ID: 1001280221

View in Genome Browser
Species Human (GRCh38)
Location 5:170381449-170381471
Sequence GTCCTCTGGAATCACTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 173}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001280221_1001280223 -8 Left 1001280221 5:170381449-170381471 CCTTCACAGTGATTCCAGAGGAC 0: 1
1: 0
2: 0
3: 21
4: 173
Right 1001280223 5:170381464-170381486 CAGAGGACACCCAGCTAGCCTGG 0: 1
1: 0
2: 3
3: 26
4: 221
1001280221_1001280232 28 Left 1001280221 5:170381449-170381471 CCTTCACAGTGATTCCAGAGGAC 0: 1
1: 0
2: 0
3: 21
4: 173
Right 1001280232 5:170381500-170381522 TGAACCCCTATGATGGACATAGG 0: 1
1: 0
2: 0
3: 8
4: 132
1001280221_1001280230 21 Left 1001280221 5:170381449-170381471 CCTTCACAGTGATTCCAGAGGAC 0: 1
1: 0
2: 0
3: 21
4: 173
Right 1001280230 5:170381493-170381515 AGCCACTTGAACCCCTATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001280221 Original CRISPR GTCCTCTGGAATCACTGTGA AGG (reversed) Intronic
902774667 1:18666972-18666994 GTCCTCTGGGGTCATTGAGAAGG + Intronic
903096586 1:20981214-20981236 GGCCTCTGGAAAAACTGGGAAGG + Exonic
904830182 1:33301239-33301261 GCCCTGTGGAAGCACTGTGAGGG + Intergenic
904920799 1:34006455-34006477 TTCCTCTGGAAACAGTGTGGAGG - Intronic
906002874 1:42442220-42442242 ATCCTCTGGAACCAATGTGGAGG + Intronic
908048793 1:60205083-60205105 GTCATGTGACATCACTGTGATGG - Intergenic
911687439 1:100793259-100793281 GTCCTCAGCAATCACTGTAGTGG + Intergenic
913150594 1:116038689-116038711 GTCTTCTGGTAAGACTGTGATGG + Intronic
917504218 1:175613570-175613592 GTCCTCTGGAATCAGAGGGCAGG - Intronic
922213386 1:223501944-223501966 GTGCTGTGGAATCAATGTGAAGG + Intergenic
924392665 1:243580373-243580395 GTGGCCTGGAGTCACTGTGACGG + Intronic
1066358992 10:34712422-34712444 GTGCTCTGTAATCAGAGTGAGGG - Intronic
1066810032 10:39318544-39318566 GTCGTTTGGAATCACTGTTTTGG - Intergenic
1067853555 10:49770327-49770349 GTACTCTGAAACTACTGTGAAGG - Intergenic
1068844846 10:61660290-61660312 GACCTCAGGAATCACAGTGTTGG + Intergenic
1069829016 10:71271452-71271474 GTCCGATGGGGTCACTGTGATGG - Intronic
1077186604 11:1238315-1238337 CTCCTCTGGAAGCTCTGTGAGGG - Intronic
1078552869 11:12292491-12292513 GTCCTCAGGGATGGCTGTGAAGG - Intronic
1078749693 11:14149116-14149138 TTCCTTTGGAATACCTGTGAAGG - Intronic
1081067901 11:38570220-38570242 GTACTATGGAATCACAATGAAGG + Intergenic
1084620595 11:70267804-70267826 GTGCTGTGGAATCACAGGGAAGG - Intergenic
1085384344 11:76148569-76148591 GTCCCCTGGGAGCTCTGTGAAGG + Intergenic
1087628295 11:100621666-100621688 ATCCTCTGAAATCAATGTGGAGG + Intergenic
1087890139 11:103528594-103528616 GTCCTCTAGAATAACTGTGCTGG - Intergenic
1088983752 11:114887704-114887726 GCCCTCTGGACTCCCTGGGAAGG - Intergenic
1089033141 11:115354779-115354801 GTTATCTTGAATCACTCTGAAGG - Intronic
1089044665 11:115490124-115490146 TTCCTCTAGAATCAGTGTTAAGG + Intronic
1089683881 11:120134675-120134697 GTCCTCTAAAGTGACTGTGATGG - Intronic
1091086773 11:132728359-132728381 AGGCCCTGGAATCACTGTGAAGG + Intronic
1092254176 12:6917196-6917218 TTCCTCAGGAATGACTGTCAGGG + Intronic
1095539540 12:43292721-43292743 GGGCTCTGGAGTGACTGTGAAGG + Intergenic
1097710891 12:62915693-62915715 GTCCTCTGGAACCTCTCTGTAGG - Intronic
1100815108 12:98379355-98379377 GTCATCTGGAATCATTTTAATGG - Intergenic
1102219058 12:111182135-111182157 GCCCTCCCGAATGACTGTGATGG + Intronic
1104146672 12:126040657-126040679 GTCCTCTAGGACCACAGTGATGG - Intergenic
1105231625 13:18501636-18501658 GTGTTCTGGAATCCCTTTGAGGG + Intergenic
1105231656 13:18501876-18501898 GTGCTCTGGACTCTTTGTGAGGG + Intergenic
1109243012 13:59914189-59914211 GTTCTCTGTGTTCACTGTGATGG - Intronic
1112093039 13:96102895-96102917 GTCCTATAGAAACACTGTGTAGG + Intronic
1112476876 13:99739460-99739482 TGCCTCTGGAATCCCTGTTACGG + Intronic
1113771338 13:112911199-112911221 GTCTTCTGGAGTCACTGACATGG - Intronic
1114016931 14:18438900-18438922 GTTCTCTGGAATCTTTGTGAGGG + Intergenic
1114021557 14:18484209-18484231 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1114023082 14:18498786-18498808 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1114023114 14:18499168-18499190 GTGTTCTGGAATAATTGTGAGGG - Intergenic
1119099808 14:71869388-71869410 GTCCCCTGGAATCACAGTCATGG - Intergenic
1122651298 14:103228596-103228618 CTCCTCTGGCCTCCCTGTGATGG - Intergenic
1123493276 15:20799609-20799631 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1123549783 15:21368711-21368733 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1124578130 15:30927409-30927431 GTCCTTTTGAATCCCTGAGACGG + Intronic
1124589532 15:31040924-31040946 CTTCTCTGTAATCACTGTGATGG - Intronic
1126750585 15:51872786-51872808 GTACACTGAAATCACTGTAAAGG + Intronic
1127282624 15:57504873-57504895 GGCCCCATGAATCACTGTGAGGG - Intronic
1129948921 15:79568654-79568676 GTCCTCATGAATGACTTTGAAGG + Intergenic
1130251659 15:82303986-82304008 GTCCTCTGGAGCCACTTTGCTGG + Intergenic
1131759496 15:95604979-95605001 GTCCGTGGGAATCACTGGGATGG + Intergenic
1202958114 15_KI270727v1_random:95929-95951 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1135423913 16:22322945-22322967 GTTCTCTGGACTCACGGTGGGGG + Intronic
1137790430 16:51170390-51170412 GACCTCTGGAAGCCCAGTGAAGG - Intergenic
1138627295 16:58262501-58262523 GTCATCTGGAAACACTCTGCAGG + Exonic
1142510326 17:388985-389007 GTCCTCTGGTATCAGTGGGGAGG - Intergenic
1146624351 17:34424453-34424475 GTCCTCAGGAAACACTGTTATGG - Intergenic
1147351866 17:39854211-39854233 GTCTTCTGGAATAATTGTGCTGG - Intronic
1147559443 17:41499950-41499972 GTCCACGGGAAGCATTGTGAAGG + Intergenic
1148466722 17:47869305-47869327 TTCCTCTGGAATCCCTTTGGAGG + Intergenic
1148671536 17:49414384-49414406 GAGCTCTGGAATAACTGGGAGGG + Intronic
1149115077 17:53084010-53084032 GTCCTCTGAAATTTCTGAGAAGG - Intergenic
1151180629 17:72325101-72325123 CTCCCATGGAATGACTGTGATGG - Intergenic
1203156509 17_GL000205v2_random:9011-9033 GTGTTCTGGAATCTATGTGAGGG + Intergenic
1153114220 18:1635207-1635229 GTATTCTGTAATCACTGAGAAGG + Intergenic
1154450831 18:14474147-14474169 GTCCTCTGGAACCACAGTCCAGG - Intergenic
1154521658 18:15236828-15236850 GTGCTCTGGACTCTTTGTGAGGG - Intergenic
1154521688 18:15237067-15237089 GTGTTCTGGAATCCCTTTGAGGG - Intergenic
1156745131 18:40381193-40381215 GAACACTGGAGTCACTGTGATGG - Intergenic
1157918333 18:51691750-51691772 CTTCACTGGGATCACTGTGAAGG - Intergenic
1159781772 18:72668214-72668236 GCCTTCTGGAATCACTGGAATGG - Intergenic
1159937122 18:74378016-74378038 GTCCTCAGGAAATGCTGTGAAGG + Intergenic
1163277253 19:16292956-16292978 TTCCTCAGGAATAAATGTGAAGG - Intergenic
1164416333 19:28049117-28049139 GACCTCTGTAATCACAGTGCTGG + Intergenic
1165103819 19:33456952-33456974 GTCCTCTGCATGCCCTGTGAGGG + Intronic
1165278551 19:34775990-34776012 GTATTCTGTAATCACTGAGAAGG - Intergenic
925140018 2:1543885-1543907 GGCCTCTGGAAACACAGTCATGG + Intergenic
925246737 2:2390212-2390234 GGCCTCAGGAAACACAGTGATGG + Intergenic
925449175 2:3953607-3953629 GGCCTTTGGAGTCACAGTGATGG + Intergenic
925770178 2:7274549-7274571 GTCCTGGGGAATCTCAGTGAAGG + Intergenic
926532727 2:14070715-14070737 GTTCTCTGGAATGACTGTTATGG + Intergenic
927760182 2:25745526-25745548 TCCCTCTGGAGTCACTGTGTTGG - Intronic
928049034 2:27969325-27969347 GATCTCTGGAAGCACAGTGAGGG + Intronic
929378101 2:41315612-41315634 GTCTTCTGGATTCAATGTAATGG - Intergenic
931126938 2:59288709-59288731 GCCCTCTGGGAACACTGGGAAGG + Intergenic
932763483 2:74455826-74455848 CCCCTCTGGGATCACAGTGAAGG - Exonic
932849102 2:75166054-75166076 CTCCTCTCTAATCACAGTGAGGG - Intronic
933757596 2:85652221-85652243 GTCCTGAGGTAACACTGTGAAGG + Intergenic
934232028 2:90192724-90192746 GTCATCTGGAGTCACTGAGATGG + Intergenic
938521023 2:132070562-132070584 GTGCTCTGGACTCTTTGTGAGGG - Intergenic
938521052 2:132070801-132070823 GTGTTCTGGAATCCCTTTGAGGG - Intergenic
940925794 2:159362474-159362496 GTCCTGTGGAATCATTATGGAGG + Intronic
945807579 2:214509033-214509055 CCTCTCTGGAATCACTCTGAGGG + Intronic
947878831 2:233486861-233486883 GTCCTCTGGCCGCACTGTGCTGG - Intronic
1170291473 20:14774548-14774570 GTCCTCTCAAATAACTGAGAAGG - Intronic
1170546306 20:17437994-17438016 GTCCTCTGGGAGCACGGTGTGGG - Intronic
1170550222 20:17469961-17469983 GGCCTCTGGAATGCCAGTGATGG - Intronic
1170607730 20:17886423-17886445 GCCCTCTGGAATATTTGTGAAGG - Intergenic
1172970907 20:38872500-38872522 GTGCACTGGAATCACTGGCAGGG + Intronic
1173362152 20:42354543-42354565 GTACACAGGAAACACTGTGAAGG - Intronic
1173883064 20:46433442-46433464 GTCCTCTGGAAACACCCTCACGG - Intergenic
1175057800 20:56213977-56213999 GGCCTCAGGAAACACTGTGAGGG + Intergenic
1176775597 21:13129939-13129961 GTGTTCTGGAATCCCTTTGAGGG + Intergenic
1176775627 21:13130178-13130200 GTGCTCTGGACTCTTTGTGAGGG + Intergenic
1180441436 22:15369773-15369795 GTTCTCTGGAATCTTTGTGAGGG + Intergenic
1180446017 22:15414555-15414577 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1180447186 22:15425742-15425764 GTGTTCTGGAATCTTTGTGAGGG - Intergenic
1180447218 22:15426124-15426146 GTGTTCTGGAATAATTGTGAGGG - Intergenic
1180523318 22:16230676-16230698 GTGTTCTGGAATCCCTTTGAGGG + Intergenic
1180523349 22:16230915-16230937 GTGCTCTGGAATCTTTGTGAGGG + Intergenic
1180523589 22:16233214-16233236 GTGTTCTGGAATCCCTTTGAGGG + Intergenic
1180523621 22:16233453-16233475 GTGCTCTGGAATCTTTGTGAGGG + Intergenic
1184122082 22:42458233-42458255 GTGCTCCGGAATCACTGTATGGG + Intergenic
950194376 3:10998833-10998855 GCCCTCTGAACTCACTGTCAGGG - Intronic
951515032 3:23549628-23549650 GACCTCTGTAAACACTTTGAAGG + Intronic
953284980 3:41597580-41597602 GTCCTCTGGATTCACTGCGTAGG + Intronic
954013427 3:47663624-47663646 GACCTCTGGAATCACAGGGCCGG - Intronic
954119788 3:48490432-48490454 GCCCTCTGGACCCACTGTGATGG - Intronic
955435481 3:58894835-58894857 GTCCTCTGAAATCAAGGTGGAGG + Intronic
956375414 3:68608729-68608751 GTCCTCTGAAATCAAGGTGGAGG + Intergenic
956623312 3:71242688-71242710 GTCCTCTGAGACAACTGTGAGGG + Intronic
956865829 3:73367630-73367652 GTGCTCTGGTATAACTGGGAGGG - Intergenic
957701071 3:83713480-83713502 GTGTTCTTAAATCACTGTGAGGG - Intergenic
958700902 3:97587840-97587862 GTCTTCTAGGATCACTGTGTTGG + Intronic
960391849 3:117086795-117086817 GTCATCAGAGATCACTGTGAAGG + Intronic
962385833 3:134931536-134931558 GTCCTCTGGAACCACCTTCAGGG + Intronic
963252855 3:143119022-143119044 GTCCTCTGGAATTGGGGTGATGG - Intergenic
964213176 3:154250464-154250486 ATCCTCTGGAGTCCCTGTGAGGG + Intronic
966874030 3:184311515-184311537 GTACCCTGGTATCACTGAGATGG + Intronic
968586509 4:1419205-1419227 GTTGTCTACAATCACTGTGAGGG - Intergenic
972656161 4:41065647-41065669 GTCCTCAGGAAAGACTGAGATGG + Exonic
973155322 4:46944460-46944482 GTTCTCAAGAAGCACTGTGAGGG - Intronic
975413709 4:74084210-74084232 GTCCTTTGGGATCAATGTCATGG - Intergenic
975673616 4:76805346-76805368 GTACTCAGGAATCACTGTGCTGG + Intergenic
981455441 4:144948044-144948066 ATCCTCTGGCACCACTGTGGTGG + Intergenic
982140910 4:152317018-152317040 TTCCTTTGGAATATCTGTGATGG - Intergenic
988386008 5:30566124-30566146 GTCTTCTGCCATGACTGTGAGGG - Intergenic
989115899 5:37952068-37952090 GTTCTCTGGAGTCACTGTTTTGG + Intergenic
992735125 5:79712006-79712028 GTCCTCTGGAGGCCCAGTGATGG - Intronic
994028390 5:95112223-95112245 GTCCTCTGGCATCACTCAAAAGG - Intronic
994413913 5:99443547-99443569 GTCCTCTGGAAACACAATCATGG - Intergenic
995408151 5:111825754-111825776 TTCTCCTGGAACCACTGTGATGG - Intronic
999433405 5:151543243-151543265 GTCCTCTGGGTTCACTGAGTAGG + Exonic
1000149179 5:158482867-158482889 GTCCTCTGCACTCACTTGGATGG + Intergenic
1001280221 5:170381449-170381471 GTCCTCTGGAATCACTGTGAAGG - Intronic
1001810973 5:174627930-174627952 GTCCCCTGGGATCAGTGTGAAGG - Intergenic
1002368101 5:178729173-178729195 CTCCTCCCGAATCCCTGTGAGGG - Intronic
1002385225 5:178860875-178860897 CTCCTCCCGAATCCCTGTGAGGG + Intronic
1002839753 6:895660-895682 GTCCTCAGAACACACTGTGAGGG - Intergenic
1003678149 6:8226104-8226126 TTCTTCTGGAATCCCTCTGAAGG + Intergenic
1004000994 6:11597123-11597145 GTCTTATGGAACCACTGTCATGG + Intergenic
1007345106 6:41223223-41223245 GTCCTCAGAAATCACAGTGACGG + Intergenic
1010262117 6:73829456-73829478 GCCCCCAGGAATCACTGGGAAGG - Intergenic
1010498088 6:76560955-76560977 GCCATGTGGAATCAATGTGATGG - Intergenic
1010631676 6:78206281-78206303 GACCTGTGGAAACATTGTGATGG + Intergenic
1012037864 6:94165964-94165986 TTCCTCGGGAAGCACTTTGATGG + Intergenic
1012936674 6:105375257-105375279 GTCCTCTGTAATCAATAAGATGG - Intronic
1017840767 6:158221003-158221025 GTCCTCCGGCCTCACTGTGTTGG + Intergenic
1019148848 6:169991034-169991056 GTCCTCTGCAATCACCCTGCAGG + Intergenic
1019307662 7:343534-343556 GTCCTCTGGTCTCACGGTGCTGG - Intergenic
1022113492 7:27245026-27245048 GTGCTCTGGACTCGCTGTGCAGG + Exonic
1022533456 7:31081257-31081279 GTCTTCTGGATTCCCTTTGACGG + Intronic
1024383387 7:48724478-48724500 GTCTTCTGCCATGACTGTGAGGG - Intergenic
1024803414 7:53107763-53107785 GTCCTATGGAAGCTATGTGAAGG + Intergenic
1024865302 7:53899312-53899334 GCCCTCTGGCATCACTAGGAAGG - Intergenic
1026824561 7:73573372-73573394 GTCCTCTGGGGTGGCTGTGAAGG + Exonic
1027497455 7:78905841-78905863 GTCCTAGAGAATCACTGTTAGGG - Intronic
1031960291 7:127983345-127983367 GTCCCCTGGAGTCATTGTCAAGG - Intronic
1032719527 7:134539160-134539182 GTACCTGGGAATCACTGTGAGGG + Intronic
1035647059 8:1232509-1232531 TTCCTCTTGCATCACTGTGCTGG + Intergenic
1036042411 8:5100656-5100678 GTGCTCTGGAATCAGGCTGATGG - Intergenic
1037746970 8:21653392-21653414 GTCCCCTGGATTCACTTTGGGGG - Intergenic
1041824446 8:62077514-62077536 GTCCTCTTAAATCATTTTGAGGG - Intergenic
1042052879 8:64731038-64731060 GGCCTCAGAAAACACTGTGATGG - Intronic
1044795572 8:95893714-95893736 GTCCTCTGCCATTACTGTCATGG - Intergenic
1045741935 8:105370930-105370952 GTCCTCATGAACCTCTGTGATGG + Intronic
1046055771 8:109076440-109076462 GTCCTCTGGATTTTCTCTGATGG + Intergenic
1049061510 8:140279688-140279710 GTCCTGCGGATGCACTGTGACGG - Intronic
1055648662 9:78385483-78385505 ATGCTCTGGAATTAGTGTGATGG - Intergenic
1055993040 9:82128624-82128646 GTTCTCTAGTATAACTGTGAGGG + Intergenic
1057291101 9:93807966-93807988 TTCCTCTAGAATGAGTGTGAGGG + Intergenic
1058934619 9:109757269-109757291 GTTCTCTTGAAGCAATGTGATGG - Intronic
1059029605 9:110677002-110677024 GTCCTCTTAAAGCACAGTGAGGG - Intronic
1061578512 9:131522688-131522710 GTCCTCTGGCATCTGTGTGGAGG + Intronic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1186909488 X:14146760-14146782 TCCCTCTGGCAGCACTGTGAAGG + Intergenic
1195611794 X:106875293-106875315 GACCTCTTGAGTCACTCTGAAGG - Exonic
1195707523 X:107748748-107748770 ATCCTCTGGAAAGCCTGTGAAGG - Intronic
1198687167 X:139238626-139238648 TTCCTCTGGAAGCTCTGTGCCGG - Intergenic
1199756001 X:150865637-150865659 CTCCTGTGCAGTCACTGTGATGG - Intronic