ID: 1001295562

View in Genome Browser
Species Human (GRCh38)
Location 5:170496382-170496404
Sequence GAACTCAGCTGGTCTGACTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 176}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001295562_1001295568 14 Left 1001295562 5:170496382-170496404 CCGGAGTCAGACCAGCTGAGTTC 0: 1
1: 0
2: 1
3: 26
4: 176
Right 1001295568 5:170496419-170496441 CATCTATTCACTGTGACTTCAGG 0: 1
1: 0
2: 0
3: 9
4: 177
1001295562_1001295569 18 Left 1001295562 5:170496382-170496404 CCGGAGTCAGACCAGCTGAGTTC 0: 1
1: 0
2: 1
3: 26
4: 176
Right 1001295569 5:170496423-170496445 TATTCACTGTGACTTCAGGAAGG 0: 1
1: 0
2: 1
3: 26
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001295562 Original CRISPR GAACTCAGCTGGTCTGACTC CGG (reversed) Intronic
902039562 1:13483005-13483027 GACCCCAGCTGGTCTGGCTCTGG + Intronic
902229806 1:15020888-15020910 GAACCCAGATTGTCTGGCTCCGG + Intronic
902598283 1:17523794-17523816 GCACTCAGATGGTGTGACCCAGG - Intergenic
903060073 1:20663257-20663279 GATCTCACCGGCTCTGACTCAGG + Intergenic
903272670 1:22200987-22201009 GAACTCAGGCAGTCTGGCTCTGG - Intergenic
903968267 1:27102901-27102923 GAACCCAGCGGCCCTGACTCTGG + Intronic
904655268 1:32040843-32040865 GGGCTCAGCTTGTCTGTCTCTGG - Intronic
905512695 1:38535300-38535322 GAACCCAGGTAGTCTGACTCGGG + Intergenic
910690179 1:89957584-89957606 GAATTCAGCTAATCTCACTCTGG - Intergenic
911160671 1:94679902-94679924 AAACTCAGCTGGTCTCCCTGGGG - Intergenic
913610791 1:120507942-120507964 GAGCTCAGCTGATCAAACTCTGG - Intergenic
913678086 1:121161280-121161302 AGACTCAGCTTGTCTGACTTGGG - Intergenic
914029923 1:143948909-143948931 AGACTCAGCTTGTCTGACTTGGG - Intronic
914159526 1:145119041-145119063 AGACTCAGCTTGTCTGACTTGGG + Intergenic
914580399 1:149014297-149014319 GAGCTCAGCTGATCAAACTCTGG + Intronic
915905389 1:159873195-159873217 GAACTCAGCTGAGCTGGCCCAGG + Intronic
916208275 1:162336337-162336359 GAACCCAGAGGGTCTGACTGTGG + Intronic
916658656 1:166900658-166900680 GAATTCAGGAGGTCTGACTCTGG + Intergenic
916883572 1:169045967-169045989 GAGCTGAGCTAGTCTGAATCGGG + Intergenic
917088386 1:171327363-171327385 GAACTCAAGATGTCTGACTCTGG - Intronic
918095071 1:181327719-181327741 GGACTCAGCTGGTCTGATCATGG - Intergenic
918382455 1:183969816-183969838 GAACTCAGGGAGTCTGACACTGG - Intronic
919155662 1:193762867-193762889 GAACTCAGGGGGTCTGACTTGGG - Intergenic
920185044 1:204154206-204154228 GAACCCAGCCCGTCTGACTTGGG - Intergenic
920465387 1:206179793-206179815 AGACTCAGCTTGTCTGACTTGGG - Intergenic
1070399370 10:76039890-76039912 AAACTCATCTGGTTTGACTTGGG + Intronic
1073519560 10:104114462-104114484 TAACTCAGATGCTCTGACTCAGG + Intergenic
1077352715 11:2100335-2100357 GAACTGAGCTGTTCTTACTGGGG - Intergenic
1078331916 11:10429343-10429365 GAACTCAGCAAGTCTGACTCTGG + Intronic
1078433653 11:11307099-11307121 AGTCTCAGCTGGGCTGACTCAGG - Intronic
1082110566 11:48269071-48269093 GAATTCACATGGTCTGATTCTGG + Intergenic
1083238700 11:61369751-61369773 GACCTCAGCTGGAGTGACTGTGG + Intergenic
1083278019 11:61608575-61608597 GAACCCAGTTTGTCTGACTCGGG + Intergenic
1083478158 11:62927007-62927029 GAATTCTACTGGCCTGACTCTGG - Intergenic
1083478322 11:62927911-62927933 GAAGTCAACTAGTCTGGCTCTGG - Intergenic
1086121179 11:83305783-83305805 GAACCTAGGTAGTCTGACTCTGG + Intergenic
1086515265 11:87604380-87604402 AAATTCAGCAGGCCTGACTCTGG - Intergenic
1088645078 11:111911534-111911556 GCACCCAGCTGGTTTGACACTGG - Exonic
1090092577 11:123711540-123711562 GAACTCAGCTGCCCTGGTTCTGG - Intergenic
1093350143 12:18089691-18089713 GAACTCATCTGCTCTGAAACTGG - Intronic
1097628256 12:62028045-62028067 GAACTCAACCAGTCTGACCCTGG - Intronic
1098957103 12:76698903-76698925 GAATTCAGGTGGTCTGACATGGG + Intergenic
1101626378 12:106446638-106446660 GTATTCAGCTGCTCTGACCCTGG + Intronic
1106986201 13:35354333-35354355 TAACGCAGCTGGTATGATTCAGG + Intronic
1107761945 13:43688792-43688814 GAACTCAGCTTGTCTAAAACTGG - Intronic
1109948144 13:69464906-69464928 AAACTCATGTGGTCTGACTCGGG + Intergenic
1110562869 13:76927988-76928010 AATCTCAGCTGGTCTCACCCGGG + Intergenic
1117215285 14:53545395-53545417 GAATTCAGCAGGCCTGAATCTGG - Intergenic
1120308320 14:82798621-82798643 CAGCTGAGCTGGTCTGATTCTGG + Intergenic
1123171738 14:106379034-106379056 GAATTCACCTGGTCTCACTTTGG + Intergenic
1123195448 14:106611505-106611527 GAATTCACCTGGTCTCACTTTGG + Intergenic
1125330423 15:38576442-38576464 GAACTCAGTGGCTCTGAGTCAGG + Intergenic
1127302091 15:57664769-57664791 GTACTCAGGTAGTCTGAGTCTGG - Intronic
1129891047 15:79072120-79072142 GAGCTGAGCTGGCCTGACTGAGG - Intronic
1129953230 15:79610330-79610352 GAGCACAGCAGGTGTGACTCGGG + Intergenic
1130057119 15:80536236-80536258 GCACTCTGCTGGTCCCACTCGGG - Intronic
1131043120 15:89291301-89291323 GGACTCAGCCAGTCTGACTCTGG + Intronic
1135241626 16:20812005-20812027 GAACTCAGGTAGTATGACTAGGG + Intronic
1135851206 16:25965467-25965489 AACCTCAGCTGTTCTGACTGAGG - Intronic
1137578275 16:49618137-49618159 GAACTCAGCCAGTGTGACTCGGG - Intronic
1138182315 16:54949852-54949874 GAACCCAGGTAGCCTGACTCTGG - Intergenic
1139558357 16:67726807-67726829 GAACTCAGCTGGGCAGACAGAGG + Intronic
1141337761 16:83173242-83173264 GAACTCAGGCAGTCTGACCCTGG + Intronic
1142472169 17:170558-170580 GATCTGAGCTGGGCTGGCTCAGG + Intronic
1142601136 17:1053468-1053490 GGACCCAGATGGTCTGACTCCGG - Intronic
1142614685 17:1127477-1127499 GCACCCAGCTGGCCTGAGTCTGG + Intronic
1143688038 17:8535009-8535031 GAGCTCAGCAGGCCTGACACAGG + Intronic
1148046659 17:44748934-44748956 GAACTCTGCTGGTCTGTCTGTGG - Intronic
1151596046 17:75078505-75078527 GAACTCAGCTCCTCTGTCTGGGG + Intergenic
1151702998 17:75753291-75753313 GAGCGCAGCTGGTGTGACTCTGG + Intronic
1153248435 18:3096189-3096211 AAACCCAGGTGGTCTGCCTCTGG - Intronic
1155172476 18:23277065-23277087 CAGCTCAGCTGGTCTCACCCAGG + Intronic
1157622203 18:49023139-49023161 GAACCCAGGTGGTCTGTCTCCGG + Intergenic
1160348606 18:78154724-78154746 CATCTCAGCTGCCCTGACTCCGG + Intergenic
1160746978 19:716444-716466 CCACTCAGCTGGCCTCACTCTGG - Intronic
1161768428 19:6219048-6219070 GTACTGAGCTGGTGGGACTCAGG + Intronic
1164632839 19:29773011-29773033 GAAGTCAGCTGCCCTGACGCCGG - Intergenic
1167001462 19:46747625-46747647 GACCTCAGGTGATCTGCCTCAGG + Intronic
1167003260 19:46758229-46758251 GAACCCAGGTGGTCAGGCTCTGG + Exonic
1167306687 19:48713895-48713917 GGGCTCAGCGGCTCTGACTCTGG - Exonic
1167675978 19:50885988-50886010 GAATGCAGGTGGTCAGACTCTGG + Intergenic
927880780 2:26688593-26688615 AACTTCAGCTTGTCTGACTCAGG + Intergenic
928024363 2:27727987-27728009 GAACTCAGGTGATCTGCCTACGG + Intergenic
929089958 2:38205891-38205913 AAACTCAGCTGGTCTATTTCTGG - Intergenic
931249142 2:60514982-60515004 GAACTCAGCCGTTCTCCCTCTGG + Intronic
931631607 2:64306699-64306721 GAACCCAGGTGGTCTGTCTTCGG + Intergenic
936456254 2:112676681-112676703 TAACTCAGCTGGTCCGATCCAGG + Intergenic
937499789 2:122466042-122466064 GATCTCAGGGCGTCTGACTCAGG + Intergenic
937757463 2:125557369-125557391 TAACTCAGAGGATCTGACTCAGG - Intergenic
939008176 2:136813991-136814013 GACCTCAGGTTTTCTGACTCAGG + Intronic
940227032 2:151410513-151410535 GACCTCACCTGGTCAGAGTCAGG - Exonic
940800594 2:158128637-158128659 GAACCCAGCTTGGCTGACTCAGG + Intronic
940879501 2:158932606-158932628 GAATTCAGGCAGTCTGACTCTGG - Intergenic
940896337 2:159084879-159084901 GAACCCAGCCAGTTTGACTCCGG - Intronic
942338173 2:174914039-174914061 GAACCCAGATTGTCTGACTTCGG - Intronic
942660263 2:178256473-178256495 CAACTCAGATGGTCTTCCTCAGG + Intronic
946551888 2:220810775-220810797 GAAGTCAGCTTGACTGGCTCTGG + Intergenic
947519919 2:230837612-230837634 GACCTCAGCTGAGCTCACTCCGG - Intergenic
948719802 2:239892316-239892338 GAACTTAGCAGGGATGACTCAGG - Intergenic
948856636 2:240733295-240733317 GGAGTCAGCTGGCCTGCCTCTGG - Intronic
1168856364 20:1012010-1012032 GAATCCAGGTTGTCTGACTCAGG - Intergenic
1169368476 20:5010233-5010255 GAACTCAGATCTTCAGACTCAGG - Exonic
1169804159 20:9542217-9542239 GACCCCAGCTTTTCTGACTCTGG - Intronic
1170038437 20:12015248-12015270 GAAATCAGCTGGTGGGACTTTGG + Intergenic
1170876958 20:20258940-20258962 AAACTCAGGTGGTCTGGCCCTGG + Intronic
1172547600 20:35773491-35773513 GAATTCAGGAGGTGTGACTCTGG - Intronic
1173284413 20:41657228-41657250 GAACTCAGGCAGTCTGGCTCAGG - Intergenic
1175126149 20:56753137-56753159 GAACCCAGAAAGTCTGACTCTGG - Intergenic
1176418415 21:6494279-6494301 AAATTCAGTTGGTCTCACTCAGG + Intergenic
1178114422 21:29402789-29402811 GAACCCAGGTAGTCTGCCTCCGG + Intronic
1179693908 21:43102601-43102623 AAATTCAGTTGGTCTCACTCAGG + Intronic
1181845298 22:25702906-25702928 GAACCCAGCTTTTCTGACTCTGG + Intronic
1182005425 22:26955684-26955706 ACACTCAGCAGGTGTGACTCTGG + Intergenic
1182033705 22:27181185-27181207 CAACTCAGATGGGCTGATTCTGG + Intergenic
1183194203 22:36342263-36342285 GAACTCAGGATATCTGACTCTGG - Intronic
1183959340 22:41401901-41401923 CCACACAGCTGGTCTGACCCTGG - Intergenic
1184411598 22:44329278-44329300 GCTCTCAGCTGGTCTCACTCTGG + Intergenic
1185040685 22:48502480-48502502 GGACTCTGCTGCTCTGACTTGGG + Intronic
1185201109 22:49506031-49506053 GAGCTCAGAATGTCTGACTCCGG - Intronic
953060445 3:39423873-39423895 GAATTCAGCTGGTCTGGGGCTGG - Intergenic
957235008 3:77575952-77575974 GAACTCAGCTGGGCTGTGTCTGG + Intronic
960384292 3:117002444-117002466 GAATTCAGGCAGTCTGACTCAGG - Intronic
961014959 3:123460628-123460650 GTACACAGCTTGTCTGAGTCAGG + Intergenic
966075539 3:175932753-175932775 GACCTCAGATAGTCTGATTCTGG - Intergenic
966084559 3:176053634-176053656 GAACCTAACTAGTCTGACTCTGG + Intergenic
967856759 3:194123770-194123792 GAACTCAGGCAGTCTGGCTCCGG + Intergenic
968442932 4:633715-633737 GACCCCAGCAGGGCTGACTCCGG + Intronic
971227227 4:24765847-24765869 GAGCTCAGCTGGGCTGTCTTCGG + Intergenic
975241190 4:72061441-72061463 GAACCCAGGTGATCTGGCTCCGG - Intronic
975577819 4:75880351-75880373 GAATCCAGATAGTCTGACTCTGG + Intronic
975591309 4:76002769-76002791 GAACTAAGCTGGACTGAGTGAGG + Exonic
975863507 4:78702611-78702633 GAGCTCAGCAGGTCTAACTCAGG - Intergenic
980822464 4:138035723-138035745 GGACCCAGCTAGTCTGGCTCTGG - Intergenic
981205192 4:142032646-142032668 TGAAACAGCTGGTCTGACTCCGG - Intronic
982605513 4:157512035-157512057 CAACTGAGTTTGTCTGACTCAGG - Intergenic
983332706 4:166351955-166351977 GGAGCCAGTTGGTCTGACTCTGG + Intergenic
984799335 4:183699080-183699102 GACCTCACCTGGTCAGGCTCTGG + Intronic
985129929 4:186728780-186728802 GAATGCAGCTGGTGAGACTCAGG - Intergenic
985922917 5:2993554-2993576 GAACGGAGCTCTTCTGACTCAGG + Intergenic
987075090 5:14373840-14373862 GAACTCAGCTGGGCTGTGCCTGG - Intronic
992258725 5:74948646-74948668 GAACTCAGGTAGTCTTACTGCGG - Intergenic
993707051 5:91183024-91183046 GGACTCAGCTGGTTTGATTTTGG - Intergenic
995072419 5:107940176-107940198 GAACCCAGGAAGTCTGACTCCGG + Intronic
997891872 5:137684092-137684114 GCAGTCAGCTGGCCTCACTCTGG + Intronic
998969518 5:147576208-147576230 GAAGTCAGATGATCTGACCCAGG + Intergenic
999719225 5:154386365-154386387 GAACTCGGCGGGTATGACCCAGG + Exonic
1000045220 5:157516737-157516759 AAACTGAGCTCCTCTGACTCTGG - Intronic
1000132484 5:158313498-158313520 GAACTCTGCAGCTCTGACTAAGG - Intergenic
1000359430 5:160433532-160433554 CAACTCAGCTGGTGTGTGTCTGG + Intergenic
1000459040 5:161489534-161489556 AAACTCAGGTGGTTTGACTAAGG + Intronic
1001295562 5:170496382-170496404 GAACTCAGCTGGTCTGACTCCGG - Intronic
1001811834 5:174634900-174634922 GAGCTCAGGTGTCCTGACTCCGG - Intergenic
1002635034 5:180603092-180603114 GAACTCATCTGGTTGAACTCTGG - Exonic
1003062963 6:2876621-2876643 GAACTCTGGTGCTCTGACTGGGG - Intergenic
1003451478 6:6237600-6237622 AAACTCAGCTGGTTTCACCCTGG + Intronic
1003723160 6:8728759-8728781 GAACTGAGCTGCTCTGGGTCAGG + Intergenic
1003860392 6:10317374-10317396 AAACCCAGCTGCTTTGACTCAGG - Intergenic
1004143624 6:13044802-13044824 GAACTCAGCGGGTGTCAGTCAGG - Intronic
1007772615 6:44203243-44203265 GAACCCAGCTGCACAGACTCTGG + Intergenic
1007783535 6:44267512-44267534 GAACCCAGTTGGTCTGGGTCTGG - Intergenic
1015869990 6:137766513-137766535 GAACCCAGGTGGTCTGGCTCTGG - Intergenic
1016133545 6:140508102-140508124 AAACTCAGGGCGTCTGACTCTGG + Intergenic
1017378964 6:153805194-153805216 GAACTCAGCTGTTGGGAGTCTGG + Intergenic
1017499367 6:155009401-155009423 GAACTCAGATCTTCTGAGTCAGG - Intronic
1018551931 6:165007804-165007826 TATCACAGCTGGTCTGACTCTGG + Intergenic
1018877519 6:167837759-167837781 GAACCCAGATCCTCTGACTCTGG + Intronic
1019630409 7:2046026-2046048 GCACTCAGCTGGTCTTCCCCAGG - Intronic
1019645074 7:2124659-2124681 GAACCCAGCAGGTCTGCCCCTGG - Intronic
1021814546 7:24434499-24434521 GAACCCAGTTTTTCTGACTCTGG + Intergenic
1022740181 7:33112894-33112916 GACCTCAACTGATCTGACTAAGG + Intergenic
1023000021 7:35799208-35799230 GAACTCAGGCAGTCTGACTCCGG + Intergenic
1024593824 7:50915535-50915557 GAACTCAGATGGTCTGAGCATGG - Intergenic
1025105602 7:56169612-56169634 GAAGTCAGCTGGGCTTACTGGGG + Intergenic
1027579631 7:79977516-79977538 GAAGCCAGCTGGGCTGAGTCTGG - Intergenic
1032026089 7:128443881-128443903 GAACAGAGCTGGCCTTACTCTGG - Intergenic
1032495529 7:132358995-132359017 GAGCCCAGGTGGTCTGATTCTGG - Intronic
1033597889 7:142869428-142869450 GTACCCAGCTGTGCTGACTCTGG - Intronic
1034897768 7:154888438-154888460 CAAATCAACAGGTCTGACTCAGG - Intronic
1040479965 8:47816289-47816311 GGACTCAGGTGATCTGTCTCTGG - Intronic
1041207992 8:55517768-55517790 CAGCACAGCTGTTCTGACTCTGG + Intronic
1043245550 8:77995494-77995516 GAACTAAACTGGAATGACTCAGG + Intergenic
1044065657 8:87696769-87696791 GAACTCAGTTTTTGTGACTCAGG - Intergenic
1044873614 8:96643553-96643575 AAACTGAGCTGGCCTGATTCTGG - Intergenic
1047040121 8:120984263-120984285 GAACTCAGCTGGTCTGTTACGGG - Intergenic
1047313646 8:123712893-123712915 GAAATCAGCTGGGGAGACTCTGG + Intronic
1047710151 8:127543558-127543580 GAATTCAGCTGGTCTAACACAGG + Intergenic
1056623718 9:88236808-88236830 GAATTCAACTGCCCTGACTCTGG - Intergenic
1059529171 9:115019855-115019877 GAACTCAGGCAGTCTGCCTCTGG + Intronic
1060296260 9:122345203-122345225 AAACTCAGGTGATCTGACTGTGG + Intergenic
1061356645 9:130110646-130110668 GAACACGGCTGCTCTGGCTCTGG - Intronic
1061468782 9:130805713-130805735 GAAACCAGCTGAACTGACTCTGG - Intronic
1061902334 9:133679297-133679319 GAACTCAGCTGGTCTCTGACTGG + Intronic
1061974031 9:134059418-134059440 GGACTCAGGTGGAGTGACTCGGG + Intronic
1062191697 9:135251166-135251188 GGACTCAGCTGGTCTGATGGTGG + Intergenic
1187437304 X:19284399-19284421 GAACTCAGTTGATCTGATACAGG - Intergenic
1188650653 X:32627606-32627628 GAACTCAGGTAGTTTGGCTCCGG + Intronic
1190528294 X:51349952-51349974 GAACACATCTGGTCAGACACTGG - Intergenic
1191250597 X:58258352-58258374 AAACTCAGCAGGCCTGGCTCAGG - Intergenic
1192170862 X:68853881-68853903 GAACTCAGATAATCTGACTCCGG + Intergenic
1192265256 X:69533289-69533311 GAACTCATATGGTCTGGCTCCGG - Intergenic
1194832777 X:98645515-98645537 GAACTCAGGTCTTCTGACTCTGG + Intergenic
1197267450 X:124390504-124390526 TAGCTCAGTTGGTCGGACTCTGG + Intronic
1198390389 X:136168188-136168210 GAGCTCAGGCAGTCTGACTCTGG + Intronic
1200895419 Y:8370817-8370839 GAACTCAGCAAATCTTACTCTGG + Intergenic