
1055754383 9:79542339-79542361 CTGAAAAAGCAATATGGCTAAGG - Intergenic
1056721326 9:89074552-89074574 CTTAATTAACACTGTGGCTGTGG + Intronic
1057420089 9:94904798-94904820 CTTTATTAGCAGTCTAGCTAAGG + Intronic
1058203345 9:102070933-102070955 CCAATATGGCAGTGTGGCTAAGG - Intergenic
1060255099 9:122020401-122020423 TTTAAATAGAAGTGTGTATAAGG - Intronic
1061220684 9:129248856-129248878 CTTTATTAGCAGTGTGGAAATGG + Intergenic
1186021791 X:5264492-5264514 CTTAATCAGCAGTGTGGAAATGG - Intergenic
1187157655 X:16736119-16736141 ATTAAATAGCAATGTATCTAAGG - Intronic
1187495999 X:19796428-19796450 CCTAAATGGCAGTGGGGGTAGGG - Intronic
1189397102 X:40632740-40632762 CTTAACTAGCTGTGTGACTTTGG + Intronic
1190582511 X:51902903-51902925 CTTTATGAGCAATGTGGCTAGGG - Intergenic
1192247108 X:69382586-69382608 CTTAAAAAGAAGTTTTGCTAAGG + Intergenic
1192917123 X:75664832-75664854 CTTAATTAGCAGTGTGAAAATGG - Intergenic
1196311370 X:114170589-114170611 GTTAAATAGCAGAGTAGCCAAGG - Intergenic
1197467524 X:126822388-126822410 CTTTATTAGCAGTGTGGGAATGG - Intergenic