ID: 1001288262

View in Genome Browser
Species Human (GRCh38)
Location 5:170439027-170439049
Sequence AGGATCTAAGTTGATAGAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 188}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001288262_1001288268 -7 Left 1001288262 5:170439027-170439049 CCCTCTCTATCAACTTAGATCCT 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1001288268 5:170439043-170439065 AGATCCTAGTGGTAGGGTGGAGG 0: 1
1: 0
2: 2
3: 8
4: 147
1001288262_1001288272 28 Left 1001288262 5:170439027-170439049 CCCTCTCTATCAACTTAGATCCT 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1001288272 5:170439078-170439100 CTGACAATGGACAGATTCACAGG 0: 1
1: 3
2: 21
3: 96
4: 414
1001288262_1001288269 -6 Left 1001288262 5:170439027-170439049 CCCTCTCTATCAACTTAGATCCT 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1001288269 5:170439044-170439066 GATCCTAGTGGTAGGGTGGAGGG No data
1001288262_1001288271 15 Left 1001288262 5:170439027-170439049 CCCTCTCTATCAACTTAGATCCT 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1001288271 5:170439065-170439087 GGCTACAAATCAACTGACAATGG 0: 1
1: 0
2: 0
3: 12
4: 110
1001288262_1001288267 -10 Left 1001288262 5:170439027-170439049 CCCTCTCTATCAACTTAGATCCT 0: 1
1: 0
2: 0
3: 12
4: 188
Right 1001288267 5:170439040-170439062 CTTAGATCCTAGTGGTAGGGTGG 0: 1
1: 0
2: 2
3: 3
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001288262 Original CRISPR AGGATCTAAGTTGATAGAGA GGG (reversed) Intronic
902744487 1:18464329-18464351 AGGATCTAAGTGCTCAGAGATGG + Intergenic
903085578 1:20854820-20854842 AGGATCTATGTTGAAAGGAAAGG + Intronic
907661726 1:56399539-56399561 AACATATAAGTTGATAAAGAAGG + Intergenic
909568941 1:77086210-77086232 AAGAACTAAGTTGGTAGAGCAGG + Intergenic
910897507 1:92084153-92084175 AGGATCAATGGTGATAAAGATGG - Intronic
911651391 1:100393163-100393185 TGGATCTAAATTGAGAGAAATGG - Intronic
912813410 1:112810631-112810653 AGGAGGTAAGTTTAAAGAGAAGG - Intergenic
912999938 1:114569999-114570021 TGGATCTAAATTGAGAGAAATGG - Exonic
913065260 1:115246769-115246791 AAGATATAATTGGATAGAGAAGG - Intergenic
913266412 1:117049395-117049417 AGGTTCTAAGTTGTAAGTGAGGG - Intergenic
913609634 1:120497412-120497434 AGGCTGTAAGCTGAGAGAGAAGG + Intergenic
913613203 1:120529014-120529036 AGGATCTTGGGTGAGAGAGAGGG - Intergenic
914371555 1:147029776-147029798 AGGATCTTGGGTGAGAGAGAGGG - Intergenic
914577984 1:148993233-148993255 AGGATCTTGGGTGAGAGAGAGGG + Intronic
914581556 1:149024432-149024454 AGGCTGTAAGCTGAGAGAGAAGG - Exonic
917235444 1:172887229-172887251 AGCATCTTAATTGATAGAGCTGG - Intergenic
919184429 1:194126534-194126556 AGAATCTAGGTAGATAGATAAGG + Intergenic
920040495 1:203092115-203092137 AGGCTCTACATTGATACAGAGGG + Intronic
920560005 1:206932213-206932235 AGGATCTAGGTTCAGAGACAGGG - Intronic
921110055 1:212027161-212027183 AGGAGCTAAGGTGAAAAAGAAGG + Intronic
1063198222 10:3762856-3762878 AGGAGGTAAGTAGACAGAGACGG - Intergenic
1064013112 10:11751765-11751787 AGGATGTAAGTAGAGAGACAAGG - Intronic
1066282220 10:33928535-33928557 AGGATCTAAGCTGTTTAAGAAGG - Intergenic
1068636421 10:59353028-59353050 AGGATCTATTTTGATAGGCATGG + Intronic
1070225746 10:74503732-74503754 AAGGTTTAAGTTGATGGAGAAGG + Intronic
1073252823 10:102132488-102132510 AGAAACAAATTTGATAGAGAAGG + Intergenic
1074267632 10:111920656-111920678 ATGCTTTGAGTTGATAGAGAGGG - Intergenic
1074372596 10:112912347-112912369 ACGGGCTAAGTTGATGGAGATGG + Intergenic
1074450838 10:113558625-113558647 GGTATCTGAGTTGATTGAGATGG - Intronic
1075783122 10:125029986-125030008 AGGTTGAAAGTTGATAGAAATGG - Intronic
1075842134 10:125513907-125513929 AGGGACTAAGTGGCTAGAGAAGG + Intergenic
1077851611 11:6078790-6078812 TGGATCTACGTTGATACTGAGGG + Intergenic
1078806786 11:14713844-14713866 AGGATTTCAGTAGATAAAGATGG + Intronic
1079783875 11:24645348-24645370 AAGCTCTAATTTGATAGAAAAGG - Intronic
1085817448 11:79755144-79755166 AGGATCAGAGTGGAAAGAGACGG - Intergenic
1086104654 11:83134259-83134281 TGGATCTAAATTGAGAGAAATGG + Intergenic
1086588924 11:88488574-88488596 AGGATGAAAGTTGAAGGAGATGG - Intergenic
1087164587 11:94988861-94988883 AGGATCTAACATAATAGAGAGGG + Intronic
1090933313 11:131319315-131319337 AGGATAAAAGATGAGAGAGAGGG - Intergenic
1092736346 12:11586586-11586608 AGGCTATAAGTAGATTGAGAAGG - Intergenic
1093379272 12:18471945-18471967 AGTATCTAATTTGATATAAATGG - Intronic
1093871978 12:24303809-24303831 AGGATCAAAGGGGAGAGAGAGGG + Intergenic
1094114042 12:26890864-26890886 AGGATCTAAGTGGAAATAGTCGG - Intergenic
1094147134 12:27242569-27242591 AAGAACTAAGTTACTAGAGAAGG + Intergenic
1097378140 12:58862090-58862112 TTCATCTAAGCTGATAGAGAAGG - Intergenic
1100494947 12:95115986-95116008 AAGATCTAAATTGCTAGCGATGG - Intronic
1101029137 12:100642964-100642986 AGGATTAAAGTGGATAGAGGGGG - Intergenic
1101233343 12:102764303-102764325 AGGTTCTAAATTGATTGATATGG + Intergenic
1107355803 13:39565150-39565172 TGGATATAAGATGATATAGATGG - Intronic
1107798906 13:44084825-44084847 AGGATGCAAGTGGGTAGAGAAGG - Intergenic
1111130709 13:83971844-83971866 AGGAGTTAAGTTGATACAGCAGG + Intergenic
1114385874 14:22253851-22253873 AGGATTTAAAATGAGAGAGATGG + Intergenic
1118811370 14:69276862-69276884 TGGATCTCAGCTGATTGAGAAGG + Intronic
1119005726 14:70926041-70926063 AGGATATAACTAGATGGAGATGG - Intronic
1119948581 14:78720650-78720672 TTGATCTAAAATGATAGAGATGG - Intronic
1120856127 14:89214095-89214117 ATCATCAAAGTTGAGAGAGAAGG - Intronic
1120915390 14:89705833-89705855 AGTATCTATGGTGATAGAAATGG - Intergenic
1127110160 15:55660376-55660398 AAGATCTAAGTTAAACGAGAGGG - Intronic
1127718193 15:61672090-61672112 AGGAGCAGAGTTGATAGAGGTGG - Intergenic
1127951543 15:63812033-63812055 TGGCTCTAAATTTATAGAGATGG - Intronic
1128650843 15:69412207-69412229 ATGAACACAGTTGATAGAGAAGG + Intergenic
1131302905 15:91215164-91215186 AGGAGCTAAGCTGGTAGGGAAGG - Intronic
1135864079 16:26084561-26084583 AGGATCTCAGGAGATAAAGATGG - Intronic
1135957188 16:26965728-26965750 GGGCTCTAGGTTGATGGAGAGGG - Intergenic
1136854005 16:33638385-33638407 AGTGTCTAAGTTGATTGAGTTGG + Intergenic
1138528275 16:57621084-57621106 GGGAGCCAAGTTGGTAGAGAGGG - Intronic
1141747326 16:85934348-85934370 AGGAGCTAAGATGACAGGGAGGG + Intergenic
1203115586 16_KI270728v1_random:1486824-1486846 AGTGTCTAAGTTGATTGAGTTGG + Intergenic
1142570289 17:869146-869168 AGGATGTGAGATGAGAGAGAAGG - Intronic
1143102461 17:4512000-4512022 AGGATCCAAGTTGACAGATGAGG - Intronic
1144624239 17:16836646-16836668 AGGATCTGAGTTGACAGAGGAGG + Intergenic
1144882189 17:18436073-18436095 AGGATCTGAGTTGACAGAAGAGG - Intergenic
1145150044 17:20508313-20508335 AGGATCTGAGTTGACAGAAGAGG + Intergenic
1145801402 17:27688265-27688287 TGGATCTATGTTGATACTGAGGG + Intergenic
1146054370 17:29573856-29573878 TTGATTTAAGTTCATAGAGAAGG + Exonic
1146161976 17:30564956-30564978 AGGATCTGAGTTGACAGAGGAGG + Intergenic
1146433312 17:32819813-32819835 AGGATCTAATATTACAGAGAAGG + Intronic
1147026351 17:37588057-37588079 AGAATCTAAGTTGAGCAAGAAGG - Intronic
1147578374 17:41615365-41615387 AGGATCTGAGTTGACAGAGGAGG + Intronic
1149433286 17:56611865-56611887 AAGATCTAAATTGATATTGAAGG + Intergenic
1155686160 18:28554071-28554093 AGGATCTAGGTTAATAGAACTGG - Intergenic
1156161698 18:34366998-34367020 AGAATCTCAGTTGAAAGTGAGGG + Intergenic
1156486795 18:37471543-37471565 AGGATCTAGGTGGATGGAGGGGG - Intronic
1156557313 18:38082214-38082236 AGAATCTAAGTAGATTGAGAGGG + Intergenic
1157756438 18:50222203-50222225 TGAATCTATGTTGATACAGAGGG + Intergenic
1157996223 18:52559439-52559461 AGGAGATAAATTAATAGAGATGG - Intronic
1164950470 19:32332497-32332519 ATGATCTAGTTGGATAGAGAAGG - Intergenic
1166991285 19:46694211-46694233 GGGATCCATGTTGATAGGGATGG + Intronic
925652740 2:6109013-6109035 AAGTTCTATGTTGTTAGAGATGG + Intergenic
926393614 2:12419329-12419351 AGGATTTATATTCATAGAGATGG - Intergenic
926854955 2:17245254-17245276 AGGATTTGAATTGAGAGAGAGGG - Intergenic
927084985 2:19666190-19666212 AGAAGCTAAGTTGTTAGGGATGG - Intergenic
927226370 2:20769019-20769041 AGATTCAAGGTTGATAGAGATGG - Intronic
928505294 2:31945654-31945676 ATGATCTCATTTGAAAGAGATGG - Intronic
930278138 2:49337858-49337880 TGGAACTAAGGTTATAGAGATGG - Intergenic
933253536 2:80055327-80055349 AGAATTTAAGCTGTTAGAGATGG - Intronic
933578599 2:84099489-84099511 AGGATAGAAGATGAGAGAGATGG - Intergenic
933912599 2:86956448-86956470 AGGTTATAAGTTGAAAGTGAGGG + Intronic
934010396 2:87813446-87813468 AGGTTATAAGTTGAAAGTGAGGG - Intronic
935773962 2:106454156-106454178 AGGTTATAAGTTGAAAGTGAGGG - Intronic
935906101 2:107841757-107841779 AGGTTATAAGTTGAAAGTGAGGG + Intronic
935992572 2:108734275-108734297 AGGTTATAAGTTGAAAGTGAGGG + Intronic
936127887 2:109806909-109806931 AGGTTATAAGTTGAAAGTGAGGG + Intronic
936216810 2:110564576-110564598 AGGTTATAAGTTGAAAGTGAGGG - Intronic
936425949 2:112419157-112419179 AGGTTATAAGTTGAAAGTGAGGG - Intronic
938509241 2:131923088-131923110 AGGCTCCAAGTTGACACAGATGG - Intergenic
939613356 2:144335567-144335589 AGCCTCTAAATTGATAGACAAGG + Intergenic
941368813 2:164638744-164638766 AGGAACTAAGTTGGTAAATATGG + Intergenic
943875016 2:193055788-193055810 AGTATCTGAGTTGATATAGTGGG + Intergenic
943931575 2:193860575-193860597 AGGAACTAAATTAAGAGAGAAGG - Intergenic
944139623 2:196441270-196441292 AGGATCTAACTTCCTAGAGTTGG + Intronic
946669106 2:222083569-222083591 AGGATCAAAATTAATAAAGATGG - Intergenic
1170680592 20:18522118-18522140 AGGAGGTAAGTTTAAAGAGAAGG + Intronic
1176258747 20:64167739-64167761 AGGATCTAAGATGAGGAAGATGG - Intronic
1176784246 21:13235452-13235474 AGGCTCCAAGTTGACATAGATGG + Intergenic
1177982293 21:27929313-27929335 AGGCTCCAAGTTGACACAGATGG + Intergenic
1179099005 21:38340166-38340188 AGTAGCTAAGGTGACAGAGAAGG + Intergenic
1183780876 22:39998125-39998147 AGGATCTAAGTTAATGGCCAGGG - Intronic
1184511127 22:44933934-44933956 AGGATCTCAGTAAATAGACAAGG - Intronic
949703527 3:6787363-6787385 AATTTCTAAGTTGATGGAGATGG - Intronic
951913661 3:27777093-27777115 AGGAGCTAAGTTGAAAGTGTAGG + Intergenic
952801470 3:37296445-37296467 AGGATGTGAGCTGATAGATATGG + Intronic
953251589 3:41249349-41249371 AGGATCTCAGTGGACAGTGATGG + Intronic
953856161 3:46500587-46500609 AAGATTTCAGTTGATAGAGGAGG + Exonic
955884907 3:63587639-63587661 AGGATCTTACTTGATTCAGAAGG + Intronic
956807066 3:72825832-72825854 AGTATCTCAGTTGAAAGGGAAGG - Intronic
957353988 3:79058534-79058556 TGGATCTACGTTGATACTGAGGG - Intronic
959485917 3:106927201-106927223 AGGATGCAAGTTTAAAGAGAAGG + Intergenic
960924021 3:122779420-122779442 TGGATCTAAATTGAGAGAAATGG - Intronic
962035999 3:131652255-131652277 ATGAACTAAACTGATAGAGAAGG - Intronic
964773525 3:160250594-160250616 AGGATGTAATTTCATAGAGTAGG - Intronic
964982788 3:162706829-162706851 AGGATGTAACTGGATAGACAAGG + Intergenic
964988159 3:162771045-162771067 TGGATCTTATTTGATAGAGGAGG + Intergenic
965812237 3:172603146-172603168 TGGCTCTAAGATGATGGAGAAGG + Intergenic
966163956 3:176996136-176996158 AGGAAGTAAGCTGATAAAGAAGG - Intergenic
967269836 3:187724535-187724557 AGGAGCTAAGGTGTTTGAGAAGG - Intronic
970006994 4:11420809-11420831 AGGGTCCAAGATGAAAGAGAAGG - Intronic
970256572 4:14174994-14175016 AGGAGCCAAGTTGAAAGAAAAGG + Intergenic
970377125 4:15469992-15470014 AGGATGGAAGTGGAGAGAGACGG - Exonic
970911366 4:21280239-21280261 AGGATCCAAGCTGATGGGGAAGG - Intronic
970932562 4:21529664-21529686 AGGATATAAGCAGAAAGAGATGG + Intronic
977435664 4:96991000-96991022 TATCTCTAAGTTGATAGAGATGG - Intergenic
978696493 4:111585860-111585882 ACAACCTAAGTGGATAGAGAGGG - Intergenic
978953101 4:114584771-114584793 TGGATCAAATTTTATAGAGAAGG - Intergenic
979225574 4:118280516-118280538 AGGATGTAATTTGATGTAGAAGG + Exonic
979539833 4:121869413-121869435 AGGATCTAAGGGGTTAGAGAAGG - Intronic
981270237 4:142837929-142837951 AAGGTCTAAGTTGAGAGGGAAGG + Intronic
981431311 4:144664146-144664168 AGGGTCCAAGTAGATAGAGAGGG - Intronic
984225317 4:177027885-177027907 TGGATGTAAGTAGATAGAGACGG - Intergenic
984617156 4:181911785-181911807 AGGATATAACATGATATAGAAGG + Intergenic
987246711 5:16056374-16056396 AGGATCTTATAAGATAGAGATGG + Intergenic
988596129 5:32592889-32592911 AGGATGTAGGTTAAGAGAGAGGG + Intronic
991576602 5:68110769-68110791 TGGATTTAATTTGATAGATACGG - Intergenic
996681957 5:126237480-126237502 AAGATCTAAGTTAATACAGCTGG - Intergenic
998116717 5:139543440-139543462 AGGATCTACGTGGGTATAGAGGG - Intronic
998939779 5:147268829-147268851 GGGATCTGAGTTGTGAGAGAGGG + Intronic
1001288262 5:170439027-170439049 AGGATCTAAGTTGATAGAGAGGG - Intronic
1001451611 5:171829531-171829553 AAAATCCAAGTTGCTAGAGAAGG + Intergenic
1005434743 6:25796859-25796881 AGGTTCTCAGTTAAGAGAGAGGG - Intronic
1005765220 6:29004826-29004848 AGGCCCTAAGATGAAAGAGAAGG - Intronic
1006256436 6:32836194-32836216 AGTATCTATGATGACAGAGAAGG - Intronic
1008826587 6:55701902-55701924 TGGATCTAACTTAATGGAGAGGG + Intergenic
1009192388 6:60645092-60645114 AGAATCTAAATTAATGGAGAGGG - Intergenic
1009581355 6:65538192-65538214 AGGATATAAGTTGAAAGAAAAGG + Intronic
1013296346 6:108761397-108761419 AGCATCTAAGTGGGTACAGAGGG - Intergenic
1013631408 6:111989629-111989651 AGGATCTCAGTTTATGGAGAAGG - Intergenic
1020354365 7:7260595-7260617 AGGAACTCAGTGTATAGAGATGG + Intergenic
1020815342 7:12898663-12898685 ATGATATAAGTAGATACAGAGGG - Intergenic
1022297061 7:29066117-29066139 AGTATCTAGGTTGGGAGAGAGGG + Exonic
1023428820 7:40068201-40068223 GGGAGCTAAGATGATACAGAGGG + Intronic
1024231055 7:47363893-47363915 TGGATCTAAGCTGAAAGAGGAGG + Intronic
1024269684 7:47632876-47632898 ACAATCTTAGTAGATAGAGAAGG + Intergenic
1026300977 7:69097747-69097769 AGGATCTAATTTGGTACAGTGGG - Intergenic
1027936921 7:84617592-84617614 AGCATCTGAGTTTATATAGAGGG + Intergenic
1027980496 7:85214190-85214212 TGGATCCCAGTTGTTAGAGAAGG - Intergenic
1028545718 7:91997511-91997533 AGGATCTCAACTGATAGAAATGG + Intronic
1029237725 7:99135831-99135853 AGAATATAAATTGATAGAGTAGG - Intronic
1034820100 7:154209284-154209306 AGGACTTAAGTGGAAAGAGAAGG - Intronic
1035639272 8:1171641-1171663 AAGATCAAAGTTGACAAAGAAGG - Intergenic
1037234052 8:16695757-16695779 ATGATTTAACTGGATAGAGATGG - Intergenic
1037537276 8:19836327-19836349 AGAATTTGAGTAGATAGAGAGGG + Intronic
1038675603 8:29620180-29620202 AGCATCTAAGTTTAAAGAGCTGG - Intergenic
1038868153 8:31462176-31462198 AGTATGTAAGGTGATAGATATGG + Intergenic
1041787538 8:61651250-61651272 AAAATGTAAGCTGATAGAGAAGG - Intronic
1045658309 8:104409997-104410019 AGGATCTAATTAGACAGATAAGG - Intronic
1046103108 8:109636984-109637006 AGGATCAAAGATGGTAGAAACGG - Intronic
1046323904 8:112615176-112615198 ATGATCTAAGTGGAAGGAGAGGG - Intronic
1051417163 9:16853988-16854010 TGGATGTAAGTTCATAGACATGG + Intronic
1052649493 9:31282944-31282966 AGGTTCTAAGATGATGGATAGGG + Intergenic
1057402446 9:94736507-94736529 AGGATCTAGATTAATAGAGTTGG - Intronic
1059294798 9:113260736-113260758 TGGCTCTAAGATGATGGAGAAGG - Exonic
1059886024 9:118745527-118745549 AGGAAAAAAGTAGATAGAGAAGG + Intergenic
1060922876 9:127435029-127435051 AGGATCTAGGGTGATAGGGGTGG - Intronic
1187642513 X:21310570-21310592 ATGATCTAAGTTCTTGGAGAAGG + Intergenic
1188779287 X:34260539-34260561 TGGATCAAAGTTGAAAGAGAGGG - Intergenic
1188925495 X:36037664-36037686 GGGTTCTAGGGTGATAGAGAAGG - Intronic
1189632033 X:42964875-42964897 AGGATCAAAGCTGATAGAAATGG - Intergenic
1189727946 X:43987595-43987617 AGGGTCTTGGTTGATAGGGATGG + Intergenic
1197036001 X:121874068-121874090 AGGATTTTATTTTATAGAGAGGG + Intergenic
1197378098 X:125707022-125707044 ATGATTTAAGTTGACAGAAAGGG + Intergenic
1197688622 X:129472991-129473013 AGGATCTAGGGAGATGGAGAAGG + Intronic