ID: 1001280143

View in Genome Browser
Species Human (GRCh38)
Location 5:170380888-170380910
Sequence TGCCTAGGAGAACTGTCATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 160}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001280133_1001280143 21 Left 1001280133 5:170380844-170380866 CCACAACCTCACTGGGCCTTGTA 0: 1
1: 0
2: 0
3: 22
4: 218
Right 1001280143 5:170380888-170380910 TGCCTAGGAGAACTGTCATGGGG 0: 1
1: 0
2: 1
3: 7
4: 160
1001280134_1001280143 15 Left 1001280134 5:170380850-170380872 CCTCACTGGGCCTTGTAAAATGG 0: 1
1: 0
2: 0
3: 20
4: 150
Right 1001280143 5:170380888-170380910 TGCCTAGGAGAACTGTCATGGGG 0: 1
1: 0
2: 1
3: 7
4: 160
1001280137_1001280143 5 Left 1001280137 5:170380860-170380882 CCTTGTAAAATGGGTTTGTGAGG 0: 1
1: 0
2: 11
3: 179
4: 757
Right 1001280143 5:170380888-170380910 TGCCTAGGAGAACTGTCATGGGG 0: 1
1: 0
2: 1
3: 7
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001280143 Original CRISPR TGCCTAGGAGAACTGTCATG GGG Intronic
900248132 1:1649020-1649042 TGACCAAGAGAACTGTCCTGAGG - Intronic
900259349 1:1716176-1716198 TGACCAAGAGAACTGTCCTGAGG - Intronic
905272263 1:36794833-36794855 TGCCGAGGAGCACTATGATGTGG + Intergenic
906712183 1:47939054-47939076 TGCCTGGGATAACGGTGATGAGG + Intronic
907349304 1:53812786-53812808 TGCCTAGGCACACTGTCATCAGG + Intronic
908652688 1:66353379-66353401 TGCCTAGGAGACCTGGCTTTTGG - Intronic
908821063 1:68087056-68087078 TACCTATGAGGATTGTCATGAGG + Intergenic
911234376 1:95395151-95395173 TGCCTAGAAGAAATGACATTGGG + Intergenic
913493665 1:119406404-119406426 TGCCTAGGCACACTGTCATTAGG + Intergenic
915073510 1:153291508-153291530 TGCCCTGTAGAACTGTCTTGAGG + Intergenic
915285458 1:154849316-154849338 GGCCTGGGAGAACAGCCATGTGG + Intronic
917235317 1:172885604-172885626 TGCCTACCAAAACTGTTATGTGG + Intergenic
918143047 1:181734314-181734336 TGCCTAAGGGAACTGTGATGGGG - Intronic
920199501 1:204250803-204250825 AGCCTAGGACAACTGGGATGGGG - Intronic
923437459 1:233980898-233980920 TACCTAGTAGATTTGTCATGAGG - Intronic
924302170 1:242650957-242650979 TGCCTAGGCACACTGTCATCAGG - Intergenic
1065768710 10:29056445-29056467 AGCATAAGAGAACTGTCTTGGGG + Intergenic
1068175131 10:53447727-53447749 TGCCTAGTAGAGCTGTCAGAAGG - Intergenic
1070685800 10:78479890-78479912 TACATCAGAGAACTGTCATGAGG - Intergenic
1071993359 10:91122849-91122871 TAGCTATCAGAACTGTCATGAGG + Intergenic
1073322508 10:102624018-102624040 TCCCTAGCAGAACTGCCATAAGG + Intronic
1073626257 10:105100888-105100910 TGCCTCTGAGGACTGTCATCAGG - Intronic
1079983111 11:27172764-27172786 TGCCTGGCAGAGCTGGCATGCGG + Intergenic
1085804496 11:79622499-79622521 TGACCAGGAAAACTGTCATTTGG - Intergenic
1085883972 11:80500435-80500457 AACCTATGAGAACTGCCATGTGG + Intergenic
1086075009 11:82841229-82841251 TGCCAGGCAGAACTGTGATGAGG - Intronic
1088206574 11:107398714-107398736 TGCCTAGGCACACTGTCATCAGG + Intronic
1090319412 11:125829430-125829452 AGCCTAGGAGAACTGTGGTGTGG + Intergenic
1090957311 11:131524919-131524941 TGCCTAATGGCACTGTCATGAGG + Intronic
1092606375 12:10123956-10123978 TGCCTAGGGGGACTGTCATCTGG - Intronic
1093172742 12:15877229-15877251 TGCCTAGGCACACTGTCATCAGG + Intronic
1093337982 12:17933254-17933276 TGTCTAGTAGATCTGTCATCAGG + Intergenic
1093669291 12:21853505-21853527 TCCCTAGAACAACTGTCATCAGG - Intronic
1097760755 12:63461017-63461039 TGCCTAGGTGCATTGTCATCAGG + Intergenic
1098035429 12:66297105-66297127 TTCCTAGGATAACTTTCAAGGGG + Intergenic
1102916578 12:116758820-116758842 TGCCTAGGCACACTGTCATCAGG - Intronic
1107808712 13:44178883-44178905 TGCCAAGGAGAACGGTCTTCAGG - Intergenic
1108064461 13:46563517-46563539 TACCTAGTAGAGTTGTCATGAGG + Intronic
1108176807 13:47800789-47800811 TGCCAAGGTGTACTGTCAGGTGG - Intergenic
1111341630 13:86894092-86894114 TGCCTAGGATAAAAGTGATGTGG - Intergenic
1114225195 14:20731775-20731797 TGACTAGGAGCACTGGCAGGAGG + Intronic
1115196230 14:30802975-30802997 TGCCTAGGTGAGCTATCCTGCGG - Intergenic
1118324542 14:64772227-64772249 TGCCTCAGAGGACTGCCATGAGG + Intronic
1118454490 14:65932152-65932174 TGCCCAGGGGAAGTGTCTTGGGG - Intergenic
1119126185 14:72129544-72129566 TGTCAAGGAGAACTGTCCAGTGG - Intronic
1119766868 14:77195903-77195925 TGCCTTGGGGAGCTGTGATGGGG - Intronic
1124854919 15:33378372-33378394 TTCCTGGGAGAAGTGTCAAGTGG + Intronic
1127701826 15:61508656-61508678 TGCCAAGGAGAACATTCATTTGG + Intergenic
1128517880 15:68354683-68354705 GGCCAAGGAGAACTGCCAGGAGG - Intronic
1129112585 15:73346329-73346351 TGACTAGCAGCACTGTCATAAGG + Intronic
1133958229 16:10466025-10466047 TGACTAGGAGAACAGGCATGAGG - Intronic
1135739878 16:24965788-24965810 TGCCTTGTGGAACTGTCATAAGG + Intronic
1137785892 16:51137462-51137484 TGCCTCCTAGAAATGTCATGGGG + Exonic
1138452331 16:57100893-57100915 TTCCTAGGAGATCTGTCATGGGG - Intronic
1138535278 16:57656706-57656728 TACCTTGGAGAGCTGTTATGAGG - Intronic
1138724786 16:59124136-59124158 TGCCGAGTAGAGCTGGCATGAGG - Intergenic
1142534803 17:606719-606741 TGCCTATGAGACCTGACAGGAGG - Intronic
1146322375 17:31857075-31857097 TGCCACGGTGAAGTGTCATGAGG - Intronic
1146746503 17:35335109-35335131 TGCCTAGGGACACTGTCATCAGG - Intergenic
1149289229 17:55199879-55199901 TGGCTGGGAGAACTGAAATGGGG - Intergenic
1149540866 17:57467199-57467221 CTCCTGGGAGAACTGTCAGGTGG + Intronic
1152020717 17:77778994-77779016 TGCCCAGGAGCCCTGGCATGGGG + Intergenic
1157541020 18:48506725-48506747 TGCCTAGGCGCATTGTCATTGGG + Intergenic
1162400975 19:10446426-10446448 GGCCTGGGGGAACTGGCATGTGG - Intronic
925827240 2:7861480-7861502 TGCCTAGGAGAATGATCATCAGG - Intergenic
927930476 2:27040467-27040489 GGCCCAGGAGCACTGCCATGAGG + Exonic
929932624 2:46270753-46270775 TGCCAAGGATAACTTTCAAGGGG - Intergenic
931517619 2:63059172-63059194 TGCCGGGGAGAACTGGCAGGCGG + Intergenic
934527519 2:95060716-95060738 TCCCTAGGAGGATTGTCTTGAGG - Intergenic
934729472 2:96647582-96647604 TGGCTCTGAGAACTGTCTTGGGG - Intergenic
935497870 2:103804017-103804039 TGCACAGGAGAAGGGTCATGTGG + Intergenic
935847176 2:107178492-107178514 TGGCTAGGTGAGCTGTCATTTGG + Intergenic
936783413 2:116062594-116062616 CTCCTAAGAGAACTGTGATGAGG - Intergenic
937327409 2:120999371-120999393 GGCCTATGAGAACTGACAAGGGG + Intergenic
937534912 2:122874145-122874167 TGCCTAAGGGAACAGTCATTTGG - Intergenic
939237213 2:139511019-139511041 TGCATAGGAGAGCTCTCAAGAGG - Intergenic
940346938 2:152637940-152637962 TGCCTAGGTGAACAGTCAATGGG - Intronic
940998524 2:160176564-160176586 TACCTAGCAGGATTGTCATGAGG + Intronic
943318503 2:186417165-186417187 TACCTCGGAGAGATGTCATGAGG - Intergenic
945385850 2:209200277-209200299 TACCTAATAGTACTGTCATGAGG + Intergenic
948274713 2:236699580-236699602 GACCTAGGACAAGTGTCATGGGG + Intergenic
948306715 2:236953733-236953755 TGCCAAGGAGAACTGGAAGGAGG + Intergenic
1169068386 20:2707209-2707231 TGCCTAGTGGAACTGTCAAGGGG + Intronic
1169551641 20:6707421-6707443 TTCCTAAGAGAACTGTGCTGGGG - Intergenic
1170862994 20:20126676-20126698 TGCCTAGGCAAACTGTCATCAGG - Intronic
1174883213 20:54303471-54303493 TGCTTAGCACAACTTTCATGAGG + Intergenic
1176516311 21:7786459-7786481 TGACCAGGAGAACTTTAATGGGG - Intergenic
1178650339 21:34416471-34416493 TGACCAGGAGAACTTTAATGGGG - Intergenic
1178978073 21:37237635-37237657 TGCCTAAGAGATCTGTCCAGAGG - Intronic
1180048082 21:45318830-45318852 AGCCTAGAAGAACTGCCAGGGGG - Intergenic
1181421705 22:22803710-22803732 TGCCTCAGGGGACTGTCATGGGG + Intronic
1182186852 22:28413060-28413082 TGCCTAGGAGCACATTCAGGTGG + Intronic
1184732731 22:46379732-46379754 TGCCCAGGGCAACTGTGATGGGG + Intronic
1185133439 22:49054113-49054135 TGACTAGCAAAACTGTCTTGTGG - Intergenic
950603386 3:14056577-14056599 TGCCTAGGCATACTGTCATCAGG - Intronic
953379904 3:42461990-42462012 TGGCTATGAGAACTTTGATGTGG - Intergenic
957570171 3:81937035-81937057 AGCCTGAGAGAAGTGTCATGTGG + Intergenic
958518657 3:95156238-95156260 TGCCTAGTAGAGCTGTAAGGAGG - Intergenic
958617113 3:96509253-96509275 TTCCTATGACAACTGTCATATGG - Intergenic
961864002 3:129940344-129940366 TGCATTTGAAAACTGTCATGGGG - Intergenic
964504125 3:157379919-157379941 TGCCTTGTAGAATGGTCATGAGG + Intronic
965075379 3:163968506-163968528 TGCCTAGAAGGTTTGTCATGGGG + Intergenic
965510471 3:169563249-169563271 TGCCCTGGAGAACAGGCATGGGG + Intronic
965609721 3:170531271-170531293 TGCCGAGGAGAGCTGTTAAGAGG - Intronic
967587339 3:191231484-191231506 TGCTTAGGAGAGCTGTACTGAGG + Intronic
969040114 4:4289522-4289544 TAACTCGGAGAACTGTGATGAGG - Intronic
970658476 4:18259010-18259032 TGCCTAGGCACACTGTCATCAGG - Intergenic
972328632 4:38042593-38042615 TTCCTCGCAGAGCTGTCATGAGG - Intronic
973070696 4:45855108-45855130 TGCCTAGGACCATTGTCATCAGG - Intergenic
974734461 4:65911748-65911770 TCCCCAGGAGAGCAGTCATGGGG - Intergenic
975403933 4:73968236-73968258 TGCCCTGGAGATCTGTCCTGGGG - Intergenic
979997068 4:127443779-127443801 TGCCTGGGATAACTGTTCTGGGG + Intergenic
981626141 4:146757497-146757519 TGCCTAGGCACACTGTCATCAGG + Intronic
984772532 4:183450087-183450109 TGGCTAGGATAATTGTCATAGGG + Intergenic
988797549 5:34666215-34666237 AGCCTAGGAGTATTGTCAAGTGG - Intronic
988797574 5:34666338-34666360 AGCCTAGAAGTACTGTCAGGAGG - Intronic
991222963 5:64237062-64237084 TGCCTAGGGGAACTGAGAAGAGG + Intronic
993160499 5:84284364-84284386 GCCGTAGGAGAAATGTCATGGGG - Intronic
996532504 5:124541299-124541321 TGCCTTGGAGAGGTGTAATGCGG - Intergenic
999198967 5:149802640-149802662 TGCCTCACAGAAGTGTCATGAGG - Intronic
1001280143 5:170380888-170380910 TGCCTAGGAGAACTGTCATGGGG + Intronic
1001315915 5:170641250-170641272 AGCCTGGGAGAAATGTGATGAGG - Intronic
1001492178 5:172163728-172163750 TGCCTAGGAAAATTTGCATGAGG + Intronic
1005228464 6:23671394-23671416 AGCCTATGAGAGCAGTCATGGGG - Intergenic
1005479874 6:26245414-26245436 TGCATATGACAAGTGTCATGCGG + Intergenic
1010692410 6:78925903-78925925 TGCTTAGGATAACGGTCTTGAGG - Intronic
1010768857 6:79805846-79805868 TGCCTGTCAGAACTGTCATGGGG + Intergenic
1011852086 6:91641535-91641557 TGTCTAGTAGATCTGTCATCAGG - Intergenic
1012423801 6:99092975-99092997 TGCCCAGGAGCACTTCCATGAGG + Intergenic
1012484823 6:99709716-99709738 TGTCTAGGAGATCTTTCATTAGG + Intergenic
1013412091 6:109891667-109891689 GGCCTAGGAGTTGTGTCATGGGG - Intergenic
1016848530 6:148593303-148593325 TGACTACGAGAAGTGGCATGTGG + Intergenic
1017883316 6:158577158-158577180 TGCCTAACAGATCTGTCATATGG - Intronic
1020785283 7:12566008-12566030 TTCCTTGTAGAATTGTCATGAGG - Intergenic
1024343370 7:48289122-48289144 TGCCTTGGTGAAGTGTCAGGAGG + Intronic
1027417496 7:77989032-77989054 TGCCTAGGCACACTGTCATCAGG - Intergenic
1029119996 7:98261435-98261457 AACCTGGGAGAACAGTCATGGGG - Intronic
1031879381 7:127178532-127178554 TGCCTAGGCACATTGTCATGAGG + Intronic
1033015806 7:137670382-137670404 TTACTATGACAACTGTCATGGGG - Intronic
1033843534 7:145403928-145403950 TGCCTAGTAGAGCTGTCAGAAGG + Intergenic
1034705348 7:153138284-153138306 TGCCTAGGCAAATTGTCATCAGG - Intergenic
1035392560 7:158515093-158515115 TGGCGAGGAGAACTGGGATGCGG + Intronic
1036550418 8:9810647-9810669 TGGCTGGGAGGTCTGTCATGGGG + Intergenic
1037268057 8:17090039-17090061 TACCTGGTAGAACGGTCATGAGG - Intronic
1040442675 8:47461113-47461135 TGCCTAGGCATACTGTCATCAGG - Intronic
1041937664 8:63351838-63351860 TCCCTAGGAGAAGAGTCAAGTGG - Intergenic
1042892730 8:73631022-73631044 TGTCTAGGAGATCTGACATTTGG + Intronic
1043121532 8:76331477-76331499 TGCCTAGGCACACTGTCATCAGG - Intergenic
1045647578 8:104314787-104314809 TGCCTGGGAGAACTATCAAATGG - Intergenic
1046184523 8:110695224-110695246 TGCATGTGAGAGCTGTCATGAGG + Intergenic
1047041735 8:121004727-121004749 TGCCTAGGAGAACAGTGAAAAGG + Intergenic
1049123784 8:140766876-140766898 TGCCTTGTAGCACTGTTATGAGG + Intronic
1049741788 8:144244543-144244565 TGCAGGGGGGAACTGTCATGGGG + Intronic
1050398805 9:5229265-5229287 TAGCTGGGAGATCTGTCATGGGG + Intergenic
1050978066 9:11967250-11967272 TGCCAAGGAGAACTGGAGTGTGG - Intergenic
1051677887 9:19576963-19576985 CGCCAAGAAGAAATGTCATGTGG - Exonic
1057119299 9:92557281-92557303 TGCCTAGGCACACTGTCATCAGG - Intronic
1058062608 9:100514265-100514287 AGAATAGGAGAACTGTCCTGAGG + Intronic
1187180474 X:16939158-16939180 AGCCCATGAGAGCTGTCATGGGG - Intergenic
1188085778 X:25899401-25899423 TGGCTGGGAGATCTGTCATAGGG + Intergenic
1189413760 X:40795757-40795779 CGCCTAGGCGCACTGTCATCAGG + Intergenic
1190812604 X:53899117-53899139 TGCCCAGAAGAACTGAGATGAGG + Intergenic
1192978852 X:76317574-76317596 TGCCTAGGCACACTGTCATCAGG - Intergenic
1193872393 X:86816075-86816097 TGCATAGCAGCACTATCATGAGG - Exonic
1194486942 X:94496642-94496664 TAGCTAGGAGGTCTGTCATGGGG + Intergenic
1195077828 X:101344206-101344228 TGCCGTGGAGAACAGTCAAGAGG - Intergenic
1195913193 X:109910091-109910113 TGCCTAGTAGAATTGTTTTGAGG + Intergenic
1195973069 X:110494972-110494994 TGGCTAGGAGAACCATGATGAGG + Intergenic
1201520671 Y:14870275-14870297 TGGCTTGGAGGTCTGTCATGGGG - Intergenic