ID: 1001298577

View in Genome Browser
Species Human (GRCh38)
Location 5:170516974-170516996
Sequence GTGGTGTGATGGTGGTGATG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 690
Summary {0: 1, 1: 0, 2: 7, 3: 111, 4: 571}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001298577 Original CRISPR GTGGTGTGATGGTGGTGATG GGG Intronic
900019666 1:180342-180364 GAGGTGTGAGGGTGAGGATGAGG - Intergenic
900551871 1:3260576-3260598 GTGTGATGATGCTGGTGATGAGG + Intronic
900661562 1:3787037-3787059 GAGGCGGGAAGGTGGTGATGGGG - Exonic
900716021 1:4144591-4144613 ATGGTGTGATGGTGGTGGTGTGG - Intergenic
901007040 1:6177011-6177033 GTGCAGTGATGGTGGGGAGGGGG - Intronic
901275858 1:7990403-7990425 GTGTGGTGATGGTGGTGGTGAGG - Intergenic
902076261 1:13789129-13789151 TTGGTGAGATGGATGTGATGTGG - Intronic
902090144 1:13896652-13896674 ATGGTGTGAAGGTGGGCATGCGG - Intergenic
902222951 1:14978401-14978423 GGGATGTGATGGTGGGGAGGAGG + Intronic
902961415 1:19965673-19965695 GTGATGGGATGTGGGTGATGTGG + Intergenic
903221248 1:21870794-21870816 GTGGTGTGAAGTTGGTGTGGTGG - Intronic
903221338 1:21871151-21871173 ATGGTGTGATGGTGTTGTGGGGG - Intronic
903266730 1:22162418-22162440 GAGGTCTGATGGTGCTTATGGGG - Intergenic
903835635 1:26201632-26201654 GAGGGGTGGTGGTGGTGAGGGGG - Intronic
904117913 1:28175930-28175952 AGGTGGTGATGGTGGTGATGGGG - Intronic
904298350 1:29538401-29538423 GGGCTGTGATGGTGGTAATGTGG + Intergenic
904434950 1:30488666-30488688 CAGGTGTGATGGTGATAATGAGG + Intergenic
904532833 1:31180639-31180661 GTGGAGTTGTGGAGGTGATGGGG + Exonic
905502923 1:38453741-38453763 GTGCTGTGATGGGGATGATTTGG + Intergenic
905892767 1:41527633-41527655 GGTGTGTGAGGGTGGGGATGTGG - Intronic
906061382 1:42951204-42951226 GTGGTATGAAGAAGGTGATGGGG + Intronic
906902501 1:49850896-49850918 GTGTTCTGATAGTGGAGATGAGG - Intronic
907519965 1:55016950-55016972 GTGCTGTGAGAGTGGTGATAGGG - Intergenic
907573789 1:55507527-55507549 GGGCTGTGACGGTGGAGATGGGG - Intergenic
907932732 1:59015562-59015584 GGGATGTGCTCGTGGTGATGAGG + Intergenic
908070107 1:60451109-60451131 GGTGTGTGATGTTGGTAATGGGG + Intergenic
909024658 1:70468327-70468349 GTGGGGTGCTGGTGGGGCTGGGG - Intergenic
909404026 1:75266117-75266139 GTGGTGTGATATTTGAGATGTGG - Intronic
910807296 1:91201479-91201501 GTGGGATGAGGGTGGGGATGGGG - Intergenic
913071560 1:115303581-115303603 GTGGTAGGATGTTGGTGGTGAGG - Intronic
913393075 1:118335706-118335728 GTGGTCTCATGGTAGTGGTGAGG - Intergenic
915088051 1:153401767-153401789 GCGGTGAGGTGGTGGTGAAGAGG + Intergenic
915630268 1:157148737-157148759 ATGGTGTGTGGGTGGTGGTGAGG - Intergenic
916704749 1:167337663-167337685 GTGGGGTGAGGGTAGAGATGGGG - Intronic
916712658 1:167425558-167425580 GGTGGATGATGGTGGTGATGGGG - Exonic
917460236 1:175223072-175223094 GTGGAGTGATGGAGCTGAAGTGG - Intergenic
917523289 1:175765632-175765654 TGGTGGTGATGGTGGTGATGTGG + Intergenic
917679684 1:177353205-177353227 GGGGTGTGAGGGCGCTGATGTGG + Intergenic
917694549 1:177508540-177508562 GGGGTGTGTAGGTGGTGATGAGG - Intergenic
918129304 1:181611205-181611227 GTGTGTTGATGGTGGTGATGGGG - Intronic
918269637 1:182885503-182885525 GGGGTGTGATTGTGGTATTGTGG - Intronic
918920296 1:190699954-190699976 TTTGTGTGATGGTGGTATTGTGG - Intergenic
919805404 1:201378356-201378378 GTTGTGTGAGAGGGGTGATGCGG + Intronic
920001989 1:202807228-202807250 GGGCTGTGCTGGTGGGGATGGGG - Intronic
920257142 1:204663285-204663307 GTAGTGCCAGGGTGGTGATGCGG - Intronic
920838552 1:209534590-209534612 GTAGTGTGACGGGGGAGATGTGG + Intergenic
921618062 1:217295488-217295510 GTGTAGTGGTGGTGGTGGTGGGG - Intergenic
922039304 1:221880679-221880701 GTGGTGAGATGGTGATGGTGGGG + Intergenic
922089471 1:222381984-222382006 GTGCTTTGGTGGTGGTGGTGAGG - Intergenic
922763570 1:228146576-228146598 GTTGGGAGTTGGTGGTGATGGGG - Intronic
922882357 1:228990471-228990493 GTGGTAAGGTGGTAGTGATGTGG + Intergenic
922969729 1:229726237-229726259 GTGGTGGTAGGGTGGTGATGGGG - Intergenic
923018791 1:230147109-230147131 CTGGTGAGATGTTGGGGATGAGG + Intronic
923596047 1:235361480-235361502 GTGATGTGTTGGGGGTGATGTGG - Intergenic
924619305 1:245646930-245646952 TTGGGGTGATGGTGGTGGAGTGG - Intronic
1062830764 10:603994-604016 GTGGTGTTGTGGGGCTGATGAGG - Intronic
1063220119 10:3959546-3959568 GTCGTGGGAAGGTGGAGATGTGG - Intergenic
1063648934 10:7914159-7914181 TAGGTGTGATGATGGCGATGTGG + Intronic
1064216525 10:13405256-13405278 GTGGTGTGATTGTAGTGAAGCGG - Intergenic
1065605204 10:27411557-27411579 TGGGGGTGGTGGTGGTGATGGGG + Intronic
1065808469 10:29418524-29418546 ATGGGGGGCTGGTGGTGATGGGG - Intergenic
1066315547 10:34242450-34242472 GGGGTGTGGTGCTGGGGATGAGG - Intronic
1067251773 10:44592823-44592845 GGGATGTGATGGTGGGGATGAGG + Intergenic
1067342762 10:45418485-45418507 GGTGTGTGATGGTGGAGACGCGG - Intronic
1067345090 10:45432030-45432052 GGGGTGTGGTGGTGGTGAAGAGG + Intronic
1067411527 10:46069013-46069035 GTGATGTGCTGGTGATGTTGAGG + Intergenic
1067659359 10:48222822-48222844 GTTGTGTGTTGGGGGTGAGGGGG + Intronic
1069285864 10:66714633-66714655 GTGATGTGATGCTGCTGATACGG - Intronic
1069619262 10:69826414-69826436 GTGGTGGCATGGGGGTGATGTGG + Intronic
1070408513 10:76117823-76117845 GTAGTGTGGTGGTGGTGAAGTGG + Intronic
1070531973 10:77344862-77344884 TTGGTGTGGTGTTGGGGATGTGG - Intronic
1070594545 10:77823158-77823180 GAGTGGGGATGGTGGTGATGGGG + Intronic
1071602696 10:86966616-86966638 GTGATGTGATGGGGATGTTGAGG + Intronic
1072445826 10:95497730-95497752 GTGGGGTGGTGGTGATGGTGAGG - Intronic
1073722484 10:106188977-106188999 GTGGTGGGGTGGTGGTGGTGGGG - Intergenic
1073865559 10:107800459-107800481 GTGGTGTCATGGTGGAGAAGAGG - Intergenic
1073904912 10:108267363-108267385 TGGGTGTGATGGTGGGGGTGGGG - Intergenic
1074117292 10:110465973-110465995 GTGGTGAGAGGTTGGTGATGGGG + Intergenic
1074293393 10:112158868-112158890 GTGGTGGGATGGAAGGGATGAGG - Intronic
1074309966 10:112313641-112313663 GCCGGGTGGTGGTGGTGATGAGG - Intergenic
1074410662 10:113225728-113225750 GTGGTGTGAGGGTGGAGTGGAGG + Intergenic
1074970575 10:118533162-118533184 GTGGTGGGATGGTGGTTAGAGGG + Intergenic
1075527487 10:123198816-123198838 GAGGTGTGTGGGTGGTGAGGAGG + Intergenic
1075904535 10:126069619-126069641 CTGATGTGATGGTGGTGGTGGGG + Intronic
1076372002 10:129961364-129961386 GTGGTGTGTTGTTGTTGATTTGG - Intronic
1077190296 11:1253147-1253169 GGGGTGTGGTGGTGGTGTTTGGG + Intronic
1078591109 11:12641186-12641208 GGGATGTGGTGGTGGTGCTGGGG - Intergenic
1078591116 11:12641207-12641229 GGGATGTGGTGGTGGTGGTGGGG - Intergenic
1078715888 11:13838556-13838578 GAGGAGTGGGGGTGGTGATGAGG - Intergenic
1079103684 11:17557348-17557370 GAGGGGTGTTGGTGGGGATGGGG + Intronic
1079441013 11:20514987-20515009 GTGGTGTGATGATGCTGACAAGG - Intergenic
1079635527 11:22735070-22735092 GTTATGTGGTGGTGGTGATAGGG - Intronic
1080600345 11:33816411-33816433 GTGGAATGATGAGGGTGATGGGG + Intergenic
1080818547 11:35782691-35782713 CTGGTTTGGTGGTGGTGGTGGGG - Intronic
1081275319 11:41141241-41141263 TTTGTGTGGTGGTGGTGATTCGG - Intronic
1081656550 11:44861395-44861417 GTGGGGTGCGGGTGGTGCTGAGG + Intronic
1083298642 11:61728620-61728642 TTGGTGTGCTGGTGGGGATGTGG - Intronic
1083995446 11:66269324-66269346 GGGGTGTGACGGTGGCGTTGGGG - Intronic
1084182549 11:67454146-67454168 GTGGTGGGATGGTGAGGGTGAGG + Intronic
1084832471 11:71780414-71780436 GTGGTCTCATGGTGGGGAGGAGG + Intergenic
1084944710 11:72632399-72632421 GTGGTGTGATGGTCTAGGTGTGG + Intronic
1085279607 11:75321268-75321290 GTGGGGGGATGGTGGTGGGGGGG - Intronic
1085766883 11:79291092-79291114 GTGGAGTGGTGATGGTGGTGGGG + Intronic
1086932202 11:92705442-92705464 GTGGTGTGATGGTGGTGTGATGG + Intronic
1086932207 11:92705470-92705492 GTGGTGTGATAGTGGTGTGATGG + Intronic
1086932243 11:92705647-92705669 GTGGTGTGATGGTGGTGTGATGG + Intronic
1088774977 11:113073744-113073766 GTGGTGTGGAGGTGGTGGTGGGG + Intronic
1088778849 11:113114109-113114131 GTGATTTGATGGTGGTTTTGTGG + Intronic
1089309628 11:117549122-117549144 GGAGTGGGAAGGTGGTGATGGGG - Intronic
1089360224 11:117880644-117880666 TTGGAGTGATGAGGGTGATGGGG - Intergenic
1089584260 11:119500187-119500209 GTTGGATGATGGTGGTGGTGAGG - Intergenic
1089691318 11:120188481-120188503 GTGGTGGGCTGGTGGTGGTGGGG - Intergenic
1089777927 11:120851898-120851920 CTGGTGGGATGGTGGAGCTGGGG + Intronic
1090090418 11:123692060-123692082 ACAGTGTGACGGTGGTGATGGGG + Intergenic
1090144911 11:124311244-124311266 CTGGAGTGATGGTGGGCATGGGG + Intergenic
1091544884 12:1495086-1495108 GTCGGGTGAGGGTGGTTATGGGG - Exonic
1091679344 12:2515643-2515665 GTGGTGTGAGGCTGGGGAGGTGG + Intronic
1091738226 12:2940870-2940892 GGGGGGTGGTGGTGGTGACGAGG - Exonic
1092068883 12:5616405-5616427 GTGGTGTATGGGAGGTGATGAGG - Intronic
1092203982 12:6604576-6604598 GTGGTGAGATGTAGCTGATGGGG - Intronic
1092258361 12:6939108-6939130 TGGGAGTGCTGGTGGTGATGGGG - Exonic
1093931857 12:24961699-24961721 CTGGGGTGGTGGTGGTCATGGGG + Intergenic
1094476502 12:30844639-30844661 GTGGTGGGGAGGTGGTGGTGTGG - Intergenic
1094783291 12:33818018-33818040 GTGGTGGCATGGTGGTGGTGGGG + Intergenic
1095092318 12:38118770-38118792 GTGGTATGATGGTGATAGTGAGG + Intergenic
1095261190 12:40101700-40101722 GATGAGTGAGGGTGGTGATGAGG - Intronic
1095277151 12:40299824-40299846 GTGGGGTGGTGGTGGTGGTGAGG + Intronic
1096250158 12:50025944-50025966 GTGGAGTGCTTGTGATGATGTGG - Intronic
1096532334 12:52249752-52249774 CAGGGGTGATGGTGGTGGTGTGG + Intronic
1096938837 12:55318260-55318282 GTGTGGTGGTGGTGGTTATGAGG + Intergenic
1097489076 12:60241793-60241815 GTGGAGTGAAGGTGGTCTTGGGG - Intergenic
1098649022 12:72941166-72941188 CTGGGGTGGTGGTGGTCATGAGG - Intergenic
1099169782 12:79349704-79349726 TTGGTGGGATTATGGTGATGGGG - Intronic
1099205715 12:79723955-79723977 GTGGTGGGGGGGTGGTGTTGGGG - Intergenic
1099812577 12:87603780-87603802 ATGGTCAGATGGTGGTGATAGGG + Intergenic
1100533608 12:95483790-95483812 GTGGTGCCATGGTGGTGGTAGGG + Intronic
1100785319 12:98072217-98072239 GGGGCCTGATGGTGGGGATGAGG + Intergenic
1101245998 12:102885049-102885071 AAGGTGTGGTGGTGGTGAAGGGG + Intronic
1101937788 12:109072236-109072258 GTGGGGTGAGGGTGGTGAAAGGG + Intronic
1103443725 12:120980679-120980701 TTGGTGGGATGGTGGGGTTGGGG + Intronic
1103772462 12:123338720-123338742 TGGGTGTGGTGGTGGTGGTGGGG + Intronic
1103858504 12:123992223-123992245 GTGGTCTGAGGGTGGAGACGAGG + Intronic
1104050527 12:125190894-125190916 AAGGGGTGGTGGTGGTGATGGGG + Intronic
1104383196 12:128326251-128326273 ATGGAGTGATGGTGGTGGGGAGG - Intronic
1104586891 12:130054778-130054800 GTGTGGTGGTGGTGGTGGTGTGG - Intergenic
1104657472 12:130584195-130584217 GTGAGGTGATGGTGGTGATAAGG - Intronic
1104657475 12:130584212-130584234 GTGAAGTGATGGTGGTGGTGAGG - Intronic
1104657498 12:130584330-130584352 GTGAGGTGATGGTGGTGATGAGG - Intronic
1104657517 12:130584430-130584452 ATGAGGTGATGGTGGTGATGAGG - Intronic
1104657531 12:130584507-130584529 ATGAGGTGATGGTGGTGATGAGG - Intronic
1104657534 12:130584524-130584546 TGGTGGTGATGGTGGTGATGAGG - Intronic
1104657541 12:130584564-130584586 GTGATGTAATGGTGGTGATGAGG - Intronic
1104657549 12:130584638-130584660 GTGATGAGGTGATGGTGATGAGG - Intronic
1104657551 12:130584652-130584674 ATGATGTAATGGTTGTGATGAGG - Intronic
1104683013 12:130764417-130764439 ATGATGTCATGGTGCTGATGTGG + Intergenic
1104728782 12:131093881-131093903 GTGGAGCTGTGGTGGTGATGAGG + Intronic
1105864600 13:24448061-24448083 GTGGTGTGGGTGTGGTGGTGTGG + Intronic
1107274493 13:38662905-38662927 CTTGAGTGATGGTGGGGATGGGG - Intergenic
1110548249 13:76781174-76781196 GGGTGGTGATGGTGGTGGTGGGG - Intergenic
1112323861 13:98430488-98430510 CTGGAGTCATGGTGGGGATGGGG - Intronic
1113756000 13:112811363-112811385 GGCGTGGGATGCTGGTGATGGGG - Intronic
1113844123 13:113376137-113376159 GGGGTCTGATGAGGGTGATGGGG + Intergenic
1113916801 13:113878826-113878848 GGTGTGTGATGGTGGTTTTGTGG - Intergenic
1114186355 14:20405423-20405445 GAGGTGTGAAGGAGGGGATGGGG - Intronic
1115814863 14:37153080-37153102 ATGATCTGATGGTGGGGATGTGG - Intronic
1115868851 14:37778145-37778167 GTGGTGTGCTGGTGGGCATAGGG + Intronic
1117083654 14:52177644-52177666 AGGTTGTGGTGGTGGTGATGGGG - Intergenic
1117374803 14:55110557-55110579 GTGGTCTGATGGAGGTGAACTGG - Intergenic
1117556633 14:56893056-56893078 GTGGGGAGAGGGTAGTGATGAGG - Intergenic
1118003376 14:61543986-61544008 GTGTTGTGGTGGTGGTGGGGTGG - Intronic
1118176326 14:63443753-63443775 GTGGTGTGGTGCTGCTGTTGGGG - Intronic
1118251868 14:64169590-64169612 GAGGTGTATGGGTGGTGATGTGG - Intronic
1118348031 14:64953924-64953946 GTGGAGTGGCAGTGGTGATGGGG - Intronic
1118764173 14:68899108-68899130 GTGGTGTGGTTGTGGTGTGGAGG - Intronic
1119206062 14:72794435-72794457 CTGGTGAGATGGTGGTGGTGGGG - Intronic
1119764628 14:77180810-77180832 GTGCTGTGCTGCTGGTTATGGGG + Intronic
1119971451 14:78975256-78975278 GTAGGGTCATGGTGGTCATGGGG + Intronic
1120289867 14:82554115-82554137 TTGTTGTGATGGTGGTCATGAGG - Intergenic
1121339251 14:93095171-93095193 GTGGTATGTAGGTGGTGCTGTGG - Intronic
1122769991 14:104093634-104093656 GTGGTGTGTGGGTGGGGCTGAGG + Intronic
1122770003 14:104093672-104093694 GTGGTGTGTGGGTGGGGCTGTGG + Intronic
1122898178 14:104770754-104770776 GTGGTGTGATGGTGATCATCTGG + Exonic
1122921210 14:104881028-104881050 GTGGTGAGAGGCAGGTGATGGGG + Intronic
1202853418 14_GL000225v1_random:36068-36090 GTGTGGTGATGGCGGTGGTGGGG - Intergenic
1202858440 14_GL000225v1_random:65212-65234 GCGTGGTGATGGTGGTGGTGGGG + Intergenic
1202859735 14_GL000225v1_random:73490-73512 GTGTGGTGATGGTGGCGATCAGG + Intergenic
1202863529 14_GL000225v1_random:100440-100462 GCGTGGTGATGGTGGTGGTGGGG + Intergenic
1202865360 14_GL000225v1_random:113900-113922 GTGTGGTGATGGTGGTGGTGGGG + Intergenic
1202921737 14_KI270723v1_random:34376-34398 GCGTGGTGATGGTGGTGGTGGGG - Intergenic
1202923178 14_KI270724v1_random:3205-3227 GCGTGGTGATGGTGGTCATGGGG + Intergenic
1123998108 15:25733156-25733178 GTGGTGTGAAGGAGGTTACGGGG + Intronic
1124721055 15:32110995-32111017 GTGGGGTGGTGCTGGTTATGTGG + Intronic
1125844559 15:42839582-42839604 CTGGTGAGATGGTGGTGAAAAGG - Intronic
1126144288 15:45462182-45462204 TGGTGGTGATGGTGGTGATGTGG - Intergenic
1126144311 15:45462275-45462297 TGGTGGTGATGGTGGTGATGTGG - Intergenic
1126144375 15:45462539-45462561 TGGTGGTGATGGTGGTGATGTGG - Intergenic
1126144398 15:45462632-45462654 TGGTGGTGATGGTGGTGATGTGG - Intergenic
1126537058 15:49777981-49778003 GTGGGGAGATGTTGGTAATGGGG - Intergenic
1127256550 15:57298322-57298344 GTGGGCTGGTGGTGGTGATGGGG - Intronic
1128148189 15:65344389-65344411 GTGGTGAGCTGGTGGTAGTGAGG - Intronic
1129245108 15:74274534-74274556 GTAGAGTGATGGTGGTGGGGAGG + Intronic
1129246864 15:74284466-74284488 TTGCAGTGAAGGTGGTGATGAGG - Intronic
1129481305 15:75828589-75828611 GTGGTGAGATGGGGAGGATGTGG + Intergenic
1129766447 15:78172359-78172381 ATGCTTTGATGGTTGTGATGGGG + Intronic
1129969983 15:79769605-79769627 GTGGTGTGATTTTGGTGATCTGG - Intergenic
1130051123 15:80484795-80484817 GAGGAGTGGTGGTGGGGATGGGG + Intronic
1131380847 15:91962716-91962738 CTGGTGTGCTGCTGGGGATGGGG - Intronic
1131672891 15:94639284-94639306 GTGGTGGGATGGGGGTAAGGAGG + Intergenic
1132673905 16:1113911-1113933 GTGGAGTGAGGGTGGTGAGTGGG - Intergenic
1132673926 16:1113980-1114002 GTGGAGTGAGGGTGGTGAGTGGG - Intergenic
1132673944 16:1114036-1114058 GTGGGGTGAGGGTGGTGAGTGGG - Intergenic
1132673963 16:1114092-1114114 GTGGAGTGAGGGTGGTGAGTGGG - Intergenic
1133147637 16:3801715-3801737 ATGGTGTGATGCTGGTAATCGGG + Intronic
1133888239 16:9852407-9852429 ATGGTGTGGGGGTTGTGATGTGG - Intronic
1134176096 16:12007689-12007711 GCTGTGAGATGCTGGTGATGGGG - Intronic
1134614777 16:15642895-15642917 CTGGTGGGATGGTGGTGGAGAGG - Intronic
1134663042 16:15998472-15998494 GGGCTGTGATGGAGGTGATGTGG + Intronic
1135042388 16:19127838-19127860 GGGTGGTGATGGTGGTGCTGGGG + Intronic
1135386070 16:22041473-22041495 GTTGGGGGTTGGTGGTGATGAGG - Intronic
1135610177 16:23859528-23859550 GTGCTGTAATGGTGGAGAGGGGG + Intronic
1135618732 16:23934707-23934729 TTACTGGGATGGTGGTGATGGGG + Intronic
1135704795 16:24665896-24665918 GTGAGGTGTTGGTGGTGGTGCGG + Intergenic
1135757839 16:25112501-25112523 AGGGTGTGGTGGTGGGGATGGGG + Intronic
1135940424 16:26817384-26817406 GTGGTGTGATGGCTGAGAGGGGG - Intergenic
1136612736 16:31377109-31377131 GGGGTGTGAGGCTGGAGATGAGG - Intronic
1139261923 16:65602480-65602502 GGGTAGTGGTGGTGGTGATGGGG - Intergenic
1139308789 16:66010880-66010902 GTGGTGGGATGCTGGGTATGTGG - Intergenic
1139395292 16:66633962-66633984 GTGGTTGGGTGTTGGTGATGTGG - Intronic
1140123697 16:72103887-72103909 GGGGTGTGCTGGTGGTGAGCCGG + Intronic
1140441578 16:74991989-74992011 GTGGGGTGATAGGGGTGCTGGGG + Intronic
1140941094 16:79722704-79722726 TGGTGGTGATGGTGGTGATGAGG + Intergenic
1141364006 16:83425511-83425533 GGGGAGTTATGGTGGAGATGCGG - Intronic
1141871237 16:86788237-86788259 GTGGGGTGATGGGAGTGTTGTGG - Intergenic
1141947685 16:87321861-87321883 GTGTGGTGGTGGTGGTGATGGGG - Intronic
1142443987 16:90122128-90122150 GAGGTGTGAGGGTGAGGATGAGG + Intergenic
1143173612 17:4944319-4944341 GAGGTGTGAGGGTGGAGATAGGG - Intronic
1143332658 17:6149024-6149046 GTGGTGTCATCATGGAGATGCGG - Intergenic
1143456151 17:7069423-7069445 GTGGTGTGGTGGTAATGGTGAGG - Intergenic
1143608027 17:8002416-8002438 GTGCAGGGGTGGTGGTGATGAGG + Intergenic
1143917208 17:10302789-10302811 GTGGTGGGATGGTGGGAATTAGG + Intronic
1146199690 17:30846134-30846156 TTGTGGTGATGGTGGTGGTGGGG - Intronic
1147422130 17:40327107-40327129 GTGGTGGGCTGGGGGTGAGGTGG + Intronic
1147629520 17:41920734-41920756 GAGATTTGATGGTGGTGGTGGGG - Intronic
1147743473 17:42681619-42681641 GTGGTGTGAGGCTGGGGTTGTGG - Intronic
1148439024 17:47702313-47702335 GGGGTGTGATTGGGGTGAGGAGG + Intronic
1148552018 17:48556059-48556081 GGAAGGTGATGGTGGTGATGGGG + Intronic
1149468387 17:56897381-56897403 GTGGTGTGATGGGGGTCTGGGGG - Intronic
1149503744 17:57175542-57175564 TTGGTGTGGTGGTGGTGATGGGG - Intergenic
1149981988 17:61318115-61318137 CTGGTGTGATGGTGGCGGGGAGG - Intronic
1150265529 17:63830203-63830225 GTGAGGTGGTGGTGGTGGTGGGG + Intronic
1150479802 17:65500187-65500209 GTGGTGTTATGGTGGTGGTATGG + Intergenic
1150834202 17:68550067-68550089 ACGGGTTGATGGTGGTGATGGGG + Intronic
1151186371 17:72367148-72367170 GGGGTTTGATGGTTGTCATGAGG - Intergenic
1151276202 17:73036337-73036359 GTGGTGTGATGTTGATAGTGGGG - Intronic
1151585692 17:75007046-75007068 CTGGTGTAATCTTGGTGATGGGG - Intergenic
1151976107 17:77484282-77484304 GTGGGATGGTAGTGGTGATGTGG + Intronic
1151976171 17:77484602-77484624 TGGTGGTGATGGTGGTGATGGGG + Intronic
1151976182 17:77484659-77484681 TGATTGTGATGGTGGTGATGTGG + Intronic
1151976189 17:77484692-77484714 TGATTGTGATGGTGGTGATGTGG + Intronic
1151976201 17:77484746-77484768 TGGTTGTGATGGTGGTGATGTGG + Intronic
1151976208 17:77484779-77484801 TGATTGTGATGGTGGTGATGTGG + Intronic
1151976220 17:77484836-77484858 TGGTTGTGATGGTGGTGATGTGG + Intronic
1151976328 17:77485359-77485381 GTGGGATGGTAGTGGTGATGTGG + Intronic
1152279025 17:79374334-79374356 CTGGTGTGTGGGTGGTGGTGCGG + Intronic
1152855885 17:82664291-82664313 GTGCTGTGCTGATGGTGGTGGGG + Intronic
1152902301 17:82949792-82949814 GTGGTGGGATGGTGGTTTTATGG + Intronic
1153113257 18:1619971-1619993 GTACGGTGATGGTGGTGATAGGG - Intergenic
1153387136 18:4510788-4510810 GTGGTGGTGTGGTGGTGGTGTGG + Intergenic
1153387137 18:4510791-4510813 GTGGTGTGGTGGTGGTGTGGTGG + Intergenic
1153387140 18:4510802-4510824 GTGGTGTGGTGGTGGTGGTGTGG + Intergenic
1153387144 18:4510816-4510838 GTGGTGTGGTGGTGGTGGTGTGG + Intergenic
1153387155 18:4510864-4510886 GTGGTGGTGTGGTGGTGGTGTGG + Intergenic
1153387156 18:4510867-4510889 GTGGTGTGGTGGTGGTGTGGTGG + Intergenic
1153387158 18:4510875-4510897 GTGGTGGTGTGGTGGTGGTGTGG + Intergenic
1153387159 18:4510878-4510900 GTGGTGTGGTGGTGGTGTGGTGG + Intergenic
1153387170 18:4510928-4510950 GTGGTGTGGTGGTAGTGTGGTGG + Intergenic
1153387191 18:4511016-4511038 GTGGTGTGGTGGTGAGGGTGGGG + Intergenic
1154272357 18:12931223-12931245 GTGATGTGATTGGAGTGATGCGG - Intergenic
1154430372 18:14303840-14303862 TTGGGGTGATTGTGGTGGTGGGG + Intergenic
1155623383 18:27807188-27807210 CTGGTGTGATGGAGTTGAGGTGG - Intergenic
1155656774 18:28201988-28202010 GTAGTATAATGGTGGTGCTGCGG - Intergenic
1156265124 18:35480988-35481010 GTGGTGTCATGGAGATTATGAGG - Intronic
1156598736 18:38578755-38578777 GTTGTGTGATGGTTGTGGGGTGG - Intergenic
1156621636 18:38858190-38858212 ATTGTTGGATGGTGGTGATGAGG - Intergenic
1157540907 18:48505814-48505836 GTGGTGGGAGGGTGGGGAAGGGG - Intergenic
1157869851 18:51219939-51219961 ATGGTGTGATGGTGGTGGGTGGG + Intergenic
1158742519 18:60159699-60159721 GTGGAGTGGTGGTGGCGACGGGG + Intergenic
1159225174 18:65523843-65523865 ATGGAGTGATGGTGGCCATGGGG + Intergenic
1161143124 19:2660596-2660618 GTGGTGGGGTGTTGGTGGTGGGG - Intronic
1161568994 19:5019772-5019794 GTGGTGTGCAGGTGCTGGTGTGG + Intronic
1161757321 19:6143724-6143746 CTGGGGAGATGGGGGTGATGAGG - Intronic
1163246709 19:16100126-16100148 GTGGTGTGGGGGTTATGATGAGG - Intronic
1163628630 19:18405061-18405083 GTTGGGTGAATGTGGTGATGGGG - Intergenic
1163762931 19:19146825-19146847 GTGGTGTCTTGCTGGTGAGGTGG + Exonic
1163838490 19:19591273-19591295 GGGGTGTCATGGTGCTCATGGGG - Intronic
1164258986 19:23552906-23552928 GTTGTGTGGTGGTGGGGATTGGG - Intronic
1164799262 19:31062477-31062499 GAGGTGGGATGGTGGGGAGGGGG + Intergenic
1164918801 19:32073157-32073179 GTGGAGTGAAAGTGGGGATGGGG - Intergenic
1165467343 19:35982818-35982840 GTGGTGTGGGGATGGTGAGGTGG - Intergenic
1166671641 19:44713553-44713575 GTGGGGTGAAGGTGGTAATATGG - Intergenic
1166988887 19:46678714-46678736 GTGGTGTGGTGGGGATGCTGGGG - Intronic
1167116176 19:47490414-47490436 GTGGTGTGATGTGTGTGGTGTGG + Intronic
1167116178 19:47490433-47490455 GTGGTGTGATGTGTGTGGTGTGG + Intronic
1167116183 19:47490486-47490508 GTGGTGTGATGTGTGTGGTGTGG + Intronic
1167563619 19:50241931-50241953 GCGGTGTGGTGGTGGTGGTACGG - Intronic
1168254212 19:55157155-55157177 GTGGGGTCTTGGTGGTGATGGGG - Intronic
925267128 2:2574065-2574087 ATGGTGACATCGTGGTGATGTGG + Intergenic
925267130 2:2574084-2574106 GTGGTGACGTCGTGGTGATGTGG + Intergenic
925267140 2:2574187-2574209 GTGGTGACGTCGTGGTGATGTGG + Intergenic
926112172 2:10190394-10190416 TGGTGGTGATGGTGGTGATGGGG + Intronic
926337632 2:11876185-11876207 GTGGTGTGGAGGTGGTGAGTAGG + Intergenic
926680024 2:15655898-15655920 GTGGAGTGATTGGGGTGAGGAGG + Intergenic
927478932 2:23435079-23435101 TGGGTGTGATGGGGGTGAGGAGG + Intronic
928460334 2:31466519-31466541 CTGGTATGATGGGGGTGGTGAGG - Intergenic
928490543 2:31778457-31778479 GTGGGGTGCTGGTGGAGGTGGGG - Intergenic
928885068 2:36138871-36138893 GTGGTGTGGTGGTGGTGGGCGGG - Intergenic
929446898 2:42009058-42009080 GTGGTGTGATGGTGGTGGGTTGG + Intergenic
929651284 2:43682168-43682190 TTGGTGTGATGATGGTATTGTGG - Intronic
929966630 2:46542107-46542129 GTGGGGTGGTGGTGGTGGGGGGG + Intronic
930004904 2:46888883-46888905 GAGAGGTGATGGTGGTGCTGTGG - Intergenic
930056039 2:47252744-47252766 GTGGTGTTAGGGTGGTGGTGGGG + Intergenic
930662015 2:54063940-54063962 GGGGTGAGATGGTGTTGAAGGGG + Intronic
930694465 2:54397250-54397272 GTGGTCTTCTGTTGGTGATGGGG + Intergenic
931064457 2:58569926-58569948 GTGCGGTGGTGGTGGTGGTGGGG + Intergenic
931847073 2:66214887-66214909 GTGGTGTGTTGATGGAGGTGAGG - Intergenic
931907175 2:66854958-66854980 GTGGGGTCATGGTGGAAATGAGG - Intergenic
932012486 2:67992476-67992498 ATGGGCTGATGGTGGTGTTGGGG - Intergenic
932187869 2:69714224-69714246 GTGGGGTAAGGGTGGAGATGTGG + Intronic
932614324 2:73222466-73222488 GAGATTTGATGGTGGTGGTGTGG + Intronic
933296495 2:80497016-80497038 GTGGGGAGATGGTTGTGTTGAGG + Intronic
934527321 2:95059801-95059823 GTGGCACGATGGTGGTGATGAGG + Intergenic
935563641 2:104584303-104584325 GTGGTTTGGTGGTGGGGGTGGGG + Intergenic
936171419 2:110180091-110180113 GTGGAGTGAGGGTTGTTATGAGG - Intronic
936419108 2:112346812-112346834 GTGGTGTGATGGTGGTGCGATGG - Intergenic
936484361 2:112913888-112913910 GAGGTGCGAGGGTGGGGATGGGG + Intronic
937668809 2:124517260-124517282 GAGGTGTGGTGGTGGTGATGAGG + Intronic
938398362 2:130967022-130967044 GTGGTGTGATTTTTGTGGTGGGG + Intronic
938537101 2:132256306-132256328 GTGGTGGGAGGGGGGTGGTGGGG + Intronic
939864832 2:147461052-147461074 GTCTTTTGATGGTGGTGGTGTGG - Intergenic
940003865 2:148993917-148993939 GTGGTGGGGTGGTGATGGTGGGG + Intronic
940014729 2:149092172-149092194 TGGTTGTGATTGTGGTGATGGGG + Intronic
943049210 2:182895036-182895058 TTGGTGTGGTGGTGGTGGTTGGG - Intergenic
943210795 2:184963577-184963599 GTGGTGTTAAGGTGTTGAGGAGG + Intergenic
945160235 2:206883027-206883049 TTGGTGTGATGGTGAGGATCAGG + Intergenic
945276233 2:207990138-207990160 GTGGGGTGAAAGTGGTGATAGGG - Intronic
945976323 2:216273904-216273926 GTGGTGGGAGAGGGGTGATGGGG + Intronic
946079973 2:217109476-217109498 GGGGAGTGGAGGTGGTGATGGGG + Intergenic
947805111 2:232961131-232961153 GATGTGGGATGGTGCTGATGTGG - Intronic
947993697 2:234508904-234508926 GTGGTCTCCTGATGGTGATGGGG + Intergenic
948110954 2:235455640-235455662 CTTGTCTGATGGTGGTGGTGGGG - Intergenic
948871036 2:240798247-240798269 TTGGTGTGAAGGGTGTGATGGGG - Intronic
1168795487 20:608187-608209 GTGGTCTGATGGTGGGGGAGGGG - Intronic
1169757829 20:9062345-9062367 GTGTGGTGGTGGTGGTGGTGGGG + Intergenic
1170034000 20:11970985-11971007 GAGAGGTGATGGTGGTGAGGGGG + Intergenic
1170095675 20:12643309-12643331 GTTATTTAATGGTGGTGATGAGG - Intergenic
1170365581 20:15594544-15594566 TTGGTGGGAATGTGGTGATGGGG - Intronic
1171866014 20:30488085-30488107 GTGGTGGGAGGGGGGTGGTGGGG + Intergenic
1172125126 20:32621134-32621156 GGGGTGGGATGGTGGGGAGGAGG + Intergenic
1172532203 20:35639883-35639905 GTGGTGTAATGGTAATGATTAGG - Intronic
1173521701 20:43704827-43704849 GTAGTGTGCTGGTGGCGGTGGGG - Intronic
1173597012 20:44265069-44265091 GTTGTGTAAGGGAGGTGATGGGG - Intronic
1173723354 20:45279287-45279309 GTGATGAGAAGGTGGTGGTGGGG - Intergenic
1174194044 20:48760424-48760446 GGGGTGCGCTGGTGGTGATGAGG - Intronic
1174435610 20:50504729-50504751 GAGATGTGATGGTGGTGATTGGG - Intergenic
1174691408 20:52510254-52510276 GGGGTGTGGGGGTGGTGAGGAGG - Intergenic
1174767728 20:53269568-53269590 ATGATATGATGATGGTGATGAGG + Intronic
1175022520 20:55865704-55865726 GTGCAGAGATTGTGGTGATGTGG + Intergenic
1175420673 20:58830516-58830538 ATGGTATGATGGTGGTGTGGTGG - Intergenic
1175491589 20:59384052-59384074 GTGGGGGGAAGGAGGTGATGGGG + Intergenic
1175533041 20:59687316-59687338 ACGGTGTGATGGTGGTAATGAGG + Intronic
1175733693 20:61371203-61371225 GTGCAGTGCTGGCGGTGATGGGG + Intronic
1175914715 20:62420235-62420257 GTGCTGTGACAGTGGTGTTGGGG - Intronic
1177371280 21:20206947-20206969 GATGGGTGATGGTGGTGATGAGG - Intergenic
1177424482 21:20904843-20904865 GTAGTGTAATGGTGGGGATTGGG - Intergenic
1179065678 21:38022578-38022600 GGGCTGTGGGGGTGGTGATGGGG + Intronic
1179227211 21:39464839-39464861 TAGGGGGGATGGTGGTGATGAGG + Intronic
1179297779 21:40078864-40078886 CTAGTGTGAAGGAGGTGATGGGG + Exonic
1179508822 21:41858945-41858967 GTGGGGTGGTTGTGGTGTTGTGG - Intronic
1179519283 21:41931831-41931853 GTGGTGGGATGTTGGAGGTGGGG - Intronic
1179519297 21:41931875-41931897 GTGGTGGGATGCTGGAGGTGGGG - Intronic
1179519305 21:41931897-41931919 GTGGTGGGATGCTGGAGGTGGGG - Intronic
1179519313 21:41931919-41931941 GTGGTGGGATGCTGGAGGTGGGG - Intronic
1179519321 21:41931941-41931963 GTGGTGGGATGCTGGAGGTGGGG - Intronic
1179519345 21:41932007-41932029 GTGGTGGGATGCTGGAGGTGGGG - Intronic
1179519360 21:41932051-41932073 GTGGTGGGATGCTGGAGGTGGGG - Intronic
1180312723 22:11252959-11252981 GTGGTGGGAGGGGGGTGGTGGGG + Intergenic
1180971610 22:19819029-19819051 GTGGTCTTGTGGAGGTGATGGGG - Intronic
1181054122 22:20252007-20252029 GTGATGGGATGATGGTGATGAGG - Intronic
1181509096 22:23380994-23381016 GTGGTGTGGAAGCGGTGATGGGG + Intergenic
1183698291 22:39435666-39435688 GTGATGTCAGGGTGGTGGTGGGG - Intronic
1183953027 22:41362745-41362767 ATGATGTGATGGGGGTGACGGGG + Intergenic
1184277718 22:43419682-43419704 GTGGTGTGACCATGGTGATGGGG + Intronic
1184286645 22:43475661-43475683 GTGATGTGGTGATGGTGATGTGG + Intronic
1184286670 22:43475808-43475830 GTGGTGTGATGATGATATTGAGG + Intronic
1184286685 22:43475941-43475963 ATGATGTGATGATGGTAATGAGG + Intronic
1184898683 22:47429647-47429669 GAGGTGGGATGGTGGCCATGAGG + Intergenic
1185032890 22:48454000-48454022 GAGGTCTGACTGTGGTGATGAGG - Intergenic
949090894 3:27798-27820 GGGGTGGGAGGGTGGTGGTGAGG - Intergenic
949528330 3:4928410-4928432 GTGGGGTGGTGGTAGTGGTGAGG + Intergenic
949543949 3:5055916-5055938 GGGGTGTGGCGGTGGAGATGGGG + Intergenic
949570193 3:5285228-5285250 GAGGTGAGATGGTGCTAATGGGG + Intergenic
949577830 3:5355966-5355988 TGATTGTGATGGTGGTGATGTGG - Intergenic
950275105 3:11654083-11654105 TTGTTGTGGTGGTGGTGGTGGGG - Intronic
950853315 3:16083136-16083158 GTGGTATGATTGTGGTGGAGGGG + Intergenic
950904866 3:16528920-16528942 TTGGTGTGACAGTGGTGATAGGG - Intergenic
950941895 3:16901325-16901347 GTGGGGAGCTGGTGCTGATGAGG + Intronic
951553435 3:23897552-23897574 GAGGTGTGTTGTAGGTGATGGGG - Intronic
951904901 3:27695400-27695422 GTGGGGTGATAGTGGGGAGGTGG + Intergenic
953151678 3:40330789-40330811 GTGGAATGATGGTGGTAAAGAGG + Intergenic
954480694 3:50797246-50797268 GTGGTGTGAGGATGGAGGTGGGG + Intronic
954905361 3:54058172-54058194 TTTGGGTGGTGGTGGTGATGAGG + Intergenic
955203661 3:56875940-56875962 GTGGGGTGGTGGTGGTGGTAGGG + Intronic
955381904 3:58445692-58445714 TTTGTGTTATTGTGGTGATGTGG - Intergenic
955526042 3:59820771-59820793 TTAGAGTGGTGGTGGTGATGGGG + Intronic
955656292 3:61248312-61248334 GTGGGGGCATGGGGGTGATGAGG + Intronic
956065194 3:65390276-65390298 GTGTTGTGATGGTGGAGATTCGG - Intronic
959126893 3:102300590-102300612 GTAGTGTGATGGTATTGAGGAGG - Intronic
959435166 3:106305948-106305970 ATGATGTGATGTGGGTGATGAGG - Intergenic
960237625 3:115302358-115302380 GTGGTTAGATGGTGGTGTTGGGG - Intergenic
960346473 3:116539161-116539183 GTGGGGTTGTGGTGCTGATGAGG - Intronic
960536053 3:118815683-118815705 GTGGTGTGATGGCGGACTTGGGG - Intergenic
961298944 3:125909514-125909536 GTGGTCTCATGGTGGGGAGGAGG + Intergenic
961420354 3:126798123-126798145 GTGGTGTGCTGGAGGTTCTGCGG + Intronic
961462736 3:127062984-127063006 GTGGTGTGGGGGTGGTGGTGGGG + Intergenic
961485950 3:127216619-127216641 GTGGTGTGGAGGTGGTGGTGAGG - Intergenic
961503164 3:127351645-127351667 GTGGAGTGATGCTGGGGATGTGG - Intergenic
961653654 3:128429701-128429723 GGTGTGTGATGGTGATGGTGTGG - Intergenic
962028246 3:131571710-131571732 GGTGTTTGATGGTGGTGATGGGG - Intronic
962212687 3:133492111-133492133 GTGGGGTGCTGGTGGAGGTGAGG - Intergenic
962564665 3:136645452-136645474 GTGATGTGATGGAGGTGAAATGG - Intronic
963050120 3:141135076-141135098 GGGGTGAGATGGTGGGGCTGGGG - Intronic
964144502 3:153442733-153442755 GTGTTGTGCTGGTGGGGAGGGGG - Intergenic
964686812 3:159404514-159404536 GTGGGGTGGTGGTGGCCATGAGG + Intronic
965266410 3:166549503-166549525 GTGGTGTAATGGTGGATTTGGGG - Intergenic
965272387 3:166635490-166635512 GTAGTGGGGTGGTGGTGATGTGG - Intergenic
965459978 3:168950416-168950438 GGGGTGTGCTGGTGGTGAAATGG + Intergenic
966596480 3:181728502-181728524 TTGGTGTGAAGGTGCTGAGGGGG - Intergenic
967117577 3:186355574-186355596 GTGGTGGGGTGATGGTGGTGGGG - Intronic
967118244 3:186361151-186361173 CTGCAGTGATGGTGGGGATGGGG + Intronic
968966818 4:3772974-3772996 GTGTTGTGATGGTCCTGATAAGG + Intergenic
969402953 4:6968966-6968988 GTGGTTTGTTGGGGGTGAGGCGG + Intronic
969427102 4:7130849-7130871 GTGGTGTGAGGGTGTGAATGTGG + Intergenic
969427113 4:7130965-7130987 GTGGTGTGAAGGTGTGAATGTGG + Intergenic
969611399 4:8229464-8229486 GGGGTGTGATGGGGGTGAGCAGG + Intronic
969855468 4:9995632-9995654 GTGATGTCAAGGTGATGATGAGG + Intronic
970866487 4:20764871-20764893 CCGCTGTGATTGTGGTGATGTGG - Intronic
971149662 4:24018479-24018501 GTGGGGTGAGGGTGATGAGGGGG + Intergenic
971173644 4:24260294-24260316 GTGGTGTGAGAGTGAGGATGGGG - Intergenic
974396044 4:61336591-61336613 GTGGTGTGAGGGTGGAAATAGGG + Intronic
974700550 4:65439416-65439438 GTGGTGTGGGGGTGGAGATGTGG - Intronic
975501319 4:75088376-75088398 TTGGTGTGGTGGTGGGGATGAGG - Intergenic
976246460 4:83010746-83010768 GAGCTGTGATGGTGATGACGAGG - Exonic
977518871 4:98056168-98056190 GTGTGGTGCTGGTGGTGGTGGGG - Intronic
977707722 4:100089813-100089835 CTGGTGTGAATGTGGTGATGTGG - Intergenic
978072724 4:104491895-104491917 AGGGAGTGATGGTGGTGTTGGGG + Exonic
978511741 4:109527725-109527747 GTGGAGTGATTGGAGTGATGCGG - Intronic
979099584 4:116598712-116598734 GTGGGGTGACGGTGGTGTAGGGG - Intergenic
979305482 4:119138155-119138177 GTGGTGAGATAGTGGTTTTGAGG - Intronic
979572504 4:122244815-122244837 TTGGGGTGAAGGTGGTGATGTGG + Intronic
981243662 4:142508668-142508690 GTGGTGTGATAGTTGTGATTAGG + Intronic
982066423 4:151658441-151658463 CTGGAGTGATGGAGGTGATGGGG + Intronic
982353765 4:154444630-154444652 GTGTTGTGAGGGTGGTGCTGGGG - Intronic
982510327 4:156274729-156274751 GGGGTGGGATGGAGGGGATGGGG + Intergenic
983165912 4:164477329-164477351 CTGCTGTGGTGGTGGTCATGGGG - Intergenic
983980256 4:173987074-173987096 GTGTGATGATGGGGGTGATGAGG - Intergenic
984025865 4:174542424-174542446 GTGGTGTCTTGGTGTTGGTGAGG + Intergenic
984825878 4:183924309-183924331 GTGGGATGAGGGTGATGATGGGG + Intronic
985235961 4:187874674-187874696 GTCCTGTGTTTGTGGTGATGTGG - Intergenic
985725119 5:1512056-1512078 GCTGTGTCCTGGTGGTGATGTGG - Intronic
985884348 5:2665002-2665024 GGGCTGTGATGGGGGTGATGGGG + Intergenic
985981974 5:3477619-3477641 GTGGATGGAAGGTGGTGATGAGG - Intergenic
986202213 5:5588946-5588968 GCGGTGTGTGAGTGGTGATGCGG + Intergenic
986797049 5:11222859-11222881 GAGGTGGGATGTTGGAGATGGGG - Intronic
987507230 5:18789433-18789455 GTGGTATGTGGGTGGGGATGTGG - Intergenic
987672694 5:21032810-21032832 GTTGTCTGGTGGTGGTGATTTGG + Intergenic
989016272 5:36938347-36938369 GTGGTGTGGTGGTGGTGGTCGGG - Intronic
989270787 5:39530520-39530542 GAGGTGTCATGGGGGTGATCAGG + Intergenic
990065506 5:51709610-51709632 GTGGGGAGGTGGTGGTGCTGGGG - Intergenic
991924324 5:71689432-71689454 GTGGTGTGGATGTGGTGATCAGG + Intergenic
992361352 5:76041681-76041703 TTGGTCTGAAGGTGGTGGTGAGG + Intergenic
992369378 5:76127142-76127164 TTTGATTGATGGTGGTGATGAGG + Intronic
992883855 5:81138157-81138179 GTGGGGTGATGGTGGGGAGGAGG + Intronic
993580474 5:89653953-89653975 CTGGGGTGATGGTGGCTATGGGG + Intergenic
993828344 5:92721941-92721963 GGGGTGCGGTGGTGGTGATGGGG - Intergenic
993918141 5:93767389-93767411 TTGGTGTGGATGTGGTGATGAGG + Intronic
995261670 5:110111491-110111513 GGGAGGTGATGGTGATGATGTGG - Intergenic
995400406 5:111734319-111734341 CTGGTGTGCTGCTGGTGAGGTGG + Intronic
995468494 5:112475451-112475473 GTGGGGTGGTGGTGGTGGTGGGG + Intergenic
995534733 5:113123668-113123690 GTGTGGTGATGGTGGTGGTGTGG - Intronic
995791966 5:115898572-115898594 GTGGTTTGGTGGTGGGGATGGGG + Intronic
996088302 5:119326196-119326218 GTGGTGTAATAGGGCTGATGAGG + Intronic
999022714 5:148186208-148186230 GTGTTGTAGTGGTGGTGGTGGGG + Intergenic
999185675 5:149706603-149706625 TAGGTGTGGTGGTGGTGCTGGGG + Intergenic
999203876 5:149834765-149834787 TGTGTGTGTTGGTGGTGATGGGG + Intronic
999303442 5:150505134-150505156 GTGGTGTGCTGATGGCGATGAGG + Intronic
999383534 5:151138636-151138658 GTGGTGTTGGGGTGGGGATGTGG - Intronic
1000124309 5:158228390-158228412 GTGGTGTGCTGGAAATGATGGGG + Intergenic
1000369365 5:160520081-160520103 CTGGGGTGGTGGGGGTGATGAGG - Intergenic
1001088596 5:168720363-168720385 TTGGGGTGGTGGGGGTGATGGGG - Intronic
1001298577 5:170516974-170516996 GTGGTGTGATGGTGGTGATGGGG + Intronic
1001698605 5:173690615-173690637 GTGGGGTGACGGTGGGGGTGAGG - Intergenic
1001731666 5:173964624-173964646 GTGGGGTGAGGGTGGGAATGTGG + Intergenic
1001897201 5:175392683-175392705 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897213 5:175392716-175392738 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897225 5:175392749-175392771 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897237 5:175392782-175392804 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897249 5:175392815-175392837 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897261 5:175392848-175392870 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897273 5:175392881-175392903 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897285 5:175392914-175392936 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897297 5:175392947-175392969 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897309 5:175392980-175393002 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897321 5:175393013-175393035 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897333 5:175393046-175393068 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897345 5:175393079-175393101 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897357 5:175393112-175393134 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897369 5:175393145-175393167 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897379 5:175393178-175393200 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897393 5:175393213-175393235 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1001897404 5:175393247-175393269 GTGCTGTGATGGAGGTGGGGTGG - Intergenic
1002191406 5:177479647-177479669 GTGCTGTGATGCTGGTGTTCCGG + Intergenic
1003106657 6:3221977-3221999 GTGTGGTGGTGGTGGTGATGTGG - Intergenic
1004604328 6:17179581-17179603 GTGGGGTGGTGGTGGGGATGGGG + Intergenic
1005058838 6:21757469-21757491 TTGGTGTGGTGGGGGTGCTGAGG + Intergenic
1006601272 6:35227817-35227839 GTGGTGGGGGGGTGGTGAGGGGG + Intronic
1007208614 6:40172974-40172996 GTGGGGGGATGGTGGTGAGAGGG - Intergenic
1007451091 6:41940925-41940947 GTGCAGTGGTGGCGGTGATGGGG - Intronic
1007974568 6:46087378-46087400 TTGGTGTAATGGTGGTGTTTGGG - Intergenic
1008454545 6:51694078-51694100 GTGGCATGGTGGTGGTGGTGAGG - Intronic
1010489128 6:76452935-76452957 GTGGGGTGGGGGTGGGGATGGGG + Intergenic
1010793124 6:80087911-80087933 GTGGTGTGATAATGGCAATGTGG + Intergenic
1011014525 6:82740270-82740292 GAGTTGTCATGGTGATGATGAGG - Intergenic
1013324490 6:109031398-109031420 GTGGTGTGAGGCTGGAGAGGAGG - Intronic
1013744329 6:113327033-113327055 GGCATGTGGTGGTGGTGATGCGG - Intergenic
1015871449 6:137780243-137780265 GTGATGTTATTGTGGAGATGAGG - Intergenic
1017048982 6:150372697-150372719 GGGGTGTGTTGGGGGTGGTGAGG + Intronic
1017068180 6:150549305-150549327 GTGGTGTCATGGGGTGGATGGGG - Intergenic
1017602463 6:156098570-156098592 TTGCTGTGATGATGGTGATGGGG - Intergenic
1017720176 6:157238350-157238372 TTATGGTGATGGTGGTGATGAGG + Intergenic
1017881704 6:158566654-158566676 ATGGGGTGAGGGAGGTGATGGGG + Intronic
1018132963 6:160749876-160749898 GTGGAATGGTGGTGATGATGAGG - Intronic
1018579425 6:165295920-165295942 GGGGTGTGGTGGTGGGGGTGTGG - Intronic
1018647402 6:165961106-165961128 GTGGTGGGAGGGTGGGGATGGGG + Intronic
1018851148 6:167591026-167591048 GGGTTCTGATGGTGGTGGTGTGG - Intergenic
1019134612 6:169900147-169900169 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134618 6:169900181-169900203 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134624 6:169900215-169900237 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134649 6:169900366-169900388 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134653 6:169900400-169900422 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134657 6:169900434-169900456 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134661 6:169900468-169900490 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134667 6:169900502-169900524 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134671 6:169900536-169900558 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134677 6:169900570-169900592 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134683 6:169900604-169900626 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134689 6:169900638-169900660 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134695 6:169900672-169900694 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134706 6:169900741-169900763 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134713 6:169900775-169900797 TTGGGGTGATGATGGTGATGGGG + Intergenic
1019134720 6:169900809-169900831 TTGGGGTGATGATGGTGATGGGG + Intergenic
1019134726 6:169900843-169900865 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134730 6:169900877-169900899 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134734 6:169900911-169900933 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134738 6:169900945-169900967 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134742 6:169900979-169901001 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134746 6:169901013-169901035 CTGGTGTGATGATGATGATGGGG + Intergenic
1019134750 6:169901047-169901069 CTGGTGTGATGATGATGATGGGG + Intergenic
1019134754 6:169901081-169901103 CTGGTGTGATGATGATGATGGGG + Intergenic
1019134770 6:169901185-169901207 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134807 6:169901387-169901409 TTGGGGTGACGGTGATGATGGGG + Intergenic
1019134814 6:169901421-169901443 TTGGGGTGATGGTGATGATGGGG + Intergenic
1019134820 6:169901455-169901477 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134839 6:169901567-169901589 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134845 6:169901601-169901623 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134855 6:169901666-169901688 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134861 6:169901700-169901722 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134865 6:169901734-169901756 TTGGTGTGATGATGATGATGGGG + Intergenic
1019134890 6:169901880-169901902 TTGGGGTGATGATGATGATGGGG + Intergenic
1019134947 6:169902176-169902198 TTGGGGTGATGATGATGATGGGG + Intergenic
1019353462 7:566379-566401 TGGTGGTGATGGTGGTGATGAGG - Intronic
1019605301 7:1907166-1907188 GTGGGGAGATAGTGGGGATGGGG - Intronic
1020302858 7:6809398-6809420 GGGGTGTGATGATGGGGTTGTGG - Intronic
1021351139 7:19595630-19595652 GTGGGGTGCTGGTGGGGTTGAGG + Intergenic
1021508107 7:21407320-21407342 GTGGTCTGTTGGTGGTCATTTGG + Intergenic
1021839644 7:24712384-24712406 GTGGTGTGTGGTTGGTGCTGTGG - Intronic
1021891241 7:25188212-25188234 CTGGTGAGATGGGGGAGATGCGG - Intergenic
1022227938 7:28382744-28382766 GTGGTTTGATGGGGGTGAGGGGG - Intronic
1022598312 7:31733356-31733378 GTGGTGAGGTGGTGGTAATTGGG + Intergenic
1022813051 7:33887845-33887867 GTGCTGAGAGGGTGGTGATGTGG - Intergenic
1023248557 7:38233171-38233193 GTGGTGGGAGGGCGCTGATGTGG - Intergenic
1023444982 7:40222111-40222133 GTGGTGTGCTGATGGTGACTGGG + Intronic
1023713008 7:43014528-43014550 AGGGTGTCATGGTGGTGATCAGG + Intergenic
1024013945 7:45294309-45294331 GGGGTGTGAAGGGGCTGATGGGG + Intergenic
1024982134 7:55166560-55166582 ATGGTGGGATGGTGATGAGGAGG + Intronic
1027080099 7:75225795-75225817 TTATTGTGATGATGGTGATGAGG + Intergenic
1028890323 7:95980033-95980055 GGGCTGGGGTGGTGGTGATGGGG - Intronic
1029880424 7:103802869-103802891 ATATTGTGATGGTGGTGATTAGG - Intronic
1031955612 7:127939563-127939585 TTGGTGTGATGCTGGTGACCTGG + Intronic
1032580251 7:133097355-133097377 GTGGTGGTATGTTGGAGATGTGG - Intergenic
1032760394 7:134935232-134935254 GTGGTGGTGTGGTGGTGATTAGG - Intronic
1033601087 7:142888826-142888848 TTGGGGTGAAGGTGGTGAGGGGG + Intergenic
1034266320 7:149782815-149782837 GGGGTCTGATGGTGGGGGTGGGG - Intergenic
1034937622 7:155210097-155210119 GGGGAGAGATGATGGTGATGGGG - Intergenic
1034963716 7:155378352-155378374 GTGGGGTGGGGGTGGTGAAGGGG - Intergenic
1035342448 7:158172631-158172653 ATGGTGGGATGGTGATGGTGGGG - Intronic
1035380918 7:158440508-158440530 TAGGGGTGATAGTGGTGATGTGG + Intronic
1035463345 7:159060105-159060127 GTGAGGTGAAGGTGGTGATTAGG - Intronic
1036544209 8:9750646-9750668 GTGGGGTGCTGGTGGACATGTGG - Intronic
1037904729 8:22709355-22709377 GTGATGTGATGGTGATGATAAGG - Intergenic
1038172778 8:25152965-25152987 GTGGTGCGGTGATGGTCATGGGG - Intergenic
1039003665 8:33009846-33009868 GGGCTGTGATGGTGCAGATGGGG + Intergenic
1039594222 8:38776897-38776919 GTAATGTGAGGGTGGAGATGAGG + Intronic
1040095751 8:43440690-43440712 CTGGTGTGGTGGTGGCAATGAGG + Intergenic
1040584743 8:48728203-48728225 GTGCTCTGAGGCTGGTGATGAGG - Intronic
1040960965 8:53032356-53032378 GTGATTTGGTGGTGGTGGTGGGG + Intergenic
1041309161 8:56496724-56496746 CTAGTGAGATGGTGGTTATGAGG - Intergenic
1041689626 8:60676506-60676528 GTTGGGGGATGGTGGTGGTGTGG + Intergenic
1041883885 8:62786050-62786072 GGGGTGTGGTGGTGGTGGTATGG - Intronic
1042808608 8:72799123-72799145 GAGGTGAGAAGATGGTGATGGGG - Intronic
1042826601 8:72986036-72986058 CTGGTGTGGTGGTGGGGGTGGGG + Intergenic
1042848709 8:73194051-73194073 GTGGTGTGGTGGTGGGCAGGGGG - Intergenic
1043840357 8:85095121-85095143 TGTGTGTGTTGGTGGTGATGAGG - Intergenic
1043848622 8:85190261-85190283 GTGGTGCAGTGGTGGTGGTGGGG - Intronic
1045138838 8:99255745-99255767 CTGATGTCATGGTGGTGCTGAGG + Intronic
1045277346 8:100720808-100720830 GTGGTGTGGTGGTGGTCCTCAGG - Intronic
1045431913 8:102122995-102123017 GTGGTGTGATGGTGGGAGTGTGG - Intronic
1045498789 8:102729591-102729613 GTTGTCTGGGGGTGGTGATGGGG - Intergenic
1045646056 8:104299973-104299995 CTGGTGGGATGTTGGTGATGGGG + Intergenic
1046514809 8:115244732-115244754 GTGTTGAGATGGTGGGGAGGTGG - Intergenic
1046557603 8:115794141-115794163 GTAGTGGGGTGGTGGGGATGGGG + Intronic
1046790621 8:118318055-118318077 GTGGTGTGGTTGTGGTGAGAGGG + Intronic
1048979233 8:139694266-139694288 TTGTTGTGATGGTGGTCATTTGG - Intronic
1049286679 8:141779586-141779608 TTGGTGTGGTGGTGTTGGTGTGG + Intergenic
1049543299 8:143218229-143218251 GTGGTGTGGGGGTGGTGTTGGGG - Intergenic
1049543313 8:143218263-143218285 GTGGTGTGGGGGTGGTGTTGGGG - Intergenic
1049543337 8:143218321-143218343 GTGGTGTGGGGGTGGTGTTGGGG - Intergenic
1049543341 8:143218332-143218354 GTGGTGTGGGGGTGGTGTGGGGG - Intergenic
1049543352 8:143218355-143218377 GTGGTGTTGGGGTGGTGGTGGGG - Intergenic
1049590744 8:143460641-143460663 TTCGTGTGCTGGTGGTTATGTGG - Intronic
1050015594 9:1229734-1229756 GTGGTGGGGTGGGGGGGATGGGG + Intergenic
1050913998 9:11108300-11108322 CTGGGGTGGTGGTGGTTATGGGG + Intergenic
1052094020 9:24362628-24362650 CTGGGGTGATGGTGGGTATGAGG + Intergenic
1052750375 9:32483879-32483901 CTGGTGTGGTGGGGGTGATAAGG - Intronic
1053129892 9:35608946-35608968 GGGGGGTGATTCTGGTGATGGGG - Exonic
1053282157 9:36827370-36827392 ATGTGGTGATGGTGGTGGTGGGG + Intergenic
1053496599 9:38552831-38552853 GTGGTGGGGTGGGGGTGTTGGGG - Intronic
1053915115 9:42939941-42939963 GTGGTGTGAGGGTGGTGGGTGGG + Intergenic
1055514135 9:77020066-77020088 TGGGGGTGGTGGTGGTGATGGGG - Exonic
1055779046 9:79799442-79799464 ATGGTGGGATGGTGGGGGTGAGG - Intergenic
1056724779 9:89105112-89105134 GTGGTGTGATGGTCTTGAGCAGG - Intronic
1056754458 9:89373187-89373209 GGGGTGCGGTGGAGGTGATGTGG - Intronic
1057757591 9:97850213-97850235 GGGGTGGGTTGGTGTTGATGTGG - Intergenic
1058886693 9:109327142-109327164 GTGATGGGGTGGGGGTGATGTGG - Intergenic
1059248040 9:112865012-112865034 GGGGTGTGGTGGTGGTAGTGGGG - Intronic
1059907146 9:119000345-119000367 GTGGTGGGGTGTTGGTGGTGGGG + Intergenic
1060288290 9:122275259-122275281 GTGGGGTGGTGGTGGTGGTGAGG - Intronic
1061733342 9:132634492-132634514 GAGGTGTGATAATGGTGGTGTGG - Intronic
1061889763 9:133612308-133612330 GTGGAATGATGCTGGTGGTGGGG - Intergenic
1061924107 9:133797595-133797617 TTGTTGGGAAGGTGGTGATGGGG - Intronic
1062689508 9:137834096-137834118 GTGGTGGGGTGGGGGTGGTGCGG - Intronic
1062748974 9:138237117-138237139 GAGGTGTGAGGGTGAGGATGAGG + Intergenic
1203738982 Un_GL000216v2:162264-162286 GTGTGGTGATGGTGGTGGTGGGG - Intergenic
1203740798 Un_GL000216v2:175572-175594 GCGTGGTGATGGTGGTGGTGGGG - Intergenic
1185456186 X:311951-311973 GTGGGGTGGTGGTGCTGGTGTGG + Intronic
1185760254 X:2685073-2685095 GTGCTGTGCTGGTGGTGATATGG - Intergenic
1186491002 X:9971981-9972003 TTGGTGTGATTGTGGCAATGTGG - Intergenic
1187288991 X:17933764-17933786 GTGGTGTGATGGAGGTCTTTTGG + Intergenic
1189152214 X:38720261-38720283 TGGGTGTGATGGTGGTGGTGGGG + Intergenic
1189175269 X:38950320-38950342 CTCTTGAGATGGTGGTGATGGGG - Intergenic
1190324024 X:49195615-49195637 GTGGTGTGATGGAGGAGAGGTGG + Intronic
1190808289 X:53860625-53860647 CTGGGGTGATGGTGGTCATGGGG - Intergenic
1190821788 X:53980114-53980136 GTTGAGTCATAGTGGTGATGGGG - Intronic
1192194780 X:69020996-69021018 GAGGGGAGATGGTGGGGATGGGG + Intergenic
1192205397 X:69092638-69092660 GTTTGGTGGTGGTGGTGATGGGG - Intergenic
1193610945 X:83631038-83631060 GTGGGGTGCTGGTGGAGGTGGGG + Intergenic
1194223998 X:91231968-91231990 GTGGTGTGGTAGCGGTGAGGTGG + Intergenic
1195010576 X:100729532-100729554 GTGTAGTGATGGTGGGGTTGAGG - Intronic
1195323392 X:103739163-103739185 GAGATGGGATGGTGGTGGTGTGG + Intergenic
1196096710 X:111808410-111808432 CTGGTGTGGTGGTGGCCATGGGG - Intronic
1196825142 X:119734926-119734948 GTGGGGTGGTGGTGGGGAGGTGG + Intergenic
1196871357 X:120116099-120116121 GTGGGGTGCAGGTGGGGATGGGG + Intergenic
1197146493 X:123178138-123178160 GTGTGGGGGTGGTGGTGATGGGG - Intergenic
1199366701 X:146994635-146994657 GTAGTGTGATGCTGGGGATGGGG + Intergenic
1200007583 X:153098053-153098075 GTTGTTTGATGGTGGGGATTGGG + Intergenic
1200018008 X:153180352-153180374 GTGGGGTGGCGGTGGAGATGAGG - Intronic
1200137049 X:153880257-153880279 GTGTGGTGGTGGTGGTGATGGGG - Intronic
1200236624 X:154470806-154470828 TGGGTGGGATGGTGGTGGTGAGG + Intronic
1200560463 Y:4695349-4695371 GTGGTGTGGTAGCGGTGAGGTGG + Intergenic
1201712463 Y:17007746-17007768 GTGGTGGGATGGAGGTGGGGGGG - Intergenic
1202018211 Y:20434641-20434663 GTGGTGTGGTGGGGGTGCTGAGG - Intergenic