ID: 1001288129

View in Genome Browser
Species Human (GRCh38)
Location 5:170438349-170438371
Sequence TGCCCTGCTGTCCCCACACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 217}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001288129_1001288134 -3 Left 1001288129 5:170438349-170438371 CCTCGTGTGGGGACAGCAGGGCA 0: 1
1: 0
2: 2
3: 36
4: 217
Right 1001288134 5:170438369-170438391 GCACACTGGAGAGGTGAGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 503
1001288129_1001288135 11 Left 1001288129 5:170438349-170438371 CCTCGTGTGGGGACAGCAGGGCA 0: 1
1: 0
2: 2
3: 36
4: 217
Right 1001288135 5:170438383-170438405 TGAGGAGGGTCTCCTGTCCTAGG 0: 1
1: 0
2: 3
3: 18
4: 229
1001288129_1001288138 23 Left 1001288129 5:170438349-170438371 CCTCGTGTGGGGACAGCAGGGCA 0: 1
1: 0
2: 2
3: 36
4: 217
Right 1001288138 5:170438395-170438417 CCTGTCCTAGGCTGAGGAGCTGG 0: 1
1: 0
2: 1
3: 35
4: 325
1001288129_1001288136 17 Left 1001288129 5:170438349-170438371 CCTCGTGTGGGGACAGCAGGGCA 0: 1
1: 0
2: 2
3: 36
4: 217
Right 1001288136 5:170438389-170438411 GGGTCTCCTGTCCTAGGCTGAGG 0: 1
1: 0
2: 0
3: 19
4: 211
1001288129_1001288132 -7 Left 1001288129 5:170438349-170438371 CCTCGTGTGGGGACAGCAGGGCA 0: 1
1: 0
2: 2
3: 36
4: 217
Right 1001288132 5:170438365-170438387 CAGGGCACACTGGAGAGGTGAGG 0: 1
1: 0
2: 3
3: 51
4: 433
1001288129_1001288133 -4 Left 1001288129 5:170438349-170438371 CCTCGTGTGGGGACAGCAGGGCA 0: 1
1: 0
2: 2
3: 36
4: 217
Right 1001288133 5:170438368-170438390 GGCACACTGGAGAGGTGAGGAGG 0: 1
1: 0
2: 5
3: 45
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001288129 Original CRISPR TGCCCTGCTGTCCCCACACG AGG (reversed) Intronic
900124396 1:1063057-1063079 TGACCTGCTCTCCCCACTCCAGG + Intergenic
900256013 1:1698500-1698522 TGCCCTGCCGGCCCCACACTCGG + Intronic
900264681 1:1751110-1751132 TGCCCTGCCGGCCCCACACTCGG + Intergenic
900366478 1:2313885-2313907 CGCCCTGCTGTGCCCACCCTGGG + Intergenic
900373420 1:2342605-2342627 TCCCCTGCTGTCCCCAGCCCCGG + Intronic
901000363 1:6146067-6146089 GCCCCTGCTGTGCCCACATGTGG + Intronic
901034587 1:6328801-6328823 TGCCCTGCTGTGCACACTGGAGG + Intronic
902630707 1:17702805-17702827 TGCCCTGCTATCCCCACCCTGGG + Intergenic
902960436 1:19959462-19959484 ATCCCTGCTGTCACCACACTTGG + Intergenic
903384171 1:22916029-22916051 TGCCCTGCTGTCCCCATGGGGGG - Intergenic
904173006 1:28605159-28605181 TGCTGTGCTGTTCCCACATGTGG - Intronic
904319790 1:29689449-29689471 TCCCCAGCTGTGCCCACCCGGGG + Intergenic
904702840 1:32368356-32368378 AGCCCAGCTGTCCCCTCAGGAGG - Intronic
906581639 1:46940085-46940107 TGCACTGCTATCCCTACAAGGGG - Intronic
907220583 1:52904627-52904649 TGCCGAGCTGTCACCACACCTGG + Exonic
907390320 1:54153862-54153884 TCCCCTGCTGTCCCCATGCCTGG - Intronic
910846405 1:91608919-91608941 TGCCCTGCAGTGGCCACACGAGG + Intergenic
912946316 1:114087652-114087674 AGCCCTGCTGTCCCCAGCCCTGG - Intergenic
918309116 1:183272920-183272942 TGCCCTTCTGTCCCCAGTCATGG + Intronic
920377905 1:205519142-205519164 AGCCCTTCTGTCCCCACTTGGGG + Intronic
920388451 1:205584004-205584026 TGACCTGCTGTCCCCAGAGGAGG + Exonic
922683291 1:227618562-227618584 TGCCTGGCTGTCCCCACAAGAGG - Intronic
923234395 1:232018734-232018756 TTCCCTGCTGTCCCTCCACACGG - Intronic
924038237 1:239957453-239957475 TGATCTGCTGTCCCCACAGGTGG + Intergenic
1063425688 10:5948424-5948446 CTCCCTGCTCTCCCCACGCGTGG - Intronic
1063440340 10:6067804-6067826 TGCCCTGCTCTTCCCACTCTGGG - Intergenic
1067529722 10:47061411-47061433 TGCCCTGCTGCCCCCCCAGGAGG + Intergenic
1070071803 10:73097003-73097025 CTCCCTGCTGCCCCCACCCGTGG + Intergenic
1070492752 10:76993092-76993114 TGGCCAGCTGTCCCCACTGGTGG + Intronic
1075731824 10:124640910-124640932 CGCCCCGCTGACCCCACACTAGG + Intronic
1076687564 10:132204952-132204974 AGCCGTGCTGGCCCCACCCGAGG + Exonic
1076828315 10:132981561-132981583 TGCCCACCTGTCCCCACCTGTGG + Intergenic
1076849470 10:133086028-133086050 TGTCCTGCTGCCCCCGCACGTGG - Intronic
1077140895 11:1024423-1024445 TGCCATGCTGTTCCCCCGCGGGG + Intronic
1077174391 11:1182028-1182050 TGTCTTCCTGTCCCCACCCGCGG - Intronic
1077907981 11:6548399-6548421 TGCCTTACTGTCCTCACACCTGG - Exonic
1083730055 11:64648043-64648065 TGGCCTGCTGTCCCCTCATAGGG - Intronic
1083844176 11:65321432-65321454 CTCCCTGCTGTCCCTGCACGTGG + Exonic
1084378914 11:68798273-68798295 TGCACAGCTCTCCGCACACGAGG - Intronic
1084694795 11:70746797-70746819 TGCCCCGCTGCCCCCACACTGGG + Intronic
1088918846 11:114247130-114247152 TGCCCTACTGTCCCCTGAAGAGG + Intronic
1089249134 11:117144762-117144784 TGCCCTGCCGGGCCCACCCGCGG + Intronic
1089335432 11:117719897-117719919 TGCCCACCTGTCCCCACAATAGG + Intronic
1091207966 11:133833714-133833736 TGCCCTGCTGGCCCCCCGCCAGG + Intergenic
1092118071 12:6023664-6023686 TGCCATGCTGGGCACACACGTGG + Exonic
1093685049 12:22046111-22046133 TGGCCTACTGGCCCCAGACGAGG + Intergenic
1097223526 12:57463773-57463795 TGACCTTCTGTCCCCACACTGGG - Exonic
1101087260 12:101249047-101249069 TGCCCTGCTGACCTCACACTAGG - Intergenic
1101426711 12:104594222-104594244 GGCCATTCTGTCCCCACACTGGG + Intronic
1103511907 12:121480806-121480828 TCCCATGCTGGCCCCACACCCGG + Intronic
1103939243 12:124492972-124492994 GCCCCTGCTGCCCCCACACAAGG + Intronic
1104016465 12:124965364-124965386 TGCCCTGCTGTGCCCAGCCAGGG - Intronic
1104924336 12:132306138-132306160 TCCCCTGCAGGCCCCCCACGGGG - Intronic
1105967638 13:25399145-25399167 TACCCAGCAGTCCCCACACTGGG - Intronic
1107279867 13:38721388-38721410 TGCTCTGCTGTCCTCACCCATGG - Intronic
1107309298 13:39060067-39060089 TGCCCAGGTGTCACCACACCAGG + Intergenic
1108495488 13:51020434-51020456 TGCCATGCTGCCCAAACACGTGG - Intergenic
1108583214 13:51845219-51845241 GGGGCTGCTCTCCCCACACGTGG - Intergenic
1113426397 13:110211919-110211941 TGCTCTGCTGTCTCCCCAGGGGG - Exonic
1118719665 14:68585244-68585266 TTCCCTGCTGTCTCCCCATGGGG + Intronic
1119335932 14:73833706-73833728 GGCCCTGCTCTCCCCTCAAGAGG + Intergenic
1120194584 14:81467979-81468001 TGCCCCGAGATCCCCACACGTGG + Intergenic
1120202590 14:81553935-81553957 TACCCTGCTGTGCCCAAACCAGG + Intergenic
1121526583 14:94623592-94623614 TGTTCTGCTGTCCCCACAGGTGG + Exonic
1122454041 14:101835746-101835768 TGCACAGCCGTCCCCTCACGGGG + Intronic
1122556847 14:102585223-102585245 GGCCCTGGTGTCCCCACTCCTGG - Intergenic
1122951673 14:105048336-105048358 AGCCCTGCTGTCCCTACCGGTGG + Intergenic
1124653358 15:31488558-31488580 TCCCCTGCAGGCCCCACACCTGG + Intronic
1125274594 15:37977727-37977749 GGCCCTGCTGTCCCCAAGCCAGG - Intergenic
1125549910 15:40537432-40537454 TGCCCCGATGGTCCCACACGAGG - Intronic
1125726194 15:41869453-41869475 TGCCCTCCTCTCTCCACCCGTGG + Intronic
1125832829 15:42728677-42728699 TTCCCAGCTGTGCCCTCACGGGG - Exonic
1127143131 15:55997109-55997131 TGCCCTCCTCACCCCACAAGGGG + Intergenic
1128154783 15:65385501-65385523 TGGCCTCTTCTCCCCACACGGGG + Intronic
1129119462 15:73387180-73387202 TGCCCTGCATTCCCCACCTGGGG + Intergenic
1129548044 15:76418777-76418799 TGGCCTGCTGTGCCCACATCTGG + Intronic
1132120413 15:99170743-99170765 CTCTCTGCTGTCCCCTCACGTGG - Intronic
1132505590 16:306903-306925 CGCCCTGCCGTCCACACACCCGG - Intronic
1132986465 16:2770064-2770086 AGCCCTGCTTCCCACACACGGGG + Intronic
1134134986 16:11671952-11671974 CGCCGTTCTGTCCCCACACTAGG + Intronic
1134286599 16:12867438-12867460 TTCCCTGCAGTCCCCACTCCAGG + Intergenic
1136270208 16:29144070-29144092 GGCCCTGCTGTCCACACACGAGG - Intergenic
1136428735 16:30185245-30185267 TGGCCGGCTGTCCAAACACGTGG - Exonic
1138605387 16:58085278-58085300 AGCCCTGCTGTGGCCACACGAGG + Intergenic
1139444566 16:66988905-66988927 TGCCCTGCTGTCCCCAGGAGAGG - Intronic
1141703540 16:85653054-85653076 GGCAGTGCTGTCCCCACATGGGG + Intronic
1141804965 16:86336378-86336400 GGTTCTGCTGTCCCCACAGGAGG - Intergenic
1141998073 16:87647675-87647697 TGTCCTGCTGTCCACACACACGG + Intronic
1142073799 16:88105904-88105926 GGCCCTGCTGTCCACACACAAGG - Intronic
1142128097 16:88420078-88420100 TGCCCTGTCTTCCCCACACATGG - Intergenic
1142247790 16:88977680-88977702 AGCCCTGCTGTCTCCACAGAGGG - Intergenic
1142850970 17:2704618-2704640 TGTCCGCCTGACCCCACACGGGG + Intronic
1143376101 17:6468569-6468591 TGCCCCGCTGTGCCCAAACCTGG + Intronic
1143514229 17:7411397-7411419 TTCCCTGCTTTGCCCACACTGGG + Intronic
1144078918 17:11744587-11744609 TGCCCTGCTGTCATCACAACTGG + Intronic
1144727458 17:17508940-17508962 AGCCCTGATGTCCCCGCACAAGG + Intronic
1144735466 17:17553099-17553121 GGCTTTGCTGTCCCCACACACGG + Intronic
1145233100 17:21189368-21189390 TGACCTGCAGTCACCACTCGCGG + Intronic
1145242607 17:21248573-21248595 TGTCCTGCTGTCCCATCATGGGG - Intronic
1146679986 17:34800124-34800146 TGGACTTCTGTCCCCACACAGGG + Intergenic
1147739870 17:42665457-42665479 TGCTCTTCTGTCCCCCCAGGTGG + Exonic
1148431547 17:47647830-47647852 TGCCCTGCAGTAGCCACACTGGG - Intergenic
1150134159 17:62686497-62686519 TGCCCTGCTGATCCAACAGGAGG + Intronic
1151351606 17:73535151-73535173 CCCCCTGCTGTCCTCACACATGG - Intronic
1151381983 17:73732163-73732185 AGCCCTGCTGGTCCCACACCAGG + Intergenic
1151395402 17:73819696-73819718 TGCCCGGCTCTCCCCACTCCAGG - Intergenic
1151400597 17:73853447-73853469 TGCCCTTGTGGCCCCACAGGGGG - Intergenic
1151431482 17:74066465-74066487 TGCCCCTCTGTCCCCACCTGGGG + Intergenic
1151785453 17:76272840-76272862 TGCCCCGCTTTGCCCACGCGGGG + Intergenic
1152077902 17:78169926-78169948 TGGCCAGCTGTCTCCACACAAGG - Intronic
1152333455 17:79686472-79686494 TGCCCTCCTGTGCCCACACCTGG - Intergenic
1152738635 17:82009368-82009390 TGGGCTGCTCTCCCCACACAAGG - Intronic
1152756739 17:82090189-82090211 TGCCCCACTGGCCCCACACCTGG - Intronic
1153255081 18:3162410-3162432 TGCCCTGCTTTCCCTACCCAAGG + Intronic
1156269414 18:35517267-35517289 TGCCCTGGTGGCACCACACCTGG + Intergenic
1158541986 18:58365478-58365500 TGGGCTGCTTTCCCCACACTTGG + Intronic
1158658062 18:59359032-59359054 TGCCCTTCTGGGCCCACGCGGGG - Exonic
1158860637 18:61588986-61589008 TGCCCTGCCCTCTCCACATGAGG + Intergenic
1160888266 19:1362627-1362649 TGTCCTCCTGTCCCCTCGCGGGG + Intronic
1161221412 19:3119852-3119874 TGCCCTACTGCCCCCACCCTCGG + Intronic
1161222362 19:3123480-3123502 TGCCCACGTGGCCCCACACGTGG - Exonic
1161343024 19:3753072-3753094 AGCCCTCCTGTCCCCACCTGGGG + Intronic
1161456569 19:4372641-4372663 TTCCCTGCTGGCCCAACACCTGG + Intronic
1161943272 19:7419084-7419106 TACCCTGATGTACCCACACTTGG + Intronic
1162259230 19:9518876-9518898 GGCTCTGCTGTCCCTGCACGTGG + Intergenic
1162626329 19:11887925-11887947 TGCCCTGCTGTAGTCACAGGAGG + Exonic
1163688463 19:18725498-18725520 TGGCCAGCCGTCCCCACACACGG + Intronic
1163826640 19:19527988-19528010 TACCCCACTGTCCCCACAGGTGG + Exonic
1164536463 19:29089517-29089539 TGCCTGGCTGTCCCCAAACCAGG - Intergenic
1166346309 19:42168241-42168263 TCCTGTCCTGTCCCCACACGAGG + Intronic
1166504522 19:43362596-43362618 TGTCCTGCTGCCCCCTCACATGG - Exonic
1167095686 19:47373840-47373862 TGCCCAGCTGCCCCAACACCTGG - Intronic
1167380747 19:49136697-49136719 TGTCCCTCTGTCCCCACACAGGG + Intronic
1167646884 19:50710790-50710812 TGCCCTGCCGTGCCGCCACGTGG + Intronic
1168259655 19:55186266-55186288 GGCTCTGCTGTTCCCACACCAGG + Exonic
1168645264 19:58055431-58055453 TTCCCTGCAGTCCCCACTGGGGG + Intergenic
925712765 2:6757850-6757872 TGCCCTCAGGTCCCCACCCGCGG + Intergenic
926203195 2:10815982-10816004 TTCCCTGCTGTCCCCAGCCCTGG + Intronic
927685690 2:25168870-25168892 TGCCCGGCCTGCCCCACACGGGG - Exonic
934936241 2:98467511-98467533 GGACCTGTTGTCCCCACATGTGG - Intronic
934975089 2:98796485-98796507 TTCCTTCCTGTCCCCACACCTGG + Intronic
935265148 2:101387367-101387389 CGCCCTGCTGTCCCCGGCCGCGG - Exonic
938292489 2:130157490-130157512 TGCTCTGCTGCCCCCACGGGAGG + Intronic
938968274 2:136407578-136407600 TGTCCTCCTGCCCCCACACCAGG - Intergenic
948374960 2:237515365-237515387 GGCCCTGCTGTCCCCACTTGGGG + Intronic
948454082 2:238096732-238096754 TGCCCTTCTGTCCCTTCCCGGGG - Intronic
948503633 2:238412557-238412579 TGCCCTGATGGCCCAGCACGTGG + Intergenic
948891015 2:240907124-240907146 GGCCCTGCTGGCCCCACACTTGG - Intergenic
1171440899 20:25162104-25162126 TGCCCCCATGTCCCCAGACGGGG + Intergenic
1172793115 20:37519762-37519784 CTCCCTGCTGTGCCCCCACGTGG + Intronic
1173573934 20:44097799-44097821 TGCCCTGCTGACACTGCACGGGG - Intergenic
1175449593 20:59051789-59051811 TGCCCTGGTCTCCCTAGACGTGG - Intergenic
1176220563 20:63967600-63967622 AGCACCGCTGTCCCAACACGAGG + Intronic
1176260585 20:64177593-64177615 TGCCCTCATGTCCCCACCCCTGG - Intronic
1179407887 21:41140326-41140348 TTCCCTGCTGTCACCACACAGGG - Intergenic
1179582111 21:42350643-42350665 TGCCCTCCTGGCCCGACACGGGG + Intronic
1179655364 21:42841486-42841508 TGCCCTGCTGTCCCCGTCTGGGG + Intergenic
1180064037 21:45404208-45404230 CTCCCTGATCTCCCCACACGTGG - Intergenic
1180199432 21:46215655-46215677 TGCCCTGCCGGCCCCTCAGGAGG + Intronic
1180569502 22:16702080-16702102 TGCCATGCTGGGCACACACGTGG + Intergenic
1180885561 22:19240928-19240950 TGGCCAGCTGTCTCCACATGTGG - Intronic
1181027002 22:20132260-20132282 CGCACTGGTGTCCCCACACAAGG - Intronic
1182526856 22:30925960-30925982 GGCCCTGCTGCACCCACACATGG + Intronic
1183086587 22:35490731-35490753 GGCCCTGTTGCCCCCACACCAGG + Intergenic
1183412332 22:37662258-37662280 AGCCCTGCTGTCCCCAGATGAGG - Intronic
1184090864 22:42292387-42292409 TGCCCTGCAGTCCCCAAACATGG + Intronic
1184545299 22:45163610-45163632 AGCCCTGCAGCTCCCACACGCGG + Intergenic
1184835171 22:47016694-47016716 TGCCCTGCTGTCCTCTCAGGTGG + Intronic
1185087830 22:48750139-48750161 GGCCCTGCTGTCCTCAGAGGAGG + Exonic
956454794 3:69409830-69409852 TACTCTGCTTTCCCCACATGTGG - Intronic
960683164 3:120270214-120270236 TGCCCTGGTCTCCCCAGACATGG + Intronic
961049222 3:123733034-123733056 TGCCTTCCTGTCTCCTCACGGGG + Exonic
962312042 3:134333659-134333681 TCCCCTGCTGGCCTCACTCGGGG - Intergenic
962928101 3:140013353-140013375 AGCTCTGCTGTCACCACATGTGG - Intronic
963781149 3:149487775-149487797 TGCCCACCTGTCACCACAAGGGG + Intronic
964251543 3:154723743-154723765 TGCCCAGCTGTCTACACACAGGG - Intergenic
967818000 3:193815361-193815383 TGCCCTGCTGTGTCCAGATGGGG - Intergenic
968356494 3:198111616-198111638 GGACCTGCTGTGCCCACACCTGG - Intergenic
968818723 4:2834791-2834813 TACCCAGCTGTCCCCAGACTGGG - Exonic
968871834 4:3246349-3246371 AGCCCTGCTGCCCCCACCCTTGG + Intronic
969427859 4:7136372-7136394 AGCCCTGCTGTCCCCTTGCGTGG + Intergenic
969618012 4:8265022-8265044 TGCACTGCTGTCCCCACCCGTGG + Intergenic
970645776 4:18118655-18118677 TGCCCTGCAATCCACACAGGAGG + Intergenic
972950267 4:44313096-44313118 TGCCCTGCTGTGCCCAGAGAAGG + Intronic
974409194 4:61517296-61517318 CGCCCTGCGGTCCCCGCAGGTGG + Intronic
975110685 4:70619751-70619773 TGTCCTGCTGTCCTAACACCTGG + Intergenic
978903354 4:113979283-113979305 TGTCCTGCGGTCCCCACACCTGG + Exonic
981325256 4:143438886-143438908 TGCCCTTCTGTCCCAACAGAGGG - Intronic
983178750 4:164622957-164622979 TGCCCTGCTGTGGCCACATTAGG - Intergenic
983537821 4:168877557-168877579 TGAACTGCTGGCCCCACACTTGG + Intronic
984855930 4:184196141-184196163 TGCCATGCTGTTCACCCACGAGG + Intronic
985511211 5:315268-315290 TGCCCTGCAGTCTCTGCACGTGG + Intronic
987079551 5:14414223-14414245 TGCCGTGCAGGCCCCACAGGCGG - Intronic
988626645 5:32883529-32883551 TGCCCATCTGTCCCAACACCTGG + Intergenic
992813009 5:80408193-80408215 AGCCCTGCTGTTCCCACAGGGGG + Intronic
995449167 5:112281390-112281412 TGCCCTGCTCTTCCCACAGATGG - Intronic
997476239 5:134144214-134144236 AGCCGTGCTGTCCCCACACAGGG + Intronic
999144641 5:149384198-149384220 TGCCGTGCTTTCCCCACAGGAGG - Intronic
999241006 5:150127331-150127353 TGCCCTGCTGGCCACCCATGAGG + Intronic
1001146134 5:169186306-169186328 TTCCCTGCTGCCTCCTCACGTGG - Intronic
1001288129 5:170438349-170438371 TGCCCTGCTGTCCCCACACGAGG - Intronic
1001711527 5:173782460-173782482 TGCCCTGAGATCCCCACACTTGG + Intergenic
1002060185 5:176621195-176621217 AGCCCTGCTGCCCCCTCACCTGG + Exonic
1002299550 5:178249405-178249427 TGCCCTGCGGTGCCCACACCCGG - Intronic
1002320706 5:178373919-178373941 TGCCCTGCTCTCCTCAGGCGAGG - Intronic
1002417340 5:179127357-179127379 TGCCATGCTGGGCCCACACCTGG - Intronic
1002518289 5:179775104-179775126 TATCCTGCTGTCCCAACACCAGG - Exonic
1002785130 6:394091-394113 TCCCCTGCTCTGCCCACAGGTGG - Intronic
1005399230 6:25414700-25414722 TGCCCTGTTGTACCCACAAGTGG + Intronic
1005781869 6:29201314-29201336 TGGCCTGGTGTGCCCACACTTGG + Intergenic
1006580578 6:35074888-35074910 TGGCCAGCAGTCACCACACGGGG + Intronic
1006936832 6:37724444-37724466 TCCCGAGCTGTCCCCACTCGGGG + Intergenic
1007956457 6:45922080-45922102 AGCCCAGCTGACGCCACACGAGG - Intronic
1015596526 6:134872360-134872382 TTACCTTTTGTCCCCACACGTGG + Intergenic
1018823939 6:167395314-167395336 GGCCCTGCTGGCCCCACATGAGG + Intergenic
1018915984 6:168132652-168132674 GGAACTGCTGTCCCCACTCGGGG + Intergenic
1019132073 6:169884315-169884337 TGTCCCGCTGTCCACACAGGAGG + Intergenic
1019181513 6:170190097-170190119 TGCCCTGCTTGGCCCACACCTGG + Intergenic
1020111729 7:5451541-5451563 GGCCCTGCGGTTCCCACCCGGGG + Intronic
1020365847 7:7379702-7379724 TGCCCTACTGTCCCAACGTGGGG - Intronic
1024142684 7:46478215-46478237 TGCCCTGCTGGGTCCACATGTGG - Intergenic
1029494155 7:100888268-100888290 CGCCCTGCAGTCCCCACAGGAGG + Exonic
1031381969 7:121097791-121097813 TCCCCTGGTTTCCACACACGTGG - Exonic
1032505919 7:132434687-132434709 TGCCTTGGTGTCCCCAAATGAGG - Intronic
1032711190 7:134461921-134461943 TTCCCTGCTGTCCCAACCCAAGG + Intergenic
1032791613 7:135246754-135246776 AGCCCTGGTGTCCCCAGGCGAGG - Intronic
1033774079 7:144587469-144587491 TGCACTGCTAACCCCACAGGTGG + Intronic
1034224816 7:149474317-149474339 CGCCCTGCTGCCTGCACACGGGG + Exonic
1034441717 7:151089017-151089039 AGCCCTGCTGTTCCCACTCCTGG + Intronic
1035160916 7:156949588-156949610 TGCCCGGCTGCCCCCGCACCCGG + Intergenic
1035236243 7:157499367-157499389 TGGCCTGCTCACCCCACAGGAGG + Intergenic
1036417200 8:8561724-8561746 TTCCCTGCTTGCCCCACACCTGG - Intergenic
1036636209 8:10551442-10551464 TACCCTGCCGTCCCCACCAGAGG - Intronic
1036638373 8:10566706-10566728 TGCCCAGCTGTCCCACCACAAGG + Intergenic
1040542699 8:48374177-48374199 TACCCTGCTGTGCCCAGACATGG + Intergenic
1042120304 8:65480183-65480205 TGTCTTGCTGTCCTCACATGTGG - Intergenic
1044892781 8:96855036-96855058 TGCCCTGCTGCCCTCAAACTGGG - Intronic
1048030444 8:130626577-130626599 TCCCCTTCTGTCCCCAAACAAGG + Intergenic
1048274166 8:133053285-133053307 TGCCCATCTGTCCCCACCCCCGG + Intronic
1048591160 8:135821911-135821933 TGCCCTGCTCTCCCCAGATATGG - Intergenic
1049310538 8:141931561-141931583 TGACCAGCTCTCCCCACAGGGGG - Intergenic
1049748400 8:144272613-144272635 TGGCCTGCTGTGCCCACTCGGGG - Intronic
1052676710 9:31635129-31635151 TGCCCCGCTGACCTCACAGGTGG + Intergenic
1052868496 9:33481238-33481260 TGCCCTGCTGATCTCACAGGAGG - Intergenic
1059958507 9:119542799-119542821 TGCCCTTCCCTCCCCACAAGTGG - Intergenic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1061008038 9:127939345-127939367 TGGCCTGCTGTCCCCACCTGGGG + Intergenic
1061037715 9:128122730-128122752 AGCCCTGCTGTCCCCAGGGGAGG + Intronic
1061878471 9:133556673-133556695 TGCCCAGGTGTCCCCAGACATGG - Intronic
1062046215 9:134425653-134425675 TGGTGTGCTGTCCCCACAGGGGG - Intronic
1203770220 EBV:46160-46182 TGTCCAGCTGCCCCCTCACGAGG - Intergenic
1187226104 X:17376243-17376265 TGCCCTGCAGCGCCCAGACGCGG - Exonic
1192333603 X:70199793-70199815 TTCCCTTCTGTACCCACAGGTGG + Exonic
1197759308 X:130016369-130016391 TGACCTGCTGTCCCCTCCCTAGG + Intronic
1200161854 X:154013679-154013701 TGCCCCGCTGCCCTCAAACGGGG + Intronic
1200307870 X:155046793-155046815 TGCACTTCTGTCGCCACATGAGG - Intronic