ID: 1001286995

View in Genome Browser
Species Human (GRCh38)
Location 5:170431044-170431066
Sequence CAGCATCTGCAGATGGAGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 2, 3: 53, 4: 346}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001286995_1001286998 8 Left 1001286995 5:170431044-170431066 CCTCACTCCATCTGCAGATGCTG 0: 1
1: 0
2: 2
3: 53
4: 346
Right 1001286998 5:170431075-170431097 CATTCCAGCCCTCGCCTCTGAGG 0: 1
1: 1
2: 1
3: 29
4: 390

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001286995 Original CRISPR CAGCATCTGCAGATGGAGTG AGG (reversed) Intronic
900384144 1:2401692-2401714 TTGCAGCCGCAGATGGAGTGTGG + Intronic
900475865 1:2876065-2876087 CTGCATCCGCAGAGGGAGTTGGG + Intergenic
900843316 1:5074986-5075008 AAGCATCTTCAGTTGAAGTGAGG - Intergenic
901041775 1:6368450-6368472 CTGCACCTGCATATGGAGTGTGG - Intronic
901654241 1:10760230-10760252 CAGCCTCTGGAGATGGAGAAAGG + Intronic
902253101 1:15168881-15168903 CAATATCTGGAGTTGGAGTGGGG + Intronic
902634435 1:17725975-17725997 CACCATCTGCAGGTGGAGAGTGG - Intergenic
902654614 1:17858954-17858976 CTGAGTCTGCAGATGGAGTGAGG - Intergenic
903292947 1:22326196-22326218 CAGCCCCTCCAGCTGGAGTGTGG + Intergenic
904299209 1:29543273-29543295 CACCAGCAGCATATGGAGTGGGG - Intergenic
904756091 1:32769765-32769787 CAGCATGTGCAGAAGGAGCTTGG + Exonic
905031416 1:34886369-34886391 CAGCCTCTGCAGATATAGAGAGG - Intronic
905351648 1:37350846-37350868 AAGCATCTGCAGAGGGAGTTGGG - Intergenic
912609125 1:111025267-111025289 CGGCCTCTGCAGGAGGAGTGGGG - Intergenic
913777735 1:122343374-122343396 TAGCATCTGCAAATGGATAGGGG + Intergenic
914680686 1:149936445-149936467 CAGCTTCTGCTGATGGAGCCTGG - Intronic
915495362 1:156278751-156278773 TAAAATCTGCAGATGGAGTGAGG + Intronic
915668205 1:157463991-157464013 CAGCATCCCCCTATGGAGTGTGG - Intergenic
915705095 1:157836136-157836158 CAGCGTCTCCATCTGGAGTGCGG - Exonic
917632558 1:176904457-176904479 CAGCATGGGGAGAGGGAGTGCGG + Intronic
918151359 1:181800136-181800158 CAGATTCTGCAGCTGGTGTGGGG + Intronic
918942974 1:191026209-191026231 CAGCAGCTGCAGAGGGGGCGCGG - Intergenic
919153227 1:193726875-193726897 CAACATGAGCAGAAGGAGTGTGG + Intergenic
919682864 1:200453564-200453586 GAGCATCTGCAGAGGAAGAGTGG - Intergenic
920017729 1:202927129-202927151 CAGCCTGTGGGGATGGAGTGCGG + Exonic
920070194 1:203297071-203297093 CAGCATCCATAGAGGGAGTGAGG - Intergenic
920445016 1:206009742-206009764 CAGCATGTGGAGCTGGAGAGAGG + Exonic
921195962 1:212757946-212757968 CAGGATCTACTGATGGACTGAGG + Intronic
921885076 1:220297240-220297262 CTGCCTCTGCAAAGGGAGTGAGG - Intergenic
922239620 1:223747190-223747212 CAGCAAGAGCAGATGGGGTGAGG - Intronic
922571746 1:226638439-226638461 CAGCAGCTGCAGAGCAAGTGGGG - Intronic
923302517 1:232655093-232655115 CAGAATCAGCAGATGGGCTGGGG - Intergenic
923643590 1:235791859-235791881 CAGCAACGGCAGGTGGACTGGGG + Exonic
924706590 1:246507351-246507373 GAGCATGCGCAGATGGAGTCTGG + Intergenic
1062909168 10:1201251-1201273 CTGCATTTGCAGAGGGAGAGAGG - Intronic
1065048626 10:21767200-21767222 AAGAATCTGTTGATGGAGTGGGG + Intronic
1065252341 10:23828315-23828337 CAGCAATAGCAGATGGAGTAGGG + Intronic
1067899852 10:50228322-50228344 CAGCATTTGCAATTTGAGTGGGG + Intronic
1070113305 10:73505407-73505429 CAGGCTCTGCAGATGGCATGGGG - Exonic
1070333277 10:75432749-75432771 CAGCTCCTACAGATGCAGTGAGG + Intronic
1073412726 10:103355493-103355515 AAGAATCTGGAGATGGAGGGTGG + Intergenic
1074964158 10:118473997-118474019 GGGCATTTGCAGATGAAGTGCGG + Intergenic
1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG + Intergenic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1076570597 10:131430152-131430174 GACCATCTGCAGCTCGAGTGTGG - Intergenic
1076712513 10:132346181-132346203 CAGCGGCTGCTGATGGGGTGCGG + Intronic
1077552562 11:3207535-3207557 CAGCATATGCACAGGGAGAGGGG - Intergenic
1077747599 11:4924447-4924469 AAGCATCTGCAGATGGCATAGGG + Intronic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1080772583 11:35355548-35355570 CACCAGCTGTAGAGGGAGTGAGG + Intronic
1084209045 11:67612526-67612548 CAGCAGCGGCAGCTGGAGGGTGG - Intronic
1084464340 11:69313420-69313442 CAGCATCTGCAAGTGGGTTGGGG + Intronic
1084800891 11:71543182-71543204 CAGCAGCTGCAGGTGGAGGAGGG + Intronic
1084947344 11:72645516-72645538 CAGATTGTGCAGTTGGAGTGAGG - Intronic
1085464880 11:76716610-76716632 CACCAGCTGCAGCTGGTGTGGGG - Intergenic
1085821642 11:79800159-79800181 CAGGATCTGCATATGGTGTGAGG + Intergenic
1086417660 11:86605314-86605336 CAGCATGTGCAGATGCCCTGAGG - Intronic
1086470950 11:87109514-87109536 CAGCATGAGGAGATGAAGTGAGG + Intronic
1089254572 11:117187548-117187570 GAGCATCTGCAGAGGGTGTGGGG - Intronic
1090075360 11:123577344-123577366 CTGCAGCGGCAGATGGAGAGAGG - Intronic
1090189420 11:124758740-124758762 CAGCCTCTGCAGTTGTAGCGGGG + Intronic
1091695389 12:2624894-2624916 CAGCAGCTGCGGATGAAATGCGG + Intronic
1092084343 12:5743254-5743276 CAGCCTCTGCAGCAGGACTGTGG + Intronic
1094292106 12:28862913-28862935 CACTATCTCCAGATAGAGTGAGG + Intergenic
1095818441 12:46450485-46450507 CAGCCTCTACAGAAGCAGTGGGG - Intergenic
1096112854 12:49039519-49039541 CAGCAGCTGCAGGAGCAGTGGGG - Exonic
1096425331 12:51496711-51496733 CATCATCTGCAGATGGCTAGGGG - Intronic
1096559269 12:52424193-52424215 CAGCCTCTGCATCTGGAGGGAGG + Exonic
1096673425 12:53213695-53213717 CAGCATCTGGAGGTGGGGGGTGG + Exonic
1096876649 12:54634870-54634892 CAGAATCTGCAGAAGGTCTGGGG + Exonic
1097166709 12:57089902-57089924 CCGCATCTTCAAGTGGAGTGGGG - Intronic
1097221885 12:57455900-57455922 CAGGAGCAGCAGAGGGAGTGGGG + Intronic
1098064917 12:66603579-66603601 CAGCAACTGCACAGGTAGTGAGG + Intronic
1101514615 12:105423083-105423105 GAGCACCTGCAAAGGGAGTGGGG - Intergenic
1102441913 12:112969909-112969931 CAGCTTCTGCAGAAAGAATGGGG + Intronic
1102514890 12:113439805-113439827 CAGCATGCCCAGCTGGAGTGAGG - Intergenic
1102869094 12:116399478-116399500 CTGCAGCTGCAGAAGGAGAGTGG - Intergenic
1103134456 12:118495836-118495858 CAGCATCCACAGCTGAAGTGGGG - Intergenic
1104283996 12:127406505-127406527 AACTATCTGCAGATGGACTGTGG - Intergenic
1105282145 13:18971994-18972016 CAGCAGCTGCAGCTTGAGGGAGG + Intergenic
1106614146 13:31310829-31310851 CAGCATCTGGACAAGGGGTGGGG - Intronic
1107649874 13:42534535-42534557 CAGCAGCATCAGATGGATTGTGG + Intergenic
1107730933 13:43348074-43348096 CAGCATGAGCAGATGCAGGGAGG - Intronic
1107796166 13:44053882-44053904 TAGCATGTGCAAAAGGAGTGGGG + Intergenic
1108478479 13:50843561-50843583 CAGCTGCTGCAGCAGGAGTGGGG - Exonic
1112370844 13:98792076-98792098 GAGTATCTGGAGATGGAGGGTGG + Intergenic
1112987293 13:105466649-105466671 TAGCACAGGCAGATGGAGTGAGG - Intronic
1113397398 13:109961340-109961362 CAGCATCAGGAGATGGACAGAGG - Intergenic
1113741726 13:112716129-112716151 CAGCATCTGCAGAAGGCCAGAGG - Intronic
1114401254 14:22413019-22413041 CAGCATCGCCAGATGGGGTGCGG - Intergenic
1115706025 14:35998862-35998884 CTGCATCTGCAGATGAACTTCGG + Intergenic
1116997385 14:51337767-51337789 GACCATCTGCAGAGGTAGTGTGG + Intergenic
1118621932 14:67621284-67621306 AAGCATCTCAAGATGGAGTTAGG - Intronic
1120018699 14:79503466-79503488 CAGCATGTGCAGAGGCAGAGAGG - Intronic
1120209348 14:81619537-81619559 CAGCTTCTGCTAATGAAGTGAGG - Intergenic
1121308410 14:92922005-92922027 CAGCAGCCGCAGATGGAGAGGGG + Intergenic
1121880685 14:97498029-97498051 CAGCTCCTGCAGATGGACTGGGG - Intergenic
1122888059 14:104719310-104719332 CAGCCCCTGAAGTTGGAGTGGGG + Exonic
1122902757 14:104788582-104788604 CAGCAGCTGGGGATGCAGTGAGG + Intronic
1123685506 15:22794391-22794413 CAGTGTGTGAAGATGGAGTGTGG + Intronic
1124220758 15:27847981-27848003 CGGCATCTGCAGCTTGAGTGTGG - Intronic
1126516110 15:49539740-49539762 CAGCATCTGCATCTGCATTGTGG - Intronic
1128457140 15:67837663-67837685 AAGCATCTGAGGATGGAGAGAGG - Intergenic
1128497355 15:68206107-68206129 CAGCTTCTGCGGAAGGGGTGGGG - Intronic
1129291169 15:74568995-74569017 CAGCAGAGGCAGATGGAGGGTGG - Intronic
1129540549 15:76343887-76343909 CATCATCTGCAAGTGGGGTGGGG - Intergenic
1131067749 15:89444723-89444745 CTGCTGCTTCAGATGGAGTGGGG - Intergenic
1131360303 15:91784693-91784715 CAGCTTCTGCACATGGAGCCAGG + Intergenic
1132551325 16:554979-555001 CGGCAGGAGCAGATGGAGTGAGG + Intergenic
1132858989 16:2060802-2060824 CAGCAGCTCCAGGTGGGGTGGGG + Exonic
1133188183 16:4115413-4115435 CAGCAGCTGCTGGTGGGGTGGGG + Exonic
1133679929 16:8111292-8111314 CAGCAACTGCATTTTGAGTGAGG + Intergenic
1135420194 16:22300602-22300624 CAGCCGGTGCAGATGGGGTGAGG + Intronic
1136750242 16:32628981-32629003 TACCGTCTGCAGAAGGAGTGTGG - Intergenic
1137677701 16:50311839-50311861 CTCCATCTGGAGATGGGGTGGGG + Intronic
1140332403 16:74070604-74070626 CAGCATCTCCTGATGGACTTGGG + Intergenic
1140523554 16:75603076-75603098 CAGCATCACCTGAGGGAGTGTGG + Exonic
1140916798 16:79501116-79501138 CAGGGTCTCCAGAGGGAGTGTGG - Intergenic
1140954543 16:79849806-79849828 CAGCAGCTGTAGGAGGAGTGGGG - Intergenic
1141470653 16:84236199-84236221 CCTCATCTGAAAATGGAGTGGGG + Intronic
1141477555 16:84283967-84283989 CAGCCCCTGCAGCTGGAGTGGGG + Intergenic
1141595280 16:85093404-85093426 CAGAGTCTGCAGATAAAGTGGGG - Exonic
1142932915 17:3302743-3302765 AAGCATCTGCAGATGAAATGTGG - Intergenic
1143426440 17:6843010-6843032 CAGCACCTCCAGCTGGGGTGAGG + Intergenic
1144129624 17:12233662-12233684 CAGCTTCCTCTGATGGAGTGAGG - Intergenic
1145994761 17:29098964-29098986 CTGGATCTGCAGGTGGGGTGGGG + Exonic
1146601620 17:34222030-34222052 CAGTATCTGCAGCTGTAGAGTGG - Intergenic
1147475117 17:40703531-40703553 CAGCAGCTGCAGCCTGAGTGGGG - Exonic
1147574386 17:41590190-41590212 CAGAGTCTTCAGAGGGAGTGTGG - Intergenic
1147677552 17:42218589-42218611 CAGCAACTGGAGATGGAGTTGGG + Intronic
1147688486 17:42300982-42301004 CAGCAACTGGAGATGGAGTTGGG - Intronic
1148141892 17:45334850-45334872 CTTCATCTCCAGTTGGAGTGAGG + Intergenic
1148621264 17:49036200-49036222 CGGCATCTGCTGGTGGTGTGTGG + Intronic
1148830437 17:50427193-50427215 CAGCAACATCAGATGGGGTGTGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150345089 17:64398430-64398452 GAGCAACTGGAGGTGGAGTGGGG + Intronic
1151165811 17:72202839-72202861 CAGCAGCAGCAGCAGGAGTGAGG - Intergenic
1151377167 17:73697820-73697842 GGCAATCTGCAGATGGAGTGTGG - Intergenic
1152466042 17:80466662-80466684 CAGCATCACCAGACGGTGTGGGG + Intergenic
1152604159 17:81280728-81280750 CACGATCTGCAGAGGGAGAGGGG + Exonic
1152762461 17:82116250-82116272 CATCCTCTGCAGCTGGAGAGTGG + Intronic
1153782972 18:8510285-8510307 CATCATCTGGAACTGGAGTGGGG + Intergenic
1154083585 18:11280853-11280875 CTGCATCTGCAGAGGAAGTGCGG + Intergenic
1156382628 18:36578028-36578050 CAACATGGTCAGATGGAGTGGGG + Intronic
1156788179 18:40940274-40940296 CAGCATCTGCAAAAGACGTGTGG - Intergenic
1157750460 18:50173649-50173671 CAGGACTTGCTGATGGAGTGGGG + Intronic
1160349761 18:78166713-78166735 CAGTATATGTAGATGGAGAGGGG + Intergenic
1160967107 19:1751575-1751597 CAGCATCTGCACGGGGAGTGGGG + Intergenic
1161114291 19:2488257-2488279 CTGCATCTGGAGAAGGGGTGGGG + Intergenic
1161274259 19:3406780-3406802 CAGAATCTGCACTTGAAGTGAGG - Intronic
1162039493 19:7961441-7961463 CAGCATCTTCTGATGGAAGGTGG - Exonic
1162141804 19:8589696-8589718 CAGCTTGGGCAGAGGGAGTGGGG + Intronic
1162621513 19:11847914-11847936 GAGCAGCTCCAGAAGGAGTGTGG + Intergenic
1162625298 19:11880184-11880206 GAGCAGCTCCAGAAGGAGTGCGG + Intronic
1162635446 19:11964193-11964215 GAGCAGCTCCAGAAGGAGTGTGG + Intronic
1163157140 19:15445739-15445761 CAGGAGCTGCAGAGGGGGTGTGG + Intronic
1163535595 19:17874477-17874499 CAGCATCTGTAGACAGAGTGTGG - Exonic
1166235958 19:41456805-41456827 CAGCATCTCGAGATGGAGCAGGG + Intergenic
1166344626 19:42157432-42157454 CACCATCTGGAGATGCAGAGAGG - Intronic
1168686790 19:58353757-58353779 CAGCAGCTCCAGGTAGAGTGGGG - Intergenic
925312533 2:2895981-2896003 CAGCCTCTGCAGCTGTAATGTGG - Intergenic
926765231 2:16318230-16318252 AGGCCTCTGCAGCTGGAGTGGGG + Intergenic
926768323 2:16344836-16344858 CAGAAGCTGCAAATGGTGTGTGG + Intergenic
927493142 2:23533612-23533634 TGGCAGCTGCAGATGGGGTGCGG + Intronic
927638457 2:24832233-24832255 CAGCAGCTGCAGCTGGAGAGTGG - Intronic
928490608 2:31778799-31778821 TAGCAGCTGCAGCTGCAGTGTGG - Intergenic
929378495 2:41320347-41320369 CAAAATCTGCAGATGGAGCTGGG + Intergenic
929418995 2:41771766-41771788 CAGCACCTGCACATGGAAGGCGG - Intergenic
929848139 2:45554550-45554572 CAACATCTGCATATGTAATGAGG + Intronic
930688429 2:54333404-54333426 CAGCATGTGCAGGTGCCGTGAGG + Intronic
931635673 2:64338886-64338908 CATCATCTGGTGATGGGGTGGGG + Intergenic
931889971 2:66661351-66661373 CAGCAGCTGCAGTGGCAGTGAGG + Intergenic
932842733 2:75098954-75098976 CAGAACCAGCAGGTGGAGTGAGG + Intronic
932919312 2:75891461-75891483 CAGCATCTGCAGAGCAAGTCTGG - Intergenic
933093059 2:78145783-78145805 CTGCACTTGCACATGGAGTGTGG + Intergenic
933748099 2:85585222-85585244 CAGGATCTGCAGCAGGAGTGGGG - Intronic
935106605 2:100050779-100050801 CTGCATCTGCAGGGGCAGTGTGG - Intronic
936821011 2:116521046-116521068 CAGCAAAAGGAGATGGAGTGCGG - Intergenic
937385183 2:121424002-121424024 AAGCATCTGCAGAAGCAGTCAGG - Intronic
938096697 2:128468616-128468638 CAGCAGCTGCAGGGGGAATGGGG - Intergenic
938224527 2:129604512-129604534 CAGCCTCTGCAGATGGGGAGAGG + Intergenic
939535110 2:143417960-143417982 CTGCAACTGCTGATGGAGTAGGG + Intronic
942075898 2:172356930-172356952 CAGCATCTGCCTCTGGAGTGAGG - Intergenic
942341996 2:174958399-174958421 CACCAACTGCAAATTGAGTGGGG - Intronic
943666668 2:190616168-190616190 CAGTATGTGTGGATGGAGTGAGG + Intergenic
943810343 2:192179663-192179685 CAGGATCTGGAGATGGAGGTAGG - Exonic
943905257 2:193491129-193491151 CCACATCTGCAGATGGCCTGAGG - Intergenic
946661007 2:221999409-221999431 CTGCCTCTGCAGATGGAATATGG + Intergenic
947959606 2:234224699-234224721 CAGAATCTGCAGAAAGAGAGGGG - Intergenic
948284437 2:236772939-236772961 TAGAGTCTGCAGAGGGAGTGCGG - Intergenic
948338750 2:237232154-237232176 AAGCATCTGGAGAGGGAGAGGGG - Intergenic
948452177 2:238082545-238082567 GGGCATCTGCAGAGGGTGTGGGG + Intronic
1168795823 20:609735-609757 CAGAAGGTGCAGATGGAGCGCGG + Exonic
1168848625 20:961639-961661 CAGCATCTGGAGATGGGGTGTGG + Intronic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1170534297 20:17324808-17324830 CAGCATCTGCAGAAGGAAATGGG + Intronic
1170670205 20:18425909-18425931 TAGCACCTTCAGAGGGAGTGTGG + Intronic
1170775151 20:19368613-19368635 CAGAGACTGCAGATGGAATGGGG - Intronic
1170912973 20:20593202-20593224 CAGCATCTGAAGTTAGACTGTGG - Intronic
1170999111 20:21396194-21396216 CAGCAGCTGCAGCAGGAGGGCGG - Exonic
1171237044 20:23535439-23535461 CAGCAGCGGCACATGGAGAGTGG - Intergenic
1173808979 20:45944877-45944899 GAGCATCTGCGGAGGCAGTGTGG + Exonic
1174581738 20:51577010-51577032 CAGCTTGTGCAGTTGGAGAGGGG + Intergenic
1174778960 20:53370951-53370973 TAGCATCTTCAGAGGGAGTGTGG - Intronic
1175973272 20:62697936-62697958 CAGCACCTGCCGATGGAGTCGGG + Intergenic
1176123645 20:63465448-63465470 CAGCAGCGGGTGATGGAGTGTGG - Intronic
1178254951 21:31043981-31044003 CAGCATCTGCAGCAGGAGCCTGG - Intergenic
1178350049 21:31866346-31866368 CAGCAGGTGGAGATGCAGTGAGG - Intergenic
1178419863 21:32434772-32434794 TAGCATCCTCAGATGGAGCGTGG + Intronic
1180032836 21:45224030-45224052 CTGCACCTGCAGAAGGAGAGGGG + Exonic
1181016487 22:20072217-20072239 AAGCATCTTCAGATGGAGTAGGG + Intergenic
1181087717 22:20450012-20450034 CAGCCTGTGGGGATGGAGTGGGG - Intronic
1181374606 22:22446804-22446826 CAGCCTCTCCAGCTGGAGTGGGG + Intergenic
1181408388 22:22701363-22701385 CAGCATCTGTGGAAAGAGTGAGG - Intergenic
1182102438 22:27667589-27667611 CAGTCTCTGCAGAGGGACTGTGG + Intergenic
1182884997 22:33765855-33765877 TAACTTCTGCAGATGGAGAGAGG - Intronic
1183330640 22:37219036-37219058 CAGCAAGAGCAGATGGAGGGTGG - Intergenic
1183404085 22:37621599-37621621 CAGCATCTGCAGAGACAGAGGGG - Exonic
1183442657 22:37831961-37831983 CTGCATCTGCAGACTGAGGGAGG + Exonic
1184460478 22:44635008-44635030 AAGCCTCTGCAGAAGGAGTGTGG - Intergenic
1184745694 22:46454392-46454414 CTGCTTCTGCAGAGAGAGTGTGG - Intronic
1185010300 22:48309156-48309178 CAGCCTCTGCAGCTGGCATGTGG + Intergenic
1185101202 22:48841805-48841827 GAGGATCTGCAGATGGAGCTGGG + Intronic
1185103236 22:48852867-48852889 GAGGATCTGCAGATGGAGCTGGG - Intergenic
1185368861 22:50449836-50449858 CATCATTTGCATATGGAGGGAGG - Intronic
950015020 3:9749383-9749405 AAGCATGAGCAGATGGAGTATGG + Intergenic
950336101 3:12194694-12194716 CAGCATATGCTGTTGCAGTGGGG + Intergenic
950452335 3:13072423-13072445 CAGCCTCTGCTGCTGGCGTGAGG + Intronic
950787729 3:15450065-15450087 CAGCATTGCCAGATGGAGGGAGG - Intronic
950866667 3:16195337-16195359 GAGTTTCTGGAGATGGAGTGGGG - Intronic
951260008 3:20496135-20496157 CAGCACCTGCATGTGGAGAGAGG - Intergenic
952027428 3:29099865-29099887 AAGAATCTGCACAAGGAGTGGGG + Intergenic
952513147 3:34077024-34077046 CAGGATTTGCTGATGGACTGAGG + Intergenic
952772827 3:37017853-37017875 CAGCACCTCCTGATGGGGTGAGG - Intronic
953644504 3:44741709-44741731 CACCATCTGCACAGGGTGTGAGG + Intronic
955540741 3:59973419-59973441 CAGCATGTGCAGAGGGCCTGTGG - Intronic
956864439 3:73355565-73355587 CAGCACCTTCAGAGGGAGCGGGG + Intergenic
961434300 3:126906102-126906124 CAGCAGCTGGAGTGGGAGTGAGG - Intronic
961468780 3:127098265-127098287 CAGCATTTGCAGAGGTACTGTGG - Intergenic
961602525 3:128072580-128072602 CAGCAGGTGCAGAGGGAGCGCGG - Intronic
961798941 3:129429789-129429811 CAGCATCTCCATGGGGAGTGTGG - Intergenic
961917018 3:130386906-130386928 GAGCAGATGCAGATGGAGTGAGG + Intronic
962159287 3:132981849-132981871 CAGCATTAGCAAGTGGAGTGTGG - Intergenic
962959627 3:140298733-140298755 CAGCAACTGTGGATGCAGTGGGG + Intronic
963074376 3:141332690-141332712 AAGAGCCTGCAGATGGAGTGGGG + Intronic
963748454 3:149149513-149149535 AAGCACCAGCAGATGGAGAGAGG + Intronic
964088100 3:152842629-152842651 CAGCAGCTGTGGATGGAGTCAGG + Intergenic
964739936 3:159954525-159954547 CTGAATCAGCAGATTGAGTGAGG - Intergenic
965736889 3:171830087-171830109 CAGCAGCTGCAGAAGGCATGGGG + Intergenic
969134562 4:5019743-5019765 CAGGAACAGCAGATGGAGAGGGG + Intergenic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
973142090 4:46781825-46781847 CAGCAGCTGCAGAGGATGTGCGG + Intronic
976698920 4:87947813-87947835 CAGCATGTGCATTTGGGGTGAGG + Intergenic
979200084 4:117967119-117967141 TAGCATCTGCATACAGAGTGTGG + Intergenic
980970074 4:139559304-139559326 CAGCAGCAGCAGAAGTAGTGTGG + Intronic
983160122 4:164402963-164402985 CAGCACTTGCTGAGGGAGTGCGG + Intergenic
986132811 5:4946608-4946630 CAGGATCTGGACATGGAGTCTGG + Intergenic
986649139 5:9946656-9946678 CAGCATCTTGAGATGGGGAGAGG + Intergenic
986745003 5:10736160-10736182 CAGCGCCTGCAGAGGGAGTGTGG + Intronic
987109110 5:14668197-14668219 CAGCATCTGGGGGTGGGGTGGGG - Intronic
989108977 5:37889078-37889100 CTGCCTCTGGAGATGGAGGGAGG + Intergenic
989740233 5:44762375-44762397 CTGCATGTGCAGGTGGAATGTGG - Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
991638738 5:68732762-68732784 CAGCTTCTGAAGATGCACTGGGG + Intergenic
997626375 5:135333937-135333959 CAGCCTCGGCAGAGGGAATGAGG + Exonic
998390723 5:141785450-141785472 CAGCATCTGAATGGGGAGTGGGG + Intergenic
998562724 5:143186354-143186376 CCCCATGTGGAGATGGAGTGGGG - Intronic
998747988 5:145283511-145283533 CAGCAAATGCAGAGGGAGAGGGG - Intergenic
1000411417 5:160937729-160937751 CTGCAACTGCTGATGGAGGGAGG + Intergenic
1001286995 5:170431044-170431066 CAGCATCTGCAGATGGAGTGAGG - Intronic
1001626890 5:173143663-173143685 GAACAAATGCAGATGGAGTGGGG + Intergenic
1004914891 6:20322370-20322392 AAGCATCTGCAGTTGGATTATGG + Intergenic
1005702397 6:28415054-28415076 CAGCAACTGTAAAGGGAGTGGGG - Intergenic
1005741485 6:28794987-28795009 TGGCTTCTGCAGATGGAGAGAGG + Intergenic
1006255406 6:32828853-32828875 CAGCAGCGGCTGATGGACTGAGG - Intronic
1006744275 6:36330486-36330508 GAGCCTCTGCAGATGGAGCTGGG + Exonic
1007465249 6:42047298-42047320 TAGCCTGTGCAGATGGAGTATGG + Intronic
1009444315 6:63722502-63722524 CAGCATCTGAAGTTGCAATGAGG + Intronic
1011530232 6:88312898-88312920 CAGCAGCTGCACCTGGGGTGGGG + Intergenic
1015951160 6:138554003-138554025 CAGTATGTCCAGATGGAGGGAGG + Intronic
1017182339 6:151565147-151565169 CAGCAGCTGCAGGTGGGGTATGG + Intronic
1018641387 6:165907484-165907506 CAGAGTCTGCAGAGAGAGTGCGG - Intronic
1018857850 6:167688278-167688300 GATCATCTGTGGATGGAGTGTGG + Intergenic
1018956721 6:168415403-168415425 CAACATCTGCAGCTGGAGAGGGG + Intergenic
1019119068 6:169789199-169789221 CAGCAGCTGAAGATGATGTGGGG + Intergenic
1019374847 7:683895-683917 CATCAGCTGCAGAAGAAGTGGGG - Intronic
1019509212 7:1408944-1408966 CAGCCTCTGTAGATGGGGCGAGG + Intergenic
1019528149 7:1490169-1490191 CAGCACCTGCCGAAGGAGAGAGG + Intronic
1019735507 7:2648127-2648149 TAGGATCTGCAGATGAGGTGGGG - Intronic
1019802450 7:3098189-3098211 AAACATCTGCTGATTGAGTGAGG - Intergenic
1019999409 7:4746828-4746850 CAGCATTTGCAAATCCAGTGAGG + Intronic
1020211500 7:6161366-6161388 CTGCATCAGGAGATGGAGTGGGG + Exonic
1020397816 7:7736979-7737001 CAGCTTCTGGAGAAGCAGTGGGG - Intronic
1022390626 7:29940866-29940888 CACTCTCTGCAGAGGGAGTGAGG - Exonic
1023025309 7:36044465-36044487 CAGCAACTGCAAATGGCGTGAGG + Intergenic
1023728432 7:43167479-43167501 CAACAACTCCAGATGGAGGGAGG + Intronic
1023986780 7:45101609-45101631 CAGCATCTGGGGAAGGGGTGTGG + Exonic
1024094178 7:45971339-45971361 CTGCATCTGGAGCTGGCGTGGGG + Intergenic
1024176333 7:46844628-46844650 CAACATCTGCAGAGGGAGCATGG - Intergenic
1025712670 7:63926911-63926933 GAGCAGCGGGAGATGGAGTGAGG - Intergenic
1026274079 7:68861714-68861736 GAGCAACTGGAGAGGGAGTGGGG - Intergenic
1026431602 7:70352948-70352970 CAGCATCTGCAGAGGCTCTGAGG + Intronic
1029540124 7:101177926-101177948 CTGGAGCTGCAGATGGAGTCAGG - Intronic
1030511990 7:110493992-110494014 CAGCATGTGAAGATGTTGTGTGG + Intergenic
1030661406 7:112223253-112223275 CAGGATCTGCTGTTGGACTGAGG + Intronic
1031870133 7:127082079-127082101 GAGCATCTGCAGGAGCAGTGTGG - Intronic
1034417193 7:150971375-150971397 CAGCATCAGCTGTTGCAGTGGGG + Intronic
1034562383 7:151889459-151889481 CAGCCTCTGCAGAAGAAGTAGGG + Intergenic
1034967584 7:155400735-155400757 GGGCTTCTGCAGAGGGAGTGGGG - Intergenic
1035246864 7:157568237-157568259 CAGCATGCGCAGACGGCGTGGGG - Intronic
1035324800 7:158058156-158058178 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324805 7:158058193-158058215 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324810 7:158058230-158058252 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324822 7:158058304-158058326 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324832 7:158058378-158058400 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324837 7:158058415-158058437 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324841 7:158058452-158058474 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324844 7:158058489-158058511 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324847 7:158058526-158058548 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324850 7:158058563-158058585 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324855 7:158058600-158058622 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324865 7:158058674-158058696 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324875 7:158058748-158058770 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324879 7:158058785-158058807 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324882 7:158058822-158058844 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324894 7:158058933-158058955 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324906 7:158059044-158059066 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324916 7:158059118-158059140 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324921 7:158059155-158059177 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324932 7:158059266-158059288 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324934 7:158059303-158059325 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324937 7:158059340-158059362 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324940 7:158059377-158059399 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324945 7:158059414-158059436 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324949 7:158059451-158059473 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324951 7:158059488-158059510 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035324956 7:158059558-158059580 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324961 7:158059595-158059617 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324964 7:158059632-158059654 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324969 7:158059669-158059691 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324972 7:158059706-158059728 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324977 7:158059743-158059765 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324982 7:158059780-158059802 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324987 7:158059817-158059839 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324990 7:158059854-158059876 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035324995 7:158059891-158059913 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035324998 7:158059928-158059950 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325001 7:158059965-158059987 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325004 7:158060002-158060024 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325007 7:158060039-158060061 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325010 7:158060076-158060098 CACCGTGGGCAGATGGAGTGTGG - Intronic
1035325015 7:158060113-158060135 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325018 7:158060150-158060172 CACCATGTGCAGATGGAGTGTGG - Intronic
1035325021 7:158060187-158060209 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325024 7:158060224-158060246 CACCGTGTGCAGATGGAGTGTGG - Intronic
1035325026 7:158060261-158060283 CACTGTGTGCAGATGGAGTGTGG - Intronic
1035325029 7:158060298-158060320 CACCGTGTGCAGATGGAGCGTGG - Intronic
1037479031 8:19287110-19287132 AAGAATCTGCACAAGGAGTGGGG + Intergenic
1037542063 8:19881502-19881524 CAGCATCTGCCGTTGCTGTGGGG - Intergenic
1037896269 8:22658542-22658564 CTGCCTCTGCAGAGGGAGTGAGG - Intronic
1038659637 8:29486131-29486153 CAGGAGCTGGTGATGGAGTGAGG + Intergenic
1039398453 8:37247438-37247460 CAGCATTTCCAGGTGGTGTGGGG - Intergenic
1039849326 8:41348738-41348760 AAGCATCTGCAGTTGGAGTAAGG + Intergenic
1040661257 8:49578628-49578650 CAGCATTTTCAAATGGACTGGGG + Intergenic
1042898278 8:73694883-73694905 CAGCACCTGCACAGGGAGGGAGG + Intronic
1043674376 8:82931916-82931938 CATCATATGTAAATGGAGTGGGG + Intergenic
1044535996 8:93356990-93357012 AAGCATCCGCAGCTGGAGTATGG - Intergenic
1044961977 8:97540082-97540104 CAGCATCTGCAAATGTATGGAGG + Intergenic
1046981646 8:120342794-120342816 CAGCTTCTGAAGATGTAGTCTGG - Intronic
1047646210 8:126873280-126873302 CAACATATGCAGAAGCAGTGCGG + Intergenic
1048365433 8:133734104-133734126 TAGCATCTGCAGAGAAAGTGTGG - Intergenic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049383332 8:142328665-142328687 CACGATCTGGAGATGGTGTGTGG - Intronic
1051274938 9:15389670-15389692 CACCATCTGAAGTTGGATTGGGG + Intergenic
1051881199 9:21841259-21841281 CACCAGCTGCAGAAGGAGTAGGG - Intronic
1053065803 9:35068147-35068169 CAGTGACTGCAGATAGAGTGGGG - Intronic
1057222424 9:93264401-93264423 CAGCCTCCCCAGCTGGAGTGCGG + Intronic
1057723980 9:97555306-97555328 CGGCATCTCCACATGGACTGGGG + Intronic
1058328960 9:103734912-103734934 CAGCAACTGCAGAGGGATAGTGG - Intergenic
1059600744 9:115775554-115775576 CAGAAACTGAAGATTGAGTGTGG - Intergenic
1059646958 9:116277064-116277086 CAGCATCTGCTGGAGGAGAGGGG + Intronic
1059954597 9:119502386-119502408 TAGCATCTCCACATGGAGAGAGG - Intronic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186555185 X:10550533-10550555 GGGCATCTGCAGATGGCGGGAGG + Intronic
1188237504 X:27747897-27747919 CAGCATCTTCACCTGAAGTGAGG - Exonic
1189007651 X:37011204-37011226 CAGCATGTGAAGATGGGGTATGG + Exonic
1189823528 X:44893814-44893836 CAGCATCTTAGGAAGGAGTGGGG - Intronic
1192230908 X:69264354-69264376 CCGCATCTGCATATGGAGTCAGG - Intergenic
1192292805 X:69815418-69815440 CAGCTTCTGGAGTTGGGGTGGGG + Intronic
1193509762 X:82384461-82384483 CAGGATCTGCTGAGGGAGGGAGG + Intergenic
1194599196 X:95899601-95899623 CAGCATATGAAGTTGGAGGGGGG + Intergenic
1195322388 X:103730225-103730247 CAGTTTCTGCCCATGGAGTGGGG - Intergenic
1196753628 X:119139150-119139172 CTGCTTCTTCAGAGGGAGTGGGG + Intronic
1196871302 X:120115895-120115917 TGGCGTCTGCAGCTGGAGTGGGG + Exonic
1197286672 X:124603120-124603142 CAGAGTCTCCAGAGGGAGTGTGG + Intronic
1197831712 X:130649943-130649965 CAGCATCTTGAGCTGGAGTTTGG + Intronic
1199380367 X:147165270-147165292 CAGCATCTGCTGTGGGAGAGGGG + Intergenic
1200039383 X:153354806-153354828 TAGCATCTGAGGAGGGAGTGGGG - Intronic
1200397288 X:155998703-155998725 CAGCCTCTGCAGGTGGGGCGGGG + Intronic
1201058435 Y:10018831-10018853 CAGCATCTGCATATAGTGAGGGG + Intergenic
1201858896 Y:18573713-18573735 CAGCACCTGCAGAGGTACTGAGG - Intronic
1201874426 Y:18746668-18746690 CAGCACCTGCAGAGGTACTGAGG + Intronic