ID: 1001292966

View in Genome Browser
Species Human (GRCh38)
Location 5:170477943-170477965
Sequence CTCCAATAGAAGTGCCTCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001292966 Original CRISPR CTCCAATAGAAGTGCCTCCA GGG Intronic
906610566 1:47199036-47199058 GTCCTAGAGGAGTGCCTCCACGG - Intergenic
908026962 1:59962412-59962434 CTCCAATAGGGATGACTCCAGGG + Intergenic
910253645 1:85224123-85224145 CTTTAATAGAACTGGCTCCATGG - Intergenic
910602354 1:89045300-89045322 CTGCAATCAAAGTGCCTCCTGGG + Intergenic
910638526 1:89435922-89435944 CTGCAATCAAAGTGCCTCCTGGG - Intergenic
910762683 1:90750116-90750138 CTTCAATAGCAGTGAATCCAGGG + Intergenic
913250188 1:116906862-116906884 CTCCAATCATAGTGCCCCCAAGG - Intergenic
924139548 1:241007939-241007961 CTCCCATTGAATAGCCTCCAGGG - Intronic
1066041017 10:31548118-31548140 CTCCACTATCAGTGCCTCAATGG - Intergenic
1068988107 10:63125305-63125327 CTCAAATGGCAATGCCTCCATGG + Intergenic
1071835973 10:89417222-89417244 CTCCAACAGAATGGCCTTCAAGG - Exonic
1072485450 10:95850138-95850160 ATCAAATAGAAAAGCCTCCAGGG - Intronic
1073059586 10:100725286-100725308 CTCCAAAAGGAGTGCGTCAATGG + Intergenic
1074296405 10:112193317-112193339 CTCCAGTGGCAGTGGCTCCATGG - Intronic
1076778891 10:132713323-132713345 CTCCAGTAGGTGTGGCTCCAGGG + Intronic
1078396031 11:10982959-10982981 CTCTGGCAGAAGTGCCTCCAAGG - Intergenic
1078900692 11:15639696-15639718 CTGTAATAGCAGTGGCTCCAAGG - Intergenic
1085904968 11:80749299-80749321 CTCCCTGAGAAGTACCTCCAAGG + Intergenic
1087187275 11:95214102-95214124 CTTAAATAGAACTGTCTCCATGG - Intronic
1092643835 12:10547631-10547653 CTCAAATAGAGGTGTTTCCAGGG - Intergenic
1096661990 12:53131389-53131411 CTGCACGAGATGTGCCTCCAAGG + Intergenic
1096974868 12:55694222-55694244 CTCCAATGGAGGTGCCCCCTTGG + Intronic
1106217341 13:27715059-27715081 CTCCATTATAACTGCCTGCAGGG - Intergenic
1106995103 13:35471645-35471667 CTTCACTAGAAGTGCCTGCCAGG - Intronic
1107070183 13:36259979-36260001 CTCCAATGGAGGTGCCTCCTTGG + Intronic
1111188738 13:84780253-84780275 CTGCAAGAGAAGTGGCTTCAGGG - Intergenic
1116784153 14:49269026-49269048 CTCCAATAGCAGTGCCTCAGTGG - Intergenic
1119131315 14:72175683-72175705 CTCCATTAGAGGTTCCTCAAGGG + Intronic
1120271048 14:82313432-82313454 CTCCAATAGAAGCACATGCATGG - Intergenic
1120486140 14:85115285-85115307 TTCCCACAGAAGTGCATCCAAGG + Intergenic
1120850596 14:89165515-89165537 CTTCAAGAGGAGTTCCTCCAGGG + Intronic
1121573514 14:94965095-94965117 CACCAACAGAAGTGCTTGCAAGG + Intergenic
1123725842 15:23100795-23100817 CAGCAATTGAAGCGCCTCCAGGG + Intergenic
1131329746 15:91486067-91486089 CTCCCAGAGAAGTGACTCCCAGG - Intergenic
1135691983 16:24545624-24545646 ATCCAGTAGAAGTTCCTCCAAGG + Intronic
1137646075 16:50075676-50075698 CTTCAATAGAAGAGATTCCATGG - Exonic
1140721290 16:77774715-77774737 CTCCACTACCAGTGCCTCCTGGG + Intergenic
1140799646 16:78473947-78473969 TTCGAACAGAAGTTCCTCCAAGG - Intronic
1142305020 16:89280035-89280057 CTCCAGAAGAGATGCCTCCAGGG - Exonic
1144704127 17:17356290-17356312 CCCCAAGAGAGGTCCCTCCAGGG - Intergenic
1145342312 17:21965526-21965548 CTCAAATAGAATTGACTCAAAGG + Intergenic
1148960355 17:51387326-51387348 CTCCAAGAGAGATGACTCCAAGG - Intergenic
1149563030 17:57622905-57622927 GTCCAATAGAACTTCCTGCAAGG + Intronic
1150494332 17:65595722-65595744 TTCAAGTAGAAGTTCCTCCAGGG - Intronic
1150858646 17:68777733-68777755 CTCCCAAAGAAATGCCCCCAAGG - Intergenic
1157383686 18:47245641-47245663 CATCAATAAAAGTGACTCCATGG + Intronic
1157608018 18:48938460-48938482 CTTCAAAAGAAGTGCTCCCATGG - Intronic
1158257509 18:55569854-55569876 CTTCAATAAAAATGCCTCAAAGG + Intronic
1159267457 18:66101115-66101137 CTGTAGTAGAAGTGCCTGCAGGG - Intergenic
1162155733 19:8677088-8677110 TTCCAATAGCAGAGCCTGCAGGG - Intergenic
1163947299 19:20550739-20550761 TTCCAAAATAAGTGCCTCTAAGG + Intronic
1165408009 19:35642489-35642511 CCCCACAGGAAGTGCCTCCAGGG + Exonic
1167351001 19:48974625-48974647 CTTCAATAGCAGTGCCGACAGGG - Exonic
1168163759 19:54532779-54532801 GCCCAATAGAAGTGGCACCATGG + Exonic
927224553 2:20750441-20750463 GTCCATCAAAAGTGCCTCCACGG + Intronic
938964244 2:136373913-136373935 TTCCAAATGGAGTGCCTCCAGGG + Intergenic
946374949 2:219302380-219302402 CTTCAGCAGAACTGCCTCCAAGG - Exonic
948680406 2:239630208-239630230 CTCCAATGGAGGTGTTTCCATGG + Intergenic
1175537665 20:59726063-59726085 CAGCTATAGCAGTGCCTCCAGGG + Intronic
1175906611 20:62382975-62382997 CTCCATCAGGAGAGCCTCCAGGG - Intergenic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1180048362 21:45320072-45320094 CTCCCACAGCAGAGCCTCCAAGG - Intergenic
1181938117 22:26453391-26453413 CTCCAACAGAAATGCCTCCACGG - Exonic
956279890 3:67545077-67545099 CTCCTATAAAAGTTCCTCAAGGG + Intronic
958989680 3:100828403-100828425 CTCCTATAAAAGAGGCTCCAGGG - Intronic
960532954 3:118785900-118785922 TTCCTATAGAAGAGTCTCCAGGG - Intergenic
961944241 3:130670015-130670037 CTGCATTAGGAGTGCCTCCCTGG - Intronic
963716283 3:148807926-148807948 CTCCCATAGGAATTCCTCCATGG - Intronic
969510255 4:7613618-7613640 CTCCACAAGCAGTGTCTCCACGG - Intronic
975736260 4:77384162-77384184 CACCAATAAAAATGCCTCCCAGG - Intronic
977079198 4:92501508-92501530 CTCCAAGAGAAATGCTTACAAGG + Intronic
979371719 4:119896156-119896178 CTCGATTAAAAGTTCCTCCAGGG - Intergenic
981045709 4:140263169-140263191 CTCCACTAGACTTCCCTCCAAGG - Intronic
988015388 5:25550911-25550933 CTCCAGTAGAAATGACTTCATGG - Intergenic
990623170 5:57582186-57582208 TTGCAAGACAAGTGCCTCCAAGG + Intergenic
990925189 5:61013901-61013923 CTCCAATAGGAATTACTCCAAGG - Intronic
993620722 5:90164632-90164654 CTCAAACTGAAGTGCCTTCAGGG + Intergenic
994468635 5:100172334-100172356 CTACTATAGAAATGTCTCCATGG - Intergenic
997742492 5:136269345-136269367 CTCCAAGAAAATTGCCTTCATGG + Intronic
998921832 5:147077632-147077654 CTCCACTAGCACTGCCTCAATGG - Intronic
999122546 5:149220346-149220368 CTACAGTGGAAATGCCTCCAAGG + Intronic
1001292966 5:170477943-170477965 CTCCAATAGAAGTGCCTCCAGGG + Intronic
1001517821 5:172368339-172368361 CTAGAATAGAAGTGCCACAAGGG + Intronic
1005032587 6:21525215-21525237 CAAAAATAGAAGTGCCTCTAAGG - Intergenic
1005214195 6:23506117-23506139 CTTCAATGAAAGTGGCTCCAGGG - Intergenic
1006707126 6:36030162-36030184 CTCCAATTGAATTGCTTGCAAGG + Intronic
1006909411 6:37554576-37554598 CTTCTAGAGAAGGGCCTCCAGGG + Intergenic
1012932562 6:105332085-105332107 GTCCAACAGAACTGCCTACAGGG + Intronic
1017028739 6:150202596-150202618 CTCCCAGAGAAGAGCCTGCAGGG - Intronic
1017650265 6:156574702-156574724 TTTAAATAGAAGTGCCTACAGGG - Intergenic
1017750310 6:157485326-157485348 CTCCAACAAAACTGCCTCCCAGG - Intronic
1017808121 6:157963890-157963912 GTCCTATAAAAGTGCCCCCACGG - Intergenic
1018996089 6:168711724-168711746 CTGGCATAGAAATGCCTCCAGGG - Intergenic
1020007595 7:4790752-4790774 CTCGAATAGCAGAGCCTCCAGGG - Exonic
1021031524 7:15742972-15742994 ATTCAATAGAAGTGCTTCAACGG - Intergenic
1022554491 7:31278992-31279014 TTTTAATAGAAGTGTCTCCATGG - Intergenic
1023117079 7:36873005-36873027 CTCTAATAGAAAGGCTTCCAAGG + Intronic
1026687153 7:72521139-72521161 CTCCAAAAGAAGAGCCTTCGGGG + Intergenic
1030692969 7:112553564-112553586 CTGCCATGGAGGTGCCTCCATGG - Intergenic
1032679700 7:134168913-134168935 TTCCAAGAGAAGTGGCTCCATGG - Intronic
1033301584 7:140190944-140190966 CTCCAAAAGGAGGGTCTCCAGGG + Intergenic
1036194040 8:6698624-6698646 CTCATAGAGCAGTGCCTCCAGGG + Intergenic
1046814723 8:118571463-118571485 CTCCAAGGAAAATGCCTCCAGGG + Intronic
1047809989 8:128398040-128398062 CTCCAATACAAGGGACACCATGG + Intergenic
1050205723 9:3194419-3194441 CTCCTAAATCAGTGCCTCCAGGG + Intergenic
1053286861 9:36855351-36855373 CTCAAATGGAAATGCCTGCAGGG - Intronic
1057797616 9:98169887-98169909 CTCCAACAGAACCACCTCCAAGG + Intronic
1058393133 9:104520183-104520205 CTCCAATACCTGTGCCACCAGGG + Intergenic
1059925774 9:119207930-119207952 CTACTGTAGAGGTGCCTCCAGGG - Intronic
1061531963 9:131221471-131221493 CTCTAATAGGAGAGCCACCATGG - Intronic
1185874064 X:3687884-3687906 CTCCAAGAGAGGTGGCTACATGG + Intronic
1188791714 X:34413916-34413938 CAGGAATAGAACTGCCTCCATGG - Intergenic
1188856985 X:35208975-35208997 CTCCACTAGAAGTGCCCCAGTGG + Intergenic
1193882127 X:86936346-86936368 CTCCCATAGAAGGGCCTCCACGG - Intergenic
1194741001 X:97574189-97574211 CTCCAATAGAACTCCCTCATTGG + Intronic
1196814073 X:119651257-119651279 CTTCAAGGGAGGTGCCTCCACGG - Intronic
1198020655 X:132654397-132654419 TTCAAATAGAAGTGCCTGTAGGG + Intronic
1199565534 X:149211874-149211896 CTGCAAGAGAAGTGGCCCCAAGG + Intergenic
1201964770 Y:19719955-19719977 CTCCAGAAGATGTGCCTACAGGG + Intronic