ID: 1001287950

View in Genome Browser
Species Human (GRCh38)
Location 5:170437464-170437486
Sequence GGGGGTGAGCAGAGATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 325}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001287950_1001287958 28 Left 1001287950 5:170437464-170437486 CCTTCAAATCTCTGCTCACCCCC 0: 1
1: 0
2: 1
3: 24
4: 325
Right 1001287958 5:170437515-170437537 ACATGAAGCAACCTTCCCAAGGG 0: 1
1: 0
2: 2
3: 13
4: 176
1001287950_1001287957 27 Left 1001287950 5:170437464-170437486 CCTTCAAATCTCTGCTCACCCCC 0: 1
1: 0
2: 1
3: 24
4: 325
Right 1001287957 5:170437514-170437536 GACATGAAGCAACCTTCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001287950 Original CRISPR GGGGGTGAGCAGAGATTTGA AGG (reversed) Intronic
900002191 1:20877-20899 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
900021913 1:191401-191423 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
900641783 1:3691065-3691087 TGGGGTGAGCAGAGGTAGGAAGG + Intronic
901703634 1:11058721-11058743 GGGGGTGTGCAGCCATTTCAGGG + Intronic
902974318 1:20078042-20078064 GGGGGCCAGCAGAGATGGGATGG + Intronic
903511065 1:23875177-23875199 ACGGGTGAGCAGAGCTTTGTAGG + Exonic
904917816 1:33983001-33983023 GGGTGTGAGCAGAGACCTGCAGG + Intronic
905923714 1:41735551-41735573 GGGAGTGAGCAGAGCCTGGATGG - Intronic
906343689 1:45002377-45002399 GGGGCTGAGCAGAGACGTAAGGG - Intergenic
906517161 1:46446471-46446493 GGGGGAAGGGAGAGATTTGATGG - Intergenic
906551706 1:46671122-46671144 GGGGCTGAGCTGAGTCTTGAAGG + Intronic
906946210 1:50296605-50296627 GGTGGTGACAAGAGATTTAAGGG - Intergenic
907578927 1:55554566-55554588 GGGGCTGGGCAGAAATTTTAAGG + Intergenic
908727795 1:67195521-67195543 GGGGCAGAGCTGGGATTTGAAGG + Intronic
912840794 1:113037404-113037426 GGGATTGAGATGAGATTTGAAGG - Intergenic
913058334 1:115182548-115182570 GGGGGTGACTAGAGGATTGATGG + Intergenic
914291703 1:146280067-146280089 GTGGGTGTGCAGAGATGAGATGG - Intergenic
914552747 1:148730850-148730872 GTGGGTGTGCAGAGATGAGATGG - Intergenic
915285357 1:154848744-154848766 GGGGTTGAGCTGGGTTTTGAAGG - Intronic
915441396 1:155947637-155947659 GGGGGAGAGGGGAGATTTAAAGG - Exonic
916013682 1:160729208-160729230 TGGGGTGGGCAGAGTTTGGAGGG + Intergenic
917539578 1:175899763-175899785 AAGTGTGAGCAGAGACTTGAAGG + Intergenic
918087737 1:181259755-181259777 GGGGTCTAGCAGGGATTTGAAGG + Intergenic
918265263 1:182836491-182836513 GGGAGTGATCAGAAATATGAGGG + Intergenic
920960911 1:210663316-210663338 GGGGATGAAATGAGATTTGAAGG + Intronic
922548812 1:226478736-226478758 TGGGATTAGCAGTGATTTGATGG + Intergenic
1062853759 10:768386-768408 GGGGGTGAAGAGAAATTTAATGG + Intergenic
1062971386 10:1651826-1651848 GGGGGTGAGAAGAGCCCTGAGGG - Intronic
1064156451 10:12906926-12906948 AGGTGTGAGCAGAGATTTAGTGG - Intronic
1064369692 10:14740467-14740489 GGTGGAGAACAGAGATTTTAGGG + Intronic
1065078235 10:22102295-22102317 GGGAGGGAGAAGAGATTTCATGG - Intergenic
1065596462 10:27317959-27317981 GGTGGTGAGCAGAGAAATGGGGG - Intergenic
1065711983 10:28527164-28527186 GCGTTTGAGCAAAGATTTGAAGG - Intergenic
1065895470 10:30159407-30159429 GGGTTTGTTCAGAGATTTGAAGG - Intergenic
1066303359 10:34116522-34116544 GGCTGTGTGCAGAGATCTGAGGG - Intronic
1068862388 10:61860570-61860592 GGGGGTAGGCAAAGAGTTGAGGG - Intergenic
1070729687 10:78817860-78817882 GTGGGGGAGCAGAGGATTGAGGG + Intergenic
1071825591 10:89322548-89322570 GGGGGTGGGCAGGGGTTTCAGGG - Intronic
1072089512 10:92113669-92113691 GAGGGTGGGCAGTGATGTGAAGG - Intronic
1072477720 10:95779057-95779079 GGTGGTGAGGAGAGATTTTAAGG - Intronic
1073711259 10:106045338-106045360 GGGGGTGGGCAGAGTGGTGAGGG + Intergenic
1074702429 10:116104312-116104334 GAGGCTGAGCAGGGATTTGAGGG - Intronic
1074787254 10:116851844-116851866 TGTGGTGAGCAGATATTTCAGGG - Intronic
1075574589 10:123569605-123569627 GGGGCTGAGCAGGGCTCTGAGGG + Intergenic
1076411107 10:130251624-130251646 GGGGGTGAGGAGAGAGAGGAAGG - Intergenic
1076550384 10:131274067-131274089 GGCGCTGAGCAGACATTCGACGG - Intronic
1077305253 11:1866026-1866048 GTGGGAGAGCAGAGTTTGGAGGG + Intronic
1080639781 11:34152033-34152055 AGGGGTGAGTAGAGCTTGGAGGG + Exonic
1080857788 11:36127269-36127291 GGGGTTAAACAGAGGTTTGAAGG + Intronic
1082879713 11:58025730-58025752 GTGGTGGAGCTGAGATTTGAAGG + Intronic
1083151223 11:60793058-60793080 GGGTGTGAGCTGTGATTTGCAGG - Intronic
1083182720 11:60997960-60997982 GGGGAGGAGCATACATTTGAAGG - Intronic
1083272366 11:61578918-61578940 GGGGGTGAGGGAAGAGTTGAGGG + Intronic
1084045022 11:66563417-66563439 GGGGGTGAGGAGAGATGGCAGGG - Intergenic
1084671045 11:70606898-70606920 AGGGCTGTGCAGAGATTTAAGGG - Intronic
1085259709 11:75197424-75197446 TGCGCTCAGCAGAGATTTGAAGG + Intronic
1085565020 11:77505932-77505954 GTGCCTGAGCTGAGATTTGAGGG + Intergenic
1085878817 11:80441229-80441251 TGGGGTGGGCAGAGTTATGAAGG - Intergenic
1089920208 11:122202681-122202703 GGTGGTCAGCAGAGATTAAAGGG - Intergenic
1090566066 11:127993408-127993430 GAGGGTGGGCAGAGATTTCAAGG + Intergenic
1091133606 11:133167672-133167694 TGGGGTGATCAGAGATCTCAAGG + Intronic
1091194265 11:133718277-133718299 GGGGGTGGGCAGGGATCTGAAGG - Intergenic
1091375606 12:22937-22959 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1092118933 12:6030235-6030257 GGAGGTGTGCAGACATGTGAGGG - Intronic
1093966801 12:25336261-25336283 GGGAGGGAGAAGAGTTTTGAGGG + Intergenic
1094636336 12:32230130-32230152 GGGGAGGGGCTGAGATTTGAAGG + Intronic
1095702149 12:45201430-45201452 GGGGGTGAGAACAAACTTGAGGG + Intergenic
1096705722 12:53420773-53420795 GGGTGTGAGGGGAGATTTGAAGG - Intergenic
1097066548 12:56324751-56324773 GGGGGTGAGGAGAAATATGGAGG + Intronic
1098848150 12:75563252-75563274 TGGGGTCAGCAGAGGTGTGAGGG + Intergenic
1099698396 12:86052671-86052693 TCAGGTGAGCATAGATTTGAGGG - Intronic
1100563126 12:95769024-95769046 GGGGGTTTGCAGAGATGTCAGGG + Intronic
1103092969 12:118110635-118110657 GGAGGAGAGCAAAGAATTGATGG + Intronic
1104700279 12:130897902-130897924 GTGTGTGTGCACAGATTTGATGG + Intergenic
1104814567 12:131638306-131638328 GGTGGTGAGAAGAGAGATGAGGG + Intergenic
1104814576 12:131638348-131638370 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814580 12:131638369-131638391 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814584 12:131638390-131638412 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814609 12:131638516-131638538 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814613 12:131638537-131638559 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814617 12:131638558-131638580 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814621 12:131638579-131638601 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814655 12:131638747-131638769 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814659 12:131638768-131638790 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104814663 12:131638789-131638811 GGTGGTGAGGAGAGAGATGAGGG + Intergenic
1104986765 12:132601570-132601592 GTGGGTGAGCTGAGGTTTGCAGG - Intergenic
1105043206 12:132978094-132978116 GGGTGGGAGCAGAGCTTTAAAGG + Intergenic
1105074210 12:133261229-133261251 GTGGGTCAGCTGAGGTTTGAGGG - Intergenic
1105279356 13:18954276-18954298 GGCGCTGAGCAGAGATTAGGGGG - Intergenic
1105579266 13:21678042-21678064 GATGGTGAGCAAAAATTTGAGGG + Intronic
1106916823 13:34524692-34524714 AGGGGTGTGCAGAGAAGTGATGG - Intergenic
1107810115 13:44192369-44192391 GGGAGTGAGCTGATATTTGAAGG + Intergenic
1107969650 13:45629003-45629025 GGGTGTGAGCATGGATCTGAGGG + Intergenic
1109649144 13:65303038-65303060 GTAGGAGAGCTGAGATTTGAAGG - Intergenic
1112130251 13:96515645-96515667 TGGTGTGAGGAGAGATGTGATGG + Intronic
1112341651 13:98557489-98557511 GGGGAGGAGGAGGGATTTGAGGG - Intronic
1112561034 13:100514276-100514298 GGGTGGGGGCAGAGCTTTGATGG - Intronic
1112796105 13:103058206-103058228 GGGGGTAAGCAGAGAGTTTGAGG + Intronic
1113577696 13:111405594-111405616 GGGTGTGAGCAGAGGTTGGGGGG + Intergenic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1117307343 14:54489350-54489372 GGAGGTGTGCCTAGATTTGAGGG - Intergenic
1117330547 14:54707702-54707724 GGGTGTGAGCAGAGAGTTGAAGG + Intronic
1120024872 14:79571470-79571492 GGGGGTGATGAGAGAAATGAAGG + Intronic
1120590165 14:86364921-86364943 AGGGGTGAGCAGAGTGGTGAGGG - Intergenic
1120739269 14:88089744-88089766 GAGGAGGAGGAGAGATTTGAGGG + Intergenic
1121636058 14:95454653-95454675 GCGTATGAGCAGAGATTAGAAGG + Intronic
1122246764 14:100408527-100408549 TGGGGGGAGCAGGGATTGGAGGG - Intronic
1124006154 15:25797131-25797153 GGGGGTTACCAGAGGTTGGAAGG - Intronic
1128266077 15:66267811-66267833 AAGGGTGGGCAGATATTTGAAGG - Intergenic
1128943256 15:71805613-71805635 GGGGGTGGGCAGGAATTTGTGGG + Intronic
1131263416 15:90902065-90902087 GGGGGTGAACAGAGTTTGAAGGG - Intergenic
1131352193 15:91711356-91711378 GTGGGTCACAAGAGATTTGAAGG - Intergenic
1132121698 15:99181612-99181634 GGGTGTTAGCTCAGATTTGAAGG - Intronic
1132298663 15:100763248-100763270 GAGGATGTGCAGAGGTTTGAAGG - Intergenic
1132451319 15:101970062-101970084 GGGAGTGTGCAGAGACTGGAGGG + Intergenic
1134048845 16:11122858-11122880 GTCATTGAGCAGAGATTTGAAGG - Intronic
1134317294 16:13130726-13130748 GGGGTTGAACAGAGATTGCATGG - Intronic
1135927485 16:26708351-26708373 GGGAGAGGGCAGGGATTTGAGGG - Intergenic
1136411986 16:30082986-30083008 GGGGGTGGTCAGAGACTTGATGG + Intronic
1137606579 16:49790705-49790727 GAGGCAGAGCTGAGATTTGAAGG - Intronic
1138075674 16:54040026-54040048 TGGATTTAGCAGAGATTTGATGG + Intronic
1138281002 16:55772322-55772344 GGTGGGGAGCAGAGATATCATGG - Intergenic
1138439204 16:57024200-57024222 GGGGGTGAGCAGGGATGGGGAGG + Intronic
1138861015 16:60757482-60757504 GGGGGTAAGCAGATTTGTGAAGG + Intergenic
1140907006 16:79417590-79417612 TGGGGCGAGCAGAGGTTTGGAGG + Intergenic
1141961804 16:87413842-87413864 GGGGGTGAGCAGAAATGAGATGG - Intronic
1143900927 17:10174284-10174306 GGGACTGAGTAGAGATTAGAGGG + Intronic
1144550062 17:16232712-16232734 GGGTATGTGTAGAGATTTGAGGG + Intronic
1144640728 17:16935194-16935216 GACGGGGAGCAGAGAATTGAGGG + Intronic
1145992233 17:29086110-29086132 TGGGGAGAGCAGAGATTTAAAGG - Intronic
1146020079 17:29270222-29270244 GTGTCTGCGCAGAGATTTGATGG - Intronic
1147773125 17:42881335-42881357 TGGGGTGAGCAGAGCCTTGGAGG + Intergenic
1148469404 17:47884098-47884120 GGGGGGCAGCAGAGATTTATGGG + Intergenic
1151183387 17:72345944-72345966 TGGGGGGAGCAGAGGTTTCAGGG - Intergenic
1151518147 17:74610388-74610410 GTGGGTTAGCAGAGTGTTGAGGG - Exonic
1152646571 17:81471675-81471697 GGCGGTGAGCAGAGCAGTGAGGG + Intergenic
1152939533 17:83160969-83160991 GGGGCTGAGCAGAGACAGGAGGG + Intergenic
1154170644 18:12047956-12047978 GGGGGGGTGCAGAGATGTGTAGG - Intergenic
1155080329 18:22403502-22403524 GAGGCTGAGTAGAGATTAGAAGG - Intergenic
1155601869 18:27558388-27558410 GGTAGTGAGCTGAAATTTGAGGG - Intergenic
1157589161 18:48825742-48825764 GATGGGGAGCAGAGATTTGCTGG + Intronic
1158327390 18:56326208-56326230 GGGGATGAGAAGATAGTTGAAGG + Intergenic
1160633944 19:62485-62507 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1160648432 19:206556-206578 AGGGGTGTGCAGAGCTTTCAGGG + Intergenic
1160675679 19:390060-390082 GGGAGCGAGCAGAGACGTGAGGG - Intergenic
1161423149 19:4186742-4186764 CGGGGAGAGCGGAGATTGGACGG - Intronic
1162361667 19:10224051-10224073 GGGGTTGAGCAGGGAATTCAGGG + Exonic
1162635404 19:11963984-11964006 GGAGGAGAGCAGGGGTTTGAGGG + Intronic
1163018787 19:14472037-14472059 GTGGGTGAGCCGAGATGGGAGGG + Intergenic
1166593628 19:44025465-44025487 GGCGGAGAGCAGAGGTTTGGAGG + Exonic
1166605805 19:44141720-44141742 GTGGGAGAGCAGAGGTTTGGTGG + Exonic
1167578185 19:50327808-50327830 AGTAGTGAGAAGAGATTTGATGG + Intronic
1168454784 19:56498056-56498078 GTGGATGAGCATTGATTTGAAGG + Intergenic
926660019 2:15454733-15454755 GAGGGTGATCAGAAATTTGATGG - Intronic
926781705 2:16478547-16478569 GGGAGTGTGGAGAGATGTGAAGG - Intergenic
927709193 2:25314560-25314582 GGGGGTGAGGACAGATTAGAAGG - Intronic
927964481 2:27260705-27260727 GTGGGTGAACTGAGTTTTGAGGG + Intronic
928898269 2:36290360-36290382 TGGGGATAGCAGAGATTTGGAGG - Intergenic
930522599 2:52486330-52486352 GGAGGGGAGTAGAGAGTTGAGGG - Intergenic
930621566 2:53649521-53649543 CTGGTTGAGCAGAGAATTGAGGG - Intronic
930871633 2:56176896-56176918 GGGGGTGAGCAGCAAAATGAGGG - Intergenic
931376299 2:61711522-61711544 TGGGTTGAGAAGAGATTGGATGG - Intergenic
932049599 2:68385529-68385551 GTGGGTGGGGAGAGCTTTGATGG - Intronic
932232561 2:70094762-70094784 GGGGGTGAGGTGGGACTTGAAGG - Intergenic
932306528 2:70707599-70707621 GGGGCAGAGCACCGATTTGAAGG - Intronic
934041133 2:88128590-88128612 GGGGGTGAGAAGAGATCATAAGG - Intergenic
935341059 2:102060321-102060343 GGTGGGGAGCAGAGGTCTGAGGG + Intergenic
936567534 2:113592543-113592565 GGGAGTGTGCAGAGACTGGAGGG + Intergenic
938592142 2:132749754-132749776 GTGGCTAAGCAGACATTTGAAGG - Intronic
938762709 2:134440080-134440102 GGGGGTGAGGAGAGGGTTGGAGG - Intronic
941086188 2:161121146-161121168 GAGGGGGAGCATGGATTTGAAGG - Intergenic
941988798 2:171534690-171534712 GGTGGCTCGCAGAGATTTGAGGG - Intronic
942307372 2:174621983-174622005 TGGGGTGGGCAGTGATTTGGAGG - Intronic
942844873 2:180412017-180412039 GAAGGTCAGCAGAGATTTCAAGG + Intergenic
943390271 2:187258192-187258214 GGTGGTGCGAAGAGATTAGAAGG + Intergenic
944272719 2:197802050-197802072 GGGGGTGAGCAGGGGTAGGAAGG - Intergenic
945440713 2:209875747-209875769 TGGGGAGAGCAGACATTCGAGGG - Intronic
947216964 2:227758517-227758539 GGCCGAGAGCAGAGTTTTGAGGG + Intergenic
947796695 2:232897539-232897561 GTGGGTGGGCAGAGCTTTGCAGG - Intronic
948619373 2:239224505-239224527 GAAGGTGAGCAGACATTTGCAGG - Intronic
1172939282 20:38643660-38643682 AGGGATGGGCTGAGATTTGAGGG + Intronic
1173839765 20:46149825-46149847 GTGTGTGAGCAGAGGTTTGGGGG - Intergenic
1174945419 20:54980096-54980118 GGGGGTGAGCAGTGATTCCCAGG - Intergenic
1175176885 20:57117777-57117799 GGGGGTGGGCGGTGCTTTGATGG - Intergenic
1175176895 20:57117803-57117825 GGGGGTGGGCGGTGCTTTGATGG - Intergenic
1175176918 20:57117875-57117897 GGGGGTGGGCAGCGCTTTGGTGG - Intergenic
1175176953 20:57117975-57117997 GGGGGTGGGCGGTGCTTTGATGG - Intergenic
1175176996 20:57118115-57118137 GGGGGTGGGCAGTGCTTTGGTGG - Intergenic
1175177011 20:57118161-57118183 TGGGGTGGGCGGTGATTTGATGG - Intergenic
1175353923 20:58346933-58346955 GGCTGAGAGCAGAGATATGAAGG - Intronic
1175519020 20:59587875-59587897 GGGAGGGAGGAGAGATTTGAAGG - Intronic
1177790696 21:25719137-25719159 GGGGGGAAGAAGAGATTAGAGGG - Intronic
1179418153 21:41214931-41214953 GGGGGAGGGCAGAGATCAGAAGG + Intronic
1179678478 21:43001049-43001071 GAGGGAAAGCAGAGATTTGGAGG + Intronic
1181164475 22:20976024-20976046 GAGGGTAAGGAGAGGTTTGAGGG + Intronic
1181576205 22:23796829-23796851 GGGGGCTGGCAGAGGTTTGAGGG + Intronic
1181725755 22:24809806-24809828 GGCTGTGAACAGAGATGTGAAGG + Intronic
1182155302 22:28066494-28066516 GGTGGTGACCAGAGGTTTGGGGG - Intronic
1182576408 22:31276355-31276377 GGGGGTGAGGAGAATGTTGAGGG - Intronic
1183292200 22:37009793-37009815 GAAGGTGAGCAGAGTCTTGAAGG - Intergenic
1183566864 22:38621832-38621854 GCGTTTGAGCTGAGATTTGAAGG - Intronic
1183816193 22:40302758-40302780 GGGGGTGAGCAAAGACTTCAAGG + Intronic
1184920211 22:47600635-47600657 GGGGGTGAGCAGAGGCTGGGAGG - Intergenic
1184929982 22:47673808-47673830 GGATGTGAGCAGAGCTTGGAAGG + Intergenic
1203294924 22_KI270736v1_random:32736-32758 GGGGCTGAAGAGAGATCTGAGGG + Intergenic
952367427 3:32687145-32687167 GGAGATGAGCAGAGATTCAAAGG - Intronic
953041603 3:39260053-39260075 GGGAGAGAGCAGAGAGCTGATGG - Intergenic
953666621 3:44930306-44930328 GGGGGTGAGCAGGGAGGGGAAGG + Intronic
953832510 3:46312516-46312538 AGGAGTGAAGAGAGATTTGAAGG + Intergenic
953982925 3:47421733-47421755 GGGGGTGAGCAGAGAACAGATGG - Intronic
954225209 3:49176832-49176854 GGGGGTGAGCAGAGACCCTAAGG - Intergenic
954659057 3:52216828-52216850 GGTGGTGACCAGAGCTCTGAAGG - Intergenic
957355673 3:79082713-79082735 GGTGTTGGGGAGAGATTTGAGGG - Intronic
958011846 3:87889123-87889145 TGGGGTGTGCAGAGATTACATGG - Intergenic
958503197 3:94941051-94941073 GGGGGTGAGGAGAGAGGGGAGGG - Intergenic
959371886 3:105537336-105537358 GGGGGTGAACAGAGAATGGTGGG - Intronic
962476384 3:135758848-135758870 AGGGATGAGCAGGGAGTTGAGGG - Intergenic
962665426 3:137649479-137649501 GGGAGTGGGCAGAGAGTTGCAGG + Intergenic
964688329 3:159422593-159422615 GAGGGTGGGCAGTGATTGGAAGG - Intronic
966317811 3:178668241-178668263 GGGGGTGAGCAGAGCCTTCCAGG + Intronic
966896268 3:184447591-184447613 GGGTGTGAGCATAGATTGGGTGG - Intronic
967335455 3:188339083-188339105 GAGGGTGAGCATATTTTTGAGGG + Intronic
967413418 3:189190489-189190511 GAGGCTGCCCAGAGATTTGAGGG - Intronic
967990725 3:195128358-195128380 GGGGCTGAGATGAGATTTAAGGG - Intronic
968423888 4:508250-508272 CAGGGTGAGCAGAGACTTGAAGG + Intronic
969203480 4:5624054-5624076 GGGGGTCAGCAAAGCTTTCAAGG + Intronic
970157978 4:13160505-13160527 GGGATTGAGCAGAGTCTTGAAGG + Intergenic
970978688 4:22072007-22072029 TGGGGTAAGGAGAGAGTTGATGG - Intergenic
973206768 4:47569792-47569814 GACTGTGAGCAGAGATGTGAAGG + Intronic
975059398 4:69978655-69978677 GGGGAAGAGCAGAGACTTGGGGG + Intergenic
975565013 4:75745033-75745055 GGCAGTGGGCAAAGATTTGAAGG - Intronic
977895476 4:102360348-102360370 GGATATGAGCAGAGCTTTGAGGG - Intronic
978994383 4:115131508-115131530 GGGGCTGAGCATGGATCTGAGGG + Intergenic
983365284 4:166778848-166778870 GGGGGTAGGCAGAGTTTTCATGG + Intronic
983798766 4:171901171-171901193 GAGGGTGGGCAGGGATTTGCTGG - Intronic
985800028 5:1999547-1999569 GGTGGTGAGCTGAGCTCTGAAGG - Intergenic
988244119 5:28655925-28655947 GGGGGTTACCAGGGATTAGAGGG - Intergenic
989759544 5:44996553-44996575 GAAGGTGAGGTGAGATTTGAAGG - Intergenic
990621292 5:57562168-57562190 GTAGGTCAGCAGATATTTGAGGG - Intergenic
992557282 5:77916105-77916127 GGAGGTGAGCAGAGATATAATGG - Intergenic
993144139 5:84072828-84072850 GGGGGTGAGAAAAGAATGGAGGG + Intronic
995889525 5:116935130-116935152 GTGGGTGAGAAGAAATTTGAGGG + Intergenic
997733040 5:136194406-136194428 CGGGCTGAGCAGGGATTTGTGGG - Intergenic
999340074 5:150762732-150762754 AGGTTTGAGCAAAGATTTGAAGG + Intergenic
999347876 5:150840421-150840443 GGGGCTGAGCAGAGAAGGGAAGG - Intergenic
999909934 5:156186766-156186788 AGGAGTGAACAGAGATTTCAGGG - Intronic
1000652742 5:163837352-163837374 GGTGGTGAGCACACCTTTGATGG + Intergenic
1001007304 5:168064397-168064419 GGGGGCAAGCAGAGCTTTGGGGG - Intronic
1001242365 5:170080428-170080450 GGGTGTGGGGAGAGATTAGAGGG - Intronic
1001287950 5:170437464-170437486 GGGGGTGAGCAGAGATTTGAAGG - Intronic
1001374958 5:171247626-171247648 TGGGGTGGGCAGAGAATGGATGG - Intronic
1002319771 5:178368056-178368078 GTGTGTGAGCAGAGCCTTGAAGG + Intronic
1002624800 5:180518505-180518527 GGGGGGGAGGAGGGAGTTGATGG + Intronic
1002971679 6:2029365-2029387 GGTGGTGAGAAGGAATTTGAGGG - Intronic
1003435405 6:6083442-6083464 GGGAGTGAGCAGGGAGTTCATGG + Intergenic
1003490172 6:6614418-6614440 GGCGGAGAGCAATGATTTGAAGG - Intronic
1004332552 6:14735166-14735188 GGGGGTGACCAAGGATTTGGGGG - Intergenic
1004455766 6:15790197-15790219 GAGGGTTGGGAGAGATTTGAAGG - Intergenic
1004569701 6:16833325-16833347 TGGGGTGAGGAGAGGTTGGAGGG - Intergenic
1005987345 6:30883339-30883361 GGGGGTGTGGAGAGAGGTGAGGG + Intronic
1006641686 6:35492591-35492613 GGGGGTGGGGAGAGAGTGGAGGG - Intronic
1006740051 6:36301550-36301572 GGCAGTGAGTAGAGATCTGAAGG - Intronic
1006776818 6:36599826-36599848 GGTGGTGAGAAGAGACATGATGG - Intronic
1007021251 6:38523628-38523650 GGGATTAAGCAGATATTTGAAGG - Intronic
1007082443 6:39117350-39117372 GTGGATAAGAAGAGATTTGAGGG + Intergenic
1007312662 6:40958981-40959003 GGGGTTAAGCAGCTATTTGAAGG - Intergenic
1008159489 6:48059905-48059927 GACTGTGAGCAGAGATCTGACGG - Intronic
1008238440 6:49077692-49077714 GGGTGTGAGGAGAGCTTTGAGGG + Intergenic
1008316391 6:50047185-50047207 GGCAGTGAGCTGAGACTTGATGG + Intronic
1008421808 6:51309616-51309638 GGAAATGAGCAGAGAATTGAAGG - Intergenic
1009417097 6:63427813-63427835 AGATGTGAGCAGAGTTTTGAGGG - Intergenic
1011638781 6:89400477-89400499 GAGGGTGAGAGGAGATTAGAGGG - Intronic
1012835238 6:104256242-104256264 GGGGCTGAGTTGAGGTTTGAGGG - Intergenic
1015189835 6:130460602-130460624 GTGGGTGAGAAGAGAGTGGATGG - Intergenic
1015434105 6:133166029-133166051 AAAAGTGAGCAGAGATTTGAAGG + Intergenic
1015997299 6:139007879-139007901 GTGGGTGAGCACAGATTAAAGGG - Intergenic
1016454543 6:144216788-144216810 GGAAGTGAGCAGAGCTCTGAGGG - Intergenic
1016683495 6:146856464-146856486 GGGGCTGAGCAGAGATAGAAGGG - Intergenic
1017441904 6:154472435-154472457 ATGTGTGAGCAGAGATCTGAGGG - Intronic
1017558289 6:155598218-155598240 GGAGCTCAGCTGAGATTTGAAGG - Intergenic
1018182073 6:161232764-161232786 AGGGGTGAGCAGGGATCTGGAGG - Intronic
1018906349 6:168078569-168078591 GGGGGTGAGCAGGGCTGTGAGGG - Intronic
1018906359 6:168078605-168078627 GGGGGTGAGCAGGGCCGTGAGGG - Intronic
1018906381 6:168078669-168078691 GGGGGTGAGCAGAGCCATGGGGG - Intronic
1019036749 6:169067295-169067317 GGGGGGGTGCATATATTTGATGG - Intergenic
1019047879 6:169162115-169162137 GAGGGTGAGCAGAGCTGTGCTGG - Intergenic
1019118977 6:169788249-169788271 TGGAATGAGCAGAGATTCGAGGG - Intergenic
1019649490 7:2148995-2149017 ATGGGGGAGCAGGGATTTGAGGG - Intronic
1020144862 7:5634579-5634601 GGGGAGGAGCAGAGACTTCACGG + Intronic
1020416931 7:7957158-7957180 GGGGGTGAGAAGAAGTTGGAAGG + Intronic
1021153943 7:17186417-17186439 AGGGCTGAGCAGACATGTGAGGG - Intergenic
1022651268 7:32277804-32277826 GTGGGTAAGAAGAGACTTGATGG + Intronic
1023878806 7:44307179-44307201 GGGTGTGAGCAGAGAGAGGAGGG + Intronic
1024502792 7:50130736-50130758 AGGGGTGTGCAGAAATTTGGAGG + Intronic
1024747524 7:52425432-52425454 TGGGATGAGGAGACATTTGATGG - Intergenic
1025807075 7:64844267-64844289 AGGGGTGCACAGAGATTTAAAGG + Intergenic
1025821072 7:64964494-64964516 TGGGGTGCACAGAGATTTAAAGG - Intergenic
1026084152 7:67249036-67249058 GCGGGGGAGCAGAGTTTTTAAGG + Intergenic
1027162184 7:75810987-75811009 TGGGGTGAGCCCAGATTTGAAGG + Intergenic
1027362767 7:77426682-77426704 GGGGGTGGACACAGATTAGATGG - Intergenic
1029745891 7:102515752-102515774 GGGCGAAAGCAGAGATGTGAAGG + Intronic
1029763829 7:102614731-102614753 GGGCGAAAGCAGAGATGTGAAGG + Intronic
1030220336 7:107091970-107091992 GCATTTGAGCAGAGATTTGAGGG + Intronic
1032152608 7:129442884-129442906 GGTAGGGAGCAGAGATTTAAAGG + Intronic
1032203179 7:129837764-129837786 GGGGGTGAGCTCAGGTCTGATGG + Intronic
1032910882 7:136428287-136428309 GGGGATGCACAGAGCTTTGAAGG - Intergenic
1033306636 7:140230480-140230502 GGGAGTGCGCAGAGATCTGGGGG - Intergenic
1034224640 7:149473280-149473302 GTGGGTGAACAGAGATTTCCAGG - Exonic
1036570397 8:9975341-9975363 GGGGGCAGGCAGAGAGTTGAGGG - Intergenic
1036747446 8:11419990-11420012 GGGGATGAGGAGTGATCTGATGG - Intronic
1039890303 8:41681466-41681488 GGTGGTGAGCAGAGCTATGAAGG + Intronic
1040021099 8:42742063-42742085 GTGTGTGAGCAGAAATCTGAAGG - Intergenic
1041483964 8:58353614-58353636 GGACCTGAGCAGAGCTTTGAAGG + Intergenic
1043173253 8:76992115-76992137 AGGAGTGGGCAGAGATATGATGG + Intronic
1043665685 8:82809669-82809691 GGGGGTGGAAAGTGATTTGAAGG - Intergenic
1045085364 8:98677313-98677335 GGGGGTGCGGTGAGATTTGAAGG - Intronic
1046504725 8:115122835-115122857 GGGAGTGAGCTGAGATATGAAGG + Intergenic
1046726985 8:117686611-117686633 GGGGCTGGGCAGAGCTTTAAAGG - Intergenic
1047057368 8:121180969-121180991 GGAGGAGATCAAAGATTTGAAGG + Intergenic
1048604503 8:135953617-135953639 GAAGGAGAGCAGAGATTTAAGGG + Intergenic
1049367264 8:142246440-142246462 GGGGGTGGGCAGAGGTGTGGAGG - Intronic
1049569611 8:143362982-143363004 GGAGGGGAGCAGAGGTTTGGTGG - Intergenic
1049884999 9:20990-21012 GGGAGTGTGCAGAGACTGGAGGG - Intergenic
1049925260 9:401206-401228 GGGGGGGTTGAGAGATTTGAGGG + Intronic
1050120174 9:2299784-2299806 AGGACAGAGCAGAGATTTGAAGG - Intergenic
1052046439 9:23799490-23799512 GGGGAAAAGCAGAGTTTTGAGGG + Intronic
1053338002 9:37295144-37295166 GGAGGTGAGTAGGGACTTGATGG + Intronic
1056552069 9:87660201-87660223 GAGGGTGAGCAGAGCTTGGTGGG + Intronic
1057519290 9:95748478-95748500 GGAGGTGAGCAGCGATGGGAAGG - Intergenic
1057723014 9:97547907-97547929 AGGGGTGAGTAGAGAGTTGTTGG + Intronic
1059438904 9:114291792-114291814 GAGTGTGAGCTGAGGTTTGAAGG + Intronic
1060472682 9:123961605-123961627 GTGGGTGACCAGGGATTTGGGGG + Intergenic
1061274990 9:129564858-129564880 GGGGGTGAGCAGAGGAGTGCAGG - Intergenic
1061417192 9:130453490-130453512 GGGTGAGAGCACAGCTTTGAGGG + Intronic
1061718710 9:132538015-132538037 GGGTGTGTGCAGAGGTTTGGTGG - Intronic
1062040507 9:134402265-134402287 GGGTGTAAGCAGAGACTTCAGGG - Intronic
1062176614 9:135166762-135166784 GGGTGTGAGCTGAGATTAAAGGG + Intergenic
1062403857 9:136384285-136384307 TGGGGGGAGCAGATATGTGAGGG - Intronic
1186796963 X:13056407-13056429 GGTGGTAAGCAGTGGTTTGATGG - Intergenic
1188024996 X:25199036-25199058 TGGGCTGAGTAGAGATTTGTGGG - Intergenic
1189755816 X:44270373-44270395 GGGGAGAAGCAGGGATTTGAGGG - Intronic
1190284474 X:48953112-48953134 GGAGGTGATGAGAGAATTGAGGG + Intronic
1192362066 X:70446432-70446454 GGGGGCGGGGGGAGATTTGAAGG + Intronic
1195090632 X:101455090-101455112 GTGGGAAAGAAGAGATTTGAAGG + Intronic
1196068204 X:111489203-111489225 GAGGTTGAGCAGAGATATGGAGG + Intergenic
1197634794 X:128902777-128902799 GGAGGTGGGCAGAGAGTGGAGGG + Intergenic
1198281545 X:135147847-135147869 GGGGGTGAGCACAGAATCGTTGG - Intergenic
1198289414 X:135224675-135224697 GGGGGTGAGCACAGAATCGTTGG + Intergenic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1200076304 X:153553005-153553027 GGGGGTGGGCAGAGATGAGGTGG - Intronic