ID: 1001289606

View in Genome Browser
Species Human (GRCh38)
Location 5:170447465-170447487
Sequence AACTTCCCATTCAAACTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001289606_1001289613 24 Left 1001289606 5:170447465-170447487 CCCTAGAGTTTGAATGGGAAGTT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1001289613 5:170447512-170447534 ACAGGACCCCGTTTGTGAAGGGG 0: 1
1: 0
2: 0
3: 3
4: 63
1001289606_1001289614 25 Left 1001289606 5:170447465-170447487 CCCTAGAGTTTGAATGGGAAGTT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1001289614 5:170447513-170447535 CAGGACCCCGTTTGTGAAGGGGG 0: 1
1: 0
2: 0
3: 4
4: 86
1001289606_1001289612 23 Left 1001289606 5:170447465-170447487 CCCTAGAGTTTGAATGGGAAGTT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1001289612 5:170447511-170447533 CACAGGACCCCGTTTGTGAAGGG 0: 1
1: 0
2: 0
3: 5
4: 69
1001289606_1001289615 28 Left 1001289606 5:170447465-170447487 CCCTAGAGTTTGAATGGGAAGTT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1001289615 5:170447516-170447538 GACCCCGTTTGTGAAGGGGGTGG No data
1001289606_1001289611 22 Left 1001289606 5:170447465-170447487 CCCTAGAGTTTGAATGGGAAGTT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1001289611 5:170447510-170447532 ACACAGGACCCCGTTTGTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 98
1001289606_1001289608 -5 Left 1001289606 5:170447465-170447487 CCCTAGAGTTTGAATGGGAAGTT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1001289608 5:170447483-170447505 AAGTTCTGACTTGAAGAATTAGG 0: 1
1: 0
2: 3
3: 19
4: 328
1001289606_1001289609 6 Left 1001289606 5:170447465-170447487 CCCTAGAGTTTGAATGGGAAGTT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1001289609 5:170447494-170447516 TGAAGAATTAGGAACCACACAGG 0: 1
1: 0
2: 1
3: 12
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001289606 Original CRISPR AACTTCCCATTCAAACTCTA GGG (reversed) Intronic
901537443 1:9891626-9891648 CGCTTCCCAATCAAACTCTTCGG + Intronic
904894840 1:33807640-33807662 TCCTTCCAATTCATACTCTATGG - Intronic
905517565 1:38573270-38573292 AGCTTCCCTTTCATTCTCTAGGG + Intergenic
914910974 1:151786494-151786516 AACTTCCCATTTAATCTTTTTGG + Intronic
915715228 1:157939124-157939146 GACTTCCCCTACAACCTCTATGG - Intergenic
918542247 1:185645076-185645098 AACTTCCCCTTCACCCTCCAAGG + Intergenic
919046978 1:192464713-192464735 AACTTTTCATTAAAACTTTAAGG - Intergenic
919969315 1:202563190-202563212 AACTTCCCTCTCAAACTCCTGGG + Intronic
920171519 1:204074877-204074899 AACTTCCCAGGAAAACTCTTCGG - Intronic
921306231 1:213799551-213799573 AATTTCCCTGTCAAACTTTATGG + Intergenic
923054627 1:230416766-230416788 AACTTCCCATCCAAACCGAAGGG - Intronic
1066650293 10:37648742-37648764 ACCTTCCCATTAAAACTAAAGGG + Intergenic
1067033233 10:42894527-42894549 ACCTTCCCATTAAAACTAAAGGG + Intergenic
1067214851 10:44293313-44293335 GCCTTCCCATGCAAACTGTAGGG - Exonic
1067769753 10:49115017-49115039 AACTTCCCTTTCACTCTCTTCGG - Intronic
1072507685 10:96085167-96085189 AGCATCTCATTTAAACTCTAGGG - Intergenic
1075540457 10:123309161-123309183 AGCTTCCACTTAAAACTCTATGG - Intergenic
1082370146 11:51785155-51785177 ATCTTCCCATACAAACTAGATGG + Intergenic
1082436394 11:52745145-52745167 ATCTTCCCATACAAACTAGATGG + Intergenic
1082502319 11:53697562-53697584 ATCTTCCCATACAAACTAGATGG + Intergenic
1083220289 11:61248115-61248137 AACCACACATTCAAACTATAAGG + Intronic
1085817394 11:79754499-79754521 AACTTTCCCTTCCAACTCCAGGG + Intergenic
1087995085 11:104796243-104796265 AAATTCCAATTCAAAGTCTAAGG - Intergenic
1095365130 12:41394250-41394272 GACTTCCCATCCAATCTCAATGG + Intronic
1097219523 12:57439602-57439624 AACTTCTCTTTAAAACTCTGTGG + Intronic
1097549729 12:61052284-61052306 TTATTCCCATTCAAACTTTAAGG + Intergenic
1098807459 12:75037589-75037611 AAATTCCCATTCAAATCCAAAGG - Intergenic
1099288706 12:80748218-80748240 AACTTCCCACTCATATTCCATGG + Intergenic
1101112676 12:101501455-101501477 AACCTCCCATTCAAATTCTTGGG + Intergenic
1103040732 12:117693368-117693390 GACTTCCCATTCACCCTCCATGG + Intronic
1103838788 12:123845982-123846004 ACTTTCCCAGTCAAACTCTCGGG - Exonic
1104961835 12:132491762-132491784 AAGTTCTCATCCAAACTCTGGGG + Intronic
1105086381 13:16205041-16205063 ATCTTCCCATTAAAACTAGACGG + Intergenic
1105676996 13:22682358-22682380 CCCTTCCCATTCTTACTCTATGG + Intergenic
1106156526 13:27162854-27162876 ACGTTACCATTCAAACTCTGAGG - Intronic
1107900522 13:45008885-45008907 ATCATCCCATTTCAACTCTAAGG + Intronic
1108128831 13:47274643-47274665 AACCTTCCATTCAGATTCTAGGG - Intergenic
1108202124 13:48054760-48054782 AACTTCCCATTCAGATGGTAAGG + Intronic
1112334889 13:98506596-98506618 AATTTCCCACTCAAACACAAAGG + Intronic
1114255514 14:20998443-20998465 CATTTCCCATACATACTCTAGGG - Intergenic
1116412844 14:44645590-44645612 ATCATCTCATTCAAATTCTACGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1118076311 14:62303020-62303042 TACATCCTATTCACACTCTAGGG - Intergenic
1118257081 14:64214683-64214705 AAATTCACATTCAGACACTAAGG + Intronic
1118616308 14:67576630-67576652 AAGTTCCCATCCAAGCTCCAGGG + Intronic
1119361022 14:74049817-74049839 AACTTCACTCTCAAACTCTTTGG - Exonic
1120072572 14:80120665-80120687 AACTTCCCAGCCAACCTCAAAGG + Intergenic
1120550270 14:85862796-85862818 AACTTTCCAGTCAACCTCGATGG - Intergenic
1120854823 14:89203352-89203374 GACTTCCAAATCAAAGTCTAGGG + Intronic
1125154026 15:36565668-36565690 AACTTCACATATAACCTCTAAGG + Intergenic
1125377954 15:39053430-39053452 GTCTTCCCATTCAGCCTCTAGGG - Intergenic
1128560522 15:68663416-68663438 AACTATCCATTTAAATTCTAGGG - Intronic
1130694113 15:86112946-86112968 AAATTCCCCTTAAAACACTAGGG + Intergenic
1134328840 16:13231571-13231593 AACTTCCTCTTTAAATTCTAGGG - Intronic
1134401188 16:13911501-13911523 AACTTGTCTGTCAAACTCTATGG - Intergenic
1135476786 16:22783745-22783767 ACCTTCCCATTGACCCTCTAGGG + Intergenic
1139836601 16:69843880-69843902 AACTTCCCAAACAGACCCTAGGG + Intronic
1144424048 17:15124471-15124493 AACCTCCCTTTCAAACTTGATGG + Intergenic
1148088938 17:45010995-45011017 AAATTCCCTTTCAAACTCCTTGG - Intergenic
1155689422 18:28600251-28600273 AACGTACATTTCAAACTCTAGGG + Intergenic
1156049944 18:32920409-32920431 AATTTCCAATAGAAACTCTATGG + Intergenic
1156099284 18:33574700-33574722 AAATTCCCTGTCATACTCTAAGG - Intergenic
1156440711 18:37184856-37184878 AACTTCCCATTAAAAATGTTTGG + Intronic
1158876777 18:61741664-61741686 AACTTTCCATTCATCCTCTAAGG - Intergenic
1159748365 18:72268773-72268795 AACTTCCCCTACAAACTGTGGGG + Intergenic
925053992 2:841423-841445 AACTTTCCATTCCAAATCAAAGG + Intergenic
930214188 2:48676755-48676777 AGCTTCCCTTTAAAACTCTGAGG - Intronic
930700316 2:54453847-54453869 AACTTTCCATTCAGAATGTAGGG - Intergenic
930833118 2:55766730-55766752 AACTTCCAAATCAAAATCTATGG + Intergenic
935138371 2:100328495-100328517 AAATTCCCATTCAAACTGTTGGG - Intergenic
940346702 2:152636389-152636411 AACATCCCAGTGAAACTCAATGG - Intronic
946159537 2:217827756-217827778 ACCTTCCCCTCCAAACTCTGTGG + Intronic
948819459 2:240532389-240532411 AAATACACATTCAAATTCTAAGG + Intronic
1169774941 20:9242135-9242157 CTCTTCCCATTCTGACTCTACGG - Intronic
1173106641 20:40143310-40143332 AACATCCCCTTCCAACTTTAAGG - Intergenic
1174098356 20:48107468-48107490 ACCTCCCCATTCATACTCAAAGG + Intergenic
949639294 3:6016866-6016888 AACTTCCAATTCAAAGACAAAGG + Intergenic
950216126 3:11160957-11160979 CTCTTCCCATTGATACTCTAGGG - Intronic
950828366 3:15849602-15849624 AGCTTCCAATTCCAACTCTCTGG - Intronic
952940995 3:38444279-38444301 TATGTCCCATTCAAACTGTAGGG - Intergenic
955000058 3:54919286-54919308 AGATTCCCATTGAAAATCTAAGG + Intronic
955522425 3:59787942-59787964 AACTTCTCATTTTCACTCTACGG - Intronic
956803668 3:72787496-72787518 AATTTCACATTAAAACTGTATGG - Intronic
956974411 3:74563670-74563692 AGCTTCCCATTCAAAATCTGGGG - Intergenic
957939513 3:86988085-86988107 AATTTCCCCCTCAAACTGTATGG - Intronic
959775725 3:110160458-110160480 CACTTCCCAATGAAACTCTCTGG + Intergenic
959927073 3:111934859-111934881 GACAACCCATTCCAACTCTATGG - Intronic
960890193 3:122439824-122439846 AACTTGCTATACAAACTATAAGG + Intronic
963367856 3:144362044-144362066 ATTTTCCCATTTAAATTCTAAGG - Intergenic
964072806 3:152655288-152655310 AATTTCCCATTCAAATCCAAAGG + Intergenic
965533507 3:169800872-169800894 AACTTACAATTCAAAGTCCAAGG - Intronic
966723347 3:183086302-183086324 AACTTCCCAGTCTCATTCTAGGG - Intronic
970354914 4:15242456-15242478 AACATCCCATTCTAAGTTTAGGG + Intergenic
971090562 4:23339027-23339049 AACTTACATTGCAAACTCTAGGG + Intergenic
980024200 4:127745750-127745772 ACCTTCCAATTCTAAGTCTAGGG - Intronic
983775415 4:171600412-171600434 AACTTCTCATTCAAACTAGAAGG + Intergenic
985039358 4:185873533-185873555 AAATTCTAATTCAAAATCTAGGG + Intronic
992656563 5:78916220-78916242 AGCTTCCCATGCAAGTTCTAAGG + Intronic
994062029 5:95488933-95488955 AACTTTCCATTGAAAATATATGG + Intronic
994131499 5:96234394-96234416 ATATTCCCATGCAAACTGTAAGG - Intergenic
996684274 5:126263428-126263450 AACTGCCACTTCAAACTCTCTGG - Intergenic
998621470 5:143799073-143799095 AACTTCTCTTTCAGACCCTAAGG - Intergenic
1001289606 5:170447465-170447487 AACTTCCCATTCAAACTCTAGGG - Intronic
1001687672 5:173606653-173606675 AACTTCCCATTAAAGCTATGTGG + Intergenic
1003215728 6:4108862-4108884 AACTTCCCATAAAAACACTGAGG - Intronic
1005389276 6:25316970-25316992 AACTTCCCAGTTAAAAACTAAGG - Intronic
1006396348 6:33789771-33789793 AACTGCCCATTCGAACCCAAGGG - Intergenic
1006956887 6:37881743-37881765 AACTTTTCTTTCAAACCCTAAGG - Intronic
1009621709 6:66085589-66085611 TACTTCCACATCAAACTCTAGGG + Intergenic
1010883752 6:81212089-81212111 AACTTTCTATTGAAACTCAAGGG + Intergenic
1014230892 6:118900760-118900782 AATTTTCCATTCCAAGTCTAGGG - Exonic
1014519418 6:122422529-122422551 CACTTCTCATTCAATCTTTATGG + Intronic
1014652290 6:124054616-124054638 AATCTCCCATTCTGACTCTATGG - Intronic
1016773601 6:147879584-147879606 AACATCCCATCAAAACTATAAGG - Intergenic
1018618063 6:165706754-165706776 AATTTACCATTCAGACTTTAGGG + Intronic
1019257410 7:61106-61128 ACCTGCCCTTTCAAACTCCAGGG + Intergenic
1022585289 7:31603104-31603126 AAATTGGCATTCAAGCTCTAGGG - Intronic
1023043382 7:36191924-36191946 AACTGCCCCTTCAAACTTAAGGG - Intronic
1023141221 7:37104396-37104418 ACCTTCTCAATCAAACCCTAGGG - Intronic
1024120090 7:46227763-46227785 AACTTCCTCTTCAAAATCTTTGG + Intergenic
1027296501 7:76778439-76778461 AACTTTCCTTTCATAGTCTAAGG - Intergenic
1027432650 7:78130661-78130683 AAGTGCCCACTCCAACTCTAGGG - Intronic
1028664829 7:93329699-93329721 GACTTCCCATTAAAAAGCTATGG + Intronic
1030417624 7:109265086-109265108 AAGCTCCCATTGAAACTCTGTGG + Intergenic
1031638324 7:124129684-124129706 AAGTTCCTATGCAAATTCTAGGG - Intergenic
1032763876 7:134972341-134972363 ATATTCCCATTGAAACTCAAAGG - Intergenic
1036075323 8:5493001-5493023 AATTTCCCAATCACATTCTAAGG - Intergenic
1036974340 8:13394153-13394175 ATGTTCCTATTCAACCTCTATGG + Intronic
1037885827 8:22595773-22595795 AACTTCCCCTTGAGGCTCTAGGG + Intronic
1039202625 8:35113242-35113264 AACTTCCCTTGCAAATTCCAAGG + Intergenic
1043183790 8:77119497-77119519 ACCTGCCCCTTCAGACTCTAAGG - Intergenic
1043822871 8:84890110-84890132 AACTTAACATTCACACTCTTTGG - Intronic
1046117090 8:109797472-109797494 ATCATCATATTCAAACTCTAAGG + Intergenic
1051775242 9:20624848-20624870 AAATACCCTTTCAGACTCTATGG - Intergenic
1054832633 9:69643652-69643674 AGCTTCACATTCAAATTCTCAGG + Intronic
1056891438 9:90497317-90497339 AAAATCCCATTCCAACTATAAGG + Intergenic
1057113069 9:92492712-92492734 GACTTTCCATCCAAATTCTAAGG + Intronic
1057881448 9:98796004-98796026 AGTTTACCATTCCAACTCTAAGG + Intronic
1058015279 9:100024780-100024802 TACTTCCAATTCAAATTATAGGG - Intronic
1058979336 9:110154905-110154927 AAATTCCCATTTAACCGCTATGG + Intronic
1059646662 9:116274863-116274885 AGCTTCCAATTCAAAGTCTTGGG - Intronic
1060085332 9:120694889-120694911 AATTTCCCATTCACATTCAAAGG + Intronic
1187221104 X:17326958-17326980 AACTTCCTATTCAAAAAATAGGG - Intergenic
1188541150 X:31252099-31252121 AACTTCCAAATCAAAATTTATGG - Intronic
1188614899 X:32145427-32145449 ACCTTCCCTTTCAAACTCCTTGG - Intronic
1189349688 X:40267252-40267274 GGCTTCCCATTTAACCTCTAAGG + Intergenic
1194581383 X:95676355-95676377 AATTTCCCAATAAAACTCTATGG + Intergenic
1196228465 X:113193330-113193352 TCCTTTCCTTTCAAACTCTAGGG + Intergenic
1198184987 X:134246228-134246250 AACTGCCTGTTCAAACTCAATGG + Intergenic
1200368670 X:155697323-155697345 AACTTCCCGTCCAAATTCAAAGG - Intergenic
1202257756 Y:22939192-22939214 TACATCCCCTTCAAGCTCTAGGG + Intergenic
1202410746 Y:24572939-24572961 TACATCCCCTTCAAGCTCTAGGG + Intergenic
1202460035 Y:25097133-25097155 TACATCCCCTTCAAGCTCTAGGG - Intergenic