ID: 1001293589

View in Genome Browser
Species Human (GRCh38)
Location 5:170483633-170483655
Sequence AGCTGTATCCTGCAAGTTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 3, 3: 7, 4: 92}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001293586_1001293589 -7 Left 1001293586 5:170483617-170483639 CCCCACTCATCTTTACAGCTGTA 0: 1
1: 0
2: 3
3: 28
4: 235
Right 1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG 0: 1
1: 0
2: 3
3: 7
4: 92
1001293588_1001293589 -9 Left 1001293588 5:170483619-170483641 CCACTCATCTTTACAGCTGTATC 0: 1
1: 0
2: 0
3: 6
4: 216
Right 1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG 0: 1
1: 0
2: 3
3: 7
4: 92
1001293585_1001293589 -6 Left 1001293585 5:170483616-170483638 CCCCCACTCATCTTTACAGCTGT 0: 1
1: 0
2: 1
3: 18
4: 209
Right 1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG 0: 1
1: 0
2: 3
3: 7
4: 92
1001293587_1001293589 -8 Left 1001293587 5:170483618-170483640 CCCACTCATCTTTACAGCTGTAT 0: 1
1: 0
2: 0
3: 27
4: 257
Right 1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG 0: 1
1: 0
2: 3
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001293589 Original CRISPR AGCTGTATCCTGCAAGTTAG TGG Intronic
902037826 1:13470486-13470508 AGCTCCATCCTGCACCTTAGGGG + Intergenic
905606671 1:39306832-39306854 AAATGTATCTTGCCAGTTAGAGG - Intronic
908041171 1:60115219-60115241 AGCTTTATCCTGAAAGCTATGGG + Intergenic
909507327 1:76408203-76408225 AGATGGTTCCTGCAAGTAAGTGG + Intronic
911866828 1:103037981-103038003 ACCTGTATGTTGCAAGTTAATGG - Intronic
912065818 1:105741379-105741401 AGCTGTATCGTACAATTTAAAGG - Intergenic
913377172 1:118165324-118165346 AGCTCTCTCCTGCAAGAGAGAGG - Intronic
1067368416 10:45658756-45658778 AGCTATATCCTACAAGTTTTTGG - Intronic
1075300265 10:121316143-121316165 AGCTGAAACCTGCAGGGTAGAGG + Intergenic
1075542608 10:123328205-123328227 AAATGTATCCTGCAAATAAGAGG + Intergenic
1077749627 11:4951930-4951952 AGCTGAAGCATGTAAGTTAGCGG + Intronic
1086482038 11:87251912-87251934 AGATGTATCCAGTAAGTGAGAGG + Intronic
1087701926 11:101444567-101444589 AGCTGTGTCCTGACTGTTAGCGG - Intergenic
1088691651 11:112333588-112333610 ATCTGTTTCCTGCAAGAAAGAGG - Intergenic
1099185503 12:79512043-79512065 GGCTGCATTCTGCAAGGTAGAGG - Intergenic
1106695596 13:32169315-32169337 AATTGTATCCTGAAAGTTATAGG - Intronic
1108679158 13:52764570-52764592 AGCTGCAGCCTGCAAGGTGGTGG - Intergenic
1109121475 13:58462752-58462774 AGCTGAATCCTGTATGTTAGTGG - Intergenic
1111459500 13:88520532-88520554 AGCTGTACCCTGCAGGTCACAGG + Intergenic
1113373364 13:109742111-109742133 AGCTAAATCCTGAAAGTCAGTGG - Intergenic
1116000688 14:39239469-39239491 AGCTTGAGCCTGGAAGTTAGAGG + Intronic
1116941634 14:50797073-50797095 AGCTGCTTCCTGGAAGTTAAAGG + Intronic
1120128936 14:80782120-80782142 AGCTGTTGCCAGCAAGGTAGAGG - Intronic
1120544012 14:85787398-85787420 ATTTGTATATTGCAAGTTAGAGG + Intergenic
1121118947 14:91363917-91363939 AGCTGCAGCCTCCAAGTGAGTGG - Intronic
1121392193 14:93585136-93585158 AACTGCATCCTGCAAGACAGCGG - Intronic
1121525248 14:94614941-94614963 AGCTGAGTCCTGAAAGTCAGTGG - Exonic
1122076492 14:99238314-99238336 AGCTGCCTCTTGCAATTTAGAGG + Intronic
1122872374 14:104645365-104645387 CTCTGTATTCTGCAAGTTAAAGG + Intergenic
1125337222 15:38638815-38638837 AGCTGTTTCCTCCAAGTTAGAGG + Intergenic
1131140277 15:89971662-89971684 AGCTGTGTTCTGCAATTTGGAGG + Intergenic
1131840183 15:96428804-96428826 AGCTCTATCCTGCAAATTACAGG - Intergenic
1132507972 16:321941-321963 AGCTGTATTCTGAAAGACAGAGG + Intronic
1133735911 16:8615627-8615649 ATCTGTTTCCTTCAAGTTAGTGG - Intergenic
1138928878 16:61627808-61627830 AGCTTTAACCTGCAAATTAGAGG - Intergenic
1140625095 16:76783899-76783921 ATCTGTCTCCTGCATGTTTGTGG + Intergenic
1141531491 16:84649265-84649287 TGCTGTCTCCTGCAAGTGCGTGG - Intronic
1143782182 17:9234666-9234688 AGCTGACTGCTGCAAGTGAGCGG - Intronic
1146210526 17:30939046-30939068 ATCTTTACCCTCCAAGTTAGAGG + Intronic
1147862263 17:43530466-43530488 AGCTGTTTCCTGCGAGTTCAGGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1152817621 17:82417879-82417901 AGCTGTATTCTGCACGTTAGAGG + Intronic
924992969 2:329934-329956 AGCTGTATGTTGCAAGACAGGGG - Intergenic
925099055 2:1230153-1230175 TGCTGTATCCTGGTAGTGAGAGG - Intronic
926574668 2:14566815-14566837 GGCTGTATTCTGCAAATCAGGGG - Intergenic
928327219 2:30328979-30329001 AGCTGTCTCCTGCCATTTACAGG + Intergenic
932789764 2:74644669-74644691 AGCTGTATCCAGCACGTAATTGG - Intronic
945953118 2:216058968-216058990 AGCTGTAAACTGCAGGATAGAGG + Exonic
946587254 2:221203628-221203650 AGCTGTATCCTGGGTTTTAGTGG - Intergenic
947621328 2:231593079-231593101 ATCTATATCCTGCCAGTCAGTGG - Exonic
1172186984 20:33036999-33037021 AGTTGTATCCTGCCATTTTGCGG + Intronic
1177620545 21:23586019-23586041 ATGTGTATCCTGCAAATAAGGGG + Intergenic
1182342076 22:29631309-29631331 AGCTGTATCTTGAAAGCCAGGGG - Intronic
1183894920 22:40960637-40960659 AGCTGGATCCTCTAACTTAGAGG - Intronic
952998864 3:38912146-38912168 AGCAGACTCCTGGAAGTTAGAGG - Intronic
955744134 3:62123327-62123349 AGCTGGAGCCTGGGAGTTAGTGG - Intronic
956311130 3:67881754-67881776 ATCTGTAGCCTGCTAGTTAATGG + Intergenic
958884142 3:99707399-99707421 AGCTGTCTGCTTCATGTTAGTGG + Intronic
959627520 3:108469578-108469600 AACTACATCCTGCAAGGTAGTGG + Intronic
960271315 3:115677410-115677432 AGCTGTAACTTGAAAGTTGGAGG + Intronic
961997520 3:131261645-131261667 AGCAATAACCTTCAAGTTAGGGG - Intronic
963436270 3:145271166-145271188 ATGTGTATCCTGCAATTTATTGG - Intergenic
965112786 3:164448849-164448871 AGCTGTACCCTGCAAGCTGCAGG + Intergenic
970108933 4:12616338-12616360 AGCTGTAAGATGAAAGTTAGAGG - Intergenic
971743684 4:30551802-30551824 GGCTGTATCCTGCAAGCCACAGG + Intergenic
977157829 4:93595140-93595162 AGTTGGATCCTACAAGATAGAGG - Intronic
980897388 4:138872969-138872991 AGATGTATGCTTCAAGTTTGGGG + Intergenic
981264092 4:142760455-142760477 AGCTGTATACTTGAAGCTAGTGG + Intronic
982392126 4:154876399-154876421 AGCTCTATCCTGGAAGCTGGGGG - Intergenic
992430815 5:76709826-76709848 TGCTTTATTCTGAAAGTTAGTGG + Intergenic
994776854 5:104045994-104046016 AGCAGTATCCTTGAAGTTAAAGG - Intergenic
996357822 5:122616450-122616472 AACTGTATTGAGCAAGTTAGGGG - Intergenic
1001293589 5:170483633-170483655 AGCTGTATCCTGCAAGTTAGTGG + Intronic
1004182957 6:13396691-13396713 AGCTGTGTCCTGGAAGCAAGAGG + Intronic
1005930767 6:30482094-30482116 AGGTGTTTCCTCCCAGTTAGTGG - Intergenic
1007805748 6:44444550-44444572 AGCTCTCTGATGCAAGTTAGAGG + Intronic
1014889858 6:126830746-126830768 AGCTAAATCTTACAAGTTAGAGG - Intergenic
1017438123 6:154436943-154436965 ATATGTATCCTTCAAATTAGAGG + Intronic
1018851978 6:167647246-167647268 TGGAGTATCCTGCAAGTTAACGG + Intergenic
1019819626 7:3232578-3232600 AGTTAAATCCTGCAAGGTAGTGG - Intergenic
1020197711 7:6054880-6054902 AGCTGAATCCTGGAAGCTGGAGG + Intronic
1020958836 7:14776942-14776964 AGCTGTATTCTGCAAGCTACAGG + Intronic
1026854569 7:73744489-73744511 AGCTGTATCCTGCAGGCAAGTGG - Intergenic
1028731975 7:94161372-94161394 AGCTGGATTCTGAAAGTTGGAGG - Intergenic
1030342795 7:108399857-108399879 AGTTGTTTCCTGCTATTTAGGGG - Intronic
1031130288 7:117825564-117825586 AGCTGTATCCTGAAAAATAAAGG - Intronic
1032330369 7:130973723-130973745 AACTGTATCCTAAATGTTAGAGG + Intergenic
1033599742 7:142880567-142880589 CGCTGTATCCTAGATGTTAGTGG + Intronic
1037060324 8:14500798-14500820 ATCTATATCCAACAAGTTAGTGG + Intronic
1041145649 8:54873605-54873627 AGGTTTATCCTGCAAGTCATCGG + Intergenic
1042884201 8:73530161-73530183 AGCTGTAGCCTGCAAGCTTATGG + Intronic
1047821044 8:128521092-128521114 AGCTGTATCCTCTAATTTAGAGG + Intergenic
1051463464 9:17350521-17350543 AGCTGTATTCTGCTTGTGAGTGG + Intronic
1052153209 9:25146505-25146527 ATTTGTATCCTGCAACTTATTGG - Intergenic
1055057041 9:72033612-72033634 AAATGTAGCCTGCAAGTGAGGGG + Intergenic
1056512623 9:87320275-87320297 AGTTGTATCCTGTAACTTGGAGG + Intergenic
1186448130 X:9649580-9649602 AGATGTATAATGCAAATTAGAGG + Intronic
1189186911 X:39062632-39062654 AGATGTACCTTGCAAGCTAGTGG + Intergenic
1192340896 X:70262516-70262538 AGCTGGATCCTGGGAGTGAGAGG + Intergenic
1195455625 X:105066010-105066032 AGCTGAACACTGCAAGTTACTGG + Intronic
1195514170 X:105753538-105753560 AGGTGTATCCTGCACGTGATTGG + Intronic
1198942030 X:141966384-141966406 AGCTGTATCCTGCAAGTCAAAGG + Intergenic
1199456118 X:148031009-148031031 TACTGTATCCTGCCAGTAAGTGG - Intergenic