ID: 1001299231

View in Genome Browser
Species Human (GRCh38)
Location 5:170522091-170522113
Sequence CAGCTGGGTGGAGTCCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 278}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001299226_1001299231 7 Left 1001299226 5:170522061-170522083 CCGGCAGCAATTCAGGGCTGGGC 0: 1
1: 0
2: 0
3: 17
4: 208
Right 1001299231 5:170522091-170522113 CAGCTGGGTGGAGTCCCAGCTGG 0: 1
1: 0
2: 5
3: 41
4: 278
1001299220_1001299231 14 Left 1001299220 5:170522054-170522076 CCTGCCACCGGCAGCAATTCAGG 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1001299231 5:170522091-170522113 CAGCTGGGTGGAGTCCCAGCTGG 0: 1
1: 0
2: 5
3: 41
4: 278
1001299223_1001299231 10 Left 1001299223 5:170522058-170522080 CCACCGGCAGCAATTCAGGGCTG 0: 1
1: 0
2: 0
3: 6
4: 110
Right 1001299231 5:170522091-170522113 CAGCTGGGTGGAGTCCCAGCTGG 0: 1
1: 0
2: 5
3: 41
4: 278
1001299219_1001299231 19 Left 1001299219 5:170522049-170522071 CCAGGCCTGCCACCGGCAGCAAT 0: 1
1: 0
2: 0
3: 7
4: 155
Right 1001299231 5:170522091-170522113 CAGCTGGGTGGAGTCCCAGCTGG 0: 1
1: 0
2: 5
3: 41
4: 278

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001299231 Original CRISPR CAGCTGGGTGGAGTCCCAGC TGG Intronic
900289610 1:1918381-1918403 CTGCTGTGTGGTGTCACAGCTGG - Exonic
901044266 1:6386079-6386101 CACCTGGGCGGAGTTCCACCTGG + Intronic
901526564 1:9826625-9826647 CATGTGGGTGAAATCCCAGCAGG - Intergenic
902406222 1:16185042-16185064 CAGTTGGGGGAGGTCCCAGCAGG + Intergenic
902517368 1:16996619-16996641 CAGCAGTGTGGAGTCCTAACAGG + Intronic
902677963 1:18022104-18022126 CAGGTGGGTGAAGATCCAGCCGG + Intergenic
902804601 1:18853049-18853071 CAGCTGGGAGGATGCCCAGAAGG + Intronic
905201898 1:36321538-36321560 CAGCTGGGAGGGGTCCGAGCTGG - Intronic
905321845 1:37123273-37123295 CAGCTGGGGGAAGTCAGAGCTGG - Intergenic
905491079 1:38344366-38344388 AAGATGGGTGGAGTCCATGCAGG + Intergenic
906551856 1:46671928-46671950 CAGCTGTATGGATTCCCAACAGG + Exonic
907515705 1:54991978-54992000 TAGCTGGGTGGAGGCCAGGCGGG - Exonic
908173041 1:61526869-61526891 CAGAGGGGTGGAGTCCCAGAGGG - Intergenic
909101698 1:71357201-71357223 GAGCTTGGTGGAGTCCGAGTGGG + Intergenic
915118160 1:153613033-153613055 CAGCGGGGAGGAGTCCCGGCTGG - Intronic
915457996 1:156053460-156053482 CAGCTCCTCGGAGTCCCAGCCGG + Intronic
915914540 1:159932941-159932963 GAGCCAGGTGAAGTCCCAGCAGG - Intronic
919728167 1:200897045-200897067 CCCCTGGTTGGGGTCCCAGCTGG - Intronic
920039895 1:203088731-203088753 CAGAGGGGAGGAGGCCCAGCTGG + Intergenic
921251594 1:213303407-213303429 GAGCTGGGAGGAGTCTCAGATGG - Intergenic
921374066 1:214455220-214455242 CAGCCTGGTGGGGTCTCAGCTGG - Intronic
922581629 1:226702727-226702749 GACCTGAGTGGAGTCCCAACCGG + Intronic
922757638 1:228105421-228105443 CTGCTGGGTGGAGGCCCAGCTGG + Intergenic
922787329 1:228289468-228289490 CAGCTGTGTGGAGTGGCAGAAGG + Intronic
1063511601 10:6649770-6649792 CAGCTGGGTGGAGGCCCAGGTGG + Intergenic
1063884585 10:10564340-10564362 GAGCTGGGTGGAGTCCTTACTGG + Intergenic
1064323378 10:14327074-14327096 CAGCTGGGAGGGGTCCCAGGTGG - Intronic
1069340393 10:67402769-67402791 GAGCTGTGTGGAGTCTCAGCAGG + Intronic
1070829485 10:79409780-79409802 CAGCTCAGTGGTGTCCCACCCGG + Intronic
1071304873 10:84290412-84290434 CAGGTGACTGGAGGCCCAGCTGG + Intergenic
1071719861 10:88132079-88132101 CTTCTGGGAGGAGGCCCAGCTGG - Intergenic
1072617703 10:97060417-97060439 CAGCTGGGTGGGACCCCAGAGGG + Intronic
1072696456 10:97607315-97607337 CAGCTGGGTGGTGTCAGAGCAGG - Intronic
1072750885 10:97977902-97977924 CAGCAGGCTGGAGTCCAGGCTGG - Intronic
1072750908 10:97978013-97978035 CTGCTGGGTGGAGTGCCAGAAGG + Intronic
1072895385 10:99362139-99362161 CAGCTGGGAGGAGTCAGAGTGGG - Intronic
1073430143 10:103480623-103480645 CAGGTGGGTACAGTCCCAGAGGG + Intergenic
1073785063 10:106879854-106879876 CAGCTGGCTGGACTCCCATCTGG - Intronic
1075395577 10:122124565-122124587 CAGCTGGGGGGACACCTAGCTGG - Intronic
1076344399 10:129770549-129770571 CAACGGGGTGAAGTCCGAGCTGG - Intergenic
1076368454 10:129936711-129936733 CAGCTGTGTGGGGACCCAGGGGG + Intronic
1076368470 10:129936749-129936771 CAGCTGTGTGGGGACCCAGGGGG + Intronic
1076728056 10:132422397-132422419 CTGCTGGGTGCAGACGCAGCTGG + Intergenic
1076826280 10:132971253-132971275 CACCTGGTTGGCCTCCCAGCAGG - Intergenic
1076992382 11:282236-282258 CAGCTGGCTGGGGACCCAACTGG + Intronic
1078339489 11:10488727-10488749 AAGCTGGGTGGAGTCACAGTGGG + Intronic
1078663630 11:13306716-13306738 CAGCTAGCTGGAGTCCCAACAGG - Intronic
1079313989 11:19391862-19391884 CTGATGGGTGGAGACACAGCAGG - Intronic
1083308507 11:61772802-61772824 CAGGTGGGTGGAGCTCCAGGAGG + Intronic
1083544564 11:63538736-63538758 CAGCTGGAAGGAGGCCGAGCTGG - Intronic
1084460584 11:69294621-69294643 CTGCTGGGTGGGGGACCAGCTGG + Intronic
1084915651 11:72427011-72427033 CAGCTGGGAGGAATCCAAGAAGG + Intronic
1085198900 11:74689542-74689564 CAGCTGGGGAGACTCCAAGCTGG + Intergenic
1085400664 11:76233808-76233830 AAGCTGGGGGCAGCCCCAGCTGG + Intergenic
1087664720 11:101031048-101031070 CAGCTGAGTGGAGGCTTAGCAGG + Exonic
1089279008 11:117359513-117359535 CCGGTGGGTGGGTTCCCAGCAGG - Intronic
1089297577 11:117479458-117479480 CACCTGGGTGGCTTCACAGCAGG - Intronic
1089352865 11:117831287-117831309 CAGGTGGGAGGAGACCCAGAGGG - Intronic
1089773002 11:120816613-120816635 CAGAGGGGTAGACTCCCAGCAGG - Intronic
1090205183 11:124879926-124879948 CATCTGGGTGGAGCACCCGCTGG - Exonic
1090423704 11:126592802-126592824 GAGCTGGGTGTGGTCACAGCAGG + Intronic
1091225066 11:133952070-133952092 GAGCTGGGAGGAGTCTCAGCCGG - Intronic
1091250366 11:134139348-134139370 CAGCGAGGTGGACTCCTAGCTGG + Intronic
1091313816 11:134596640-134596662 CAGGGGTGGGGAGTCCCAGCAGG + Intergenic
1093289134 12:17300483-17300505 CTGCTGTGGGGTGTCCCAGCAGG - Intergenic
1093412947 12:18888224-18888246 CCGGTGGGTGGAGACACAGCTGG + Intergenic
1095111204 12:38296421-38296443 CCACTAGGTGGTGTCCCAGCAGG + Intergenic
1097233631 12:57526210-57526232 CAGGGGTGGGGAGTCCCAGCAGG - Exonic
1099776956 12:87146099-87146121 CCTCTGGGTGGATACCCAGCAGG + Intergenic
1102549011 12:113677439-113677461 CAGCTGGGTTCAGTCCCAAGGGG - Intergenic
1102559971 12:113754911-113754933 AGGCTGAGTGGATTCCCAGCAGG - Intergenic
1103506208 12:121443588-121443610 CAGTGGGGTGGAGGACCAGCGGG + Intronic
1103607304 12:122096856-122096878 CAGCTGGGGGGACTCACACCTGG - Intronic
1103732513 12:123037203-123037225 CACCTGGATGGACTTCCAGCTGG + Intronic
1104460983 12:128955718-128955740 CACCTGCGTGGAGTCCCAGCTGG - Intronic
1104979410 12:132567086-132567108 CTGATGGGTGGGGGCCCAGCAGG + Intronic
1105212799 13:18267207-18267229 CAGCTTGGAGCAGTCCCAGAAGG - Intergenic
1106176472 13:27336547-27336569 CAGCAGGGTGCAGTCCAGGCAGG + Intergenic
1109478155 13:62911959-62911981 CAGGTGCCTGTAGTCCCAGCTGG + Intergenic
1110488124 13:76070267-76070289 AAGCTGGGTGGAGTCAGACCAGG - Intergenic
1110814526 13:79846586-79846608 CAGCTGGCTAGAGTCCAAACTGG - Intergenic
1113067124 13:106383853-106383875 CAGCTGTGAGAAGTCCAAGCTGG + Intergenic
1113636916 13:111925703-111925725 GAGCTGGGCAGAGTCGCAGCGGG + Intergenic
1113914294 13:113861668-113861690 AGGCTGGCTTGAGTCCCAGCCGG - Intronic
1114527741 14:23377054-23377076 CAGCTGGGTGAGGGCCCATCTGG + Exonic
1118346144 14:64942577-64942599 GAGCTGGGTGAAGTCCCGGGTGG + Exonic
1118711023 14:68519471-68519493 CAGCTGGCTTCAGTCCCAGTTGG + Intronic
1120624122 14:86803478-86803500 CAACTGGCTGGTGGCCCAGCTGG + Intergenic
1121512285 14:94521491-94521513 TAGCTGGGGGGAGTACCAGCAGG + Intergenic
1121922625 14:97896984-97897006 CAGCTGGGAGGATACTCAGCAGG - Intergenic
1122394285 14:101411783-101411805 GAGCTGGTTGGAGTCTCTGCAGG + Intergenic
1122549143 14:102540411-102540433 CAGCTGGCAGGTGTCCCGGCAGG + Intergenic
1122884521 14:104704997-104705019 CAGCTATGTGGGTTCCCAGCAGG - Intronic
1123038991 14:105482785-105482807 CAGCTGTGTGGAGTCCGAAGGGG - Intergenic
1124635365 15:31361515-31361537 TAGCAGGGTGGGGTCCCTGCAGG + Intronic
1125452709 15:39825803-39825825 AAGCTTGGTGGAGACCCAGAAGG + Intronic
1128474055 15:67981983-67982005 CAGCTGGGTAGAGGCCGAGCTGG - Intergenic
1128544209 15:68556334-68556356 CAGCTGGGTGGCGTCATTGCTGG + Intergenic
1128666293 15:69540544-69540566 TAGCTGGGTGGACAACCAGCTGG + Intergenic
1128683967 15:69670360-69670382 CAGCTGCGTGGGGTGCAAGCAGG - Intergenic
1129698339 15:77753409-77753431 CAGCTGGGAGGAGACTCTGCGGG + Intronic
1130862666 15:87904794-87904816 GTGCTCTGTGGAGTCCCAGCTGG - Intronic
1131053905 15:89364523-89364545 CAGCTGCTTGGACTCCAAGCTGG - Intergenic
1131080550 15:89531048-89531070 AAGCTGGGTGAGGCCCCAGCTGG - Intergenic
1131459405 15:92607731-92607753 CAGCTGAGTGGATTCTCAGCAGG - Intergenic
1132098474 15:99005712-99005734 CAGCGGGTTGGAGCGCCAGCAGG + Intronic
1132248276 15:100314822-100314844 CAGCTGGGAGCAGTCCCACTCGG - Intronic
1132400306 15:101501150-101501172 CAGCTGGGAGGTGGCCGAGCTGG - Intronic
1132525081 16:410476-410498 CGGGTGGGTGTACTCCCAGCGGG + Intronic
1132567316 16:629492-629514 CCGGTGGATGGAATCCCAGCTGG + Intronic
1132571878 16:647803-647825 CAGCTGGATGGTGGCCCAGCCGG + Exonic
1132824399 16:1896207-1896229 CAGCTTTGTTGAGTCACAGCAGG - Intergenic
1132981599 16:2741052-2741074 GAACTTGGTGGAGTCCCAGGTGG + Intergenic
1134119858 16:11576008-11576030 CATGTGCCTGGAGTCCCAGCTGG - Intronic
1134742903 16:16563951-16563973 CAGATGCAGGGAGTCCCAGCAGG - Intergenic
1134924657 16:18148509-18148531 CAGATGCAGGGAGTCCCAGCAGG + Intergenic
1135737894 16:24947303-24947325 GAGCTGGGTGCTGTCCCAGCTGG - Intronic
1136078035 16:27830315-27830337 CAGCTGGGTGGGCTGGCAGCAGG - Intronic
1136643387 16:31588031-31588053 CAGCTGGGTGGAGGCTGAGATGG - Intergenic
1138507726 16:57486480-57486502 GAGCGGAGCGGAGTCCCAGCCGG - Exonic
1139266826 16:65647838-65647860 TAGCTGGGAGGAGTTCGAGCAGG - Intergenic
1139965425 16:70742510-70742532 CAGAGGGTGGGAGTCCCAGCAGG + Intronic
1140069988 16:71640832-71640854 CACCTGGATGGACTGCCAGCTGG + Exonic
1141604175 16:85143557-85143579 CAGCTGTGCGGACTCCCCGCTGG - Intergenic
1141876541 16:86828878-86828900 CAGCTAGGTCAAGTCCCAGCAGG + Intergenic
1142034690 16:87855789-87855811 CGGCTGGGTGGGGACCCCGCAGG + Intronic
1142178739 16:88656965-88656987 CAGCTGGTTGCAGGCCCCGCTGG - Intronic
1142330686 16:89450931-89450953 TAGCTGGGTGGTGAGCCAGCTGG - Intronic
1142364944 16:89645270-89645292 CAGCAGGCTGCGGTCCCAGCGGG - Exonic
1143181980 17:4989032-4989054 CAACTCCCTGGAGTCCCAGCAGG - Intronic
1143474028 17:7192823-7192845 GAGCGGAGTGGAGACCCAGCAGG + Intronic
1146157284 17:30535164-30535186 CAGCACGTGGGAGTCCCAGCAGG - Intergenic
1147142300 17:38466520-38466542 CAGCAGACTGGAGTGCCAGCAGG + Exonic
1147539648 17:41346569-41346591 CACCAACGTGGAGTCCCAGCTGG - Exonic
1147541598 17:41364900-41364922 CACCAACGTGGAGTCCCAGCTGG - Exonic
1147545075 17:41394969-41394991 CACCAACGTGGAGTCCCAGCTGG - Exonic
1148189212 17:45667011-45667033 CAGCTGGGTGGGGTGGCATCAGG - Intergenic
1150131508 17:62671734-62671756 CAGCTGGCAGGAGTCCAAGAAGG + Exonic
1150449954 17:65258411-65258433 CTGTTGGTTGGAGTCTCAGCTGG - Intergenic
1150834951 17:68555649-68555671 CAGCTGGGTCCAGTTCCACCTGG - Exonic
1151576857 17:74956838-74956860 CAGCTGTGTGCAGTCCTTGCTGG + Intronic
1151867879 17:76816430-76816452 CACCCAGGTGGAGTCCCTGCAGG + Intergenic
1151906490 17:77052731-77052753 CAGCTGGGGTGAGCCCCGGCAGG + Intergenic
1151979497 17:77500068-77500090 CACCTGAGTGGAGTCTCATCAGG - Exonic
1152755454 17:82085237-82085259 CCGCTGGGTGGAGTCTCTGAAGG - Exonic
1152798666 17:82321155-82321177 CAGCCAGGTGGAGACCCCGCAGG - Exonic
1155150900 18:23122121-23122143 CAGCTGAATGGTGTCCCAGAGGG + Intergenic
1155495168 18:26435768-26435790 GAGGTGGGTGGAGACCCAGAAGG - Intergenic
1156450891 18:37266031-37266053 CAGCAGGATGGGGCCCCAGCAGG - Intronic
1157260798 18:46174237-46174259 CAGCGGGGAAGAGTCCCGGCCGG + Exonic
1157283164 18:46359337-46359359 CAGCTGTGGGGAGGCACAGCTGG + Intronic
1160193548 18:76734851-76734873 CAGCTGGCTGGTGTGCCAGAAGG + Intergenic
1160317274 18:77859519-77859541 CAGCTGGGTGGCGTCTCAGGAGG - Intergenic
1160377312 18:78422769-78422791 CAGCCTTGTGGTGTCCCAGCTGG + Intergenic
1160790416 19:920372-920394 CAGCTGGATGGGGCCCCAGCAGG - Exonic
1160843293 19:1155866-1155888 GAGCTGAGGGGAGTCCCTGCAGG - Intronic
1161028026 19:2045636-2045658 GGGCTGGGTGGGGTCCCAGGAGG - Intronic
1161715663 19:5874875-5874897 GAACTGGGGGGAGTCTCAGCAGG + Intronic
1161950888 19:7467234-7467256 CAGCTATGTGGAGACGCAGCGGG + Exonic
1163826102 19:19525807-19525829 CAGCTGTGTGCAGCCCCCGCAGG + Intronic
1165067208 19:33236199-33236221 CCTGTGGGTGGAGGCCCAGCTGG + Intergenic
1165125726 19:33595712-33595734 CAGCTGGGTGGTTTTCCTGCTGG + Intergenic
1165828549 19:38719287-38719309 CAGCTGGGCGGAGTGGCGGCCGG - Intronic
1166225521 19:41392751-41392773 CAGCTGAGTGGAGACCCAAGCGG + Intronic
1166678588 19:44754277-44754299 CTGCGGGGTGGAGTTCCAGAGGG + Intronic
1166784840 19:45361480-45361502 CAGCTGCTAGGAGGCCCAGCAGG + Intronic
1166988361 19:46675897-46675919 CAGGTGCTTGTAGTCCCAGCTGG - Intronic
1167618720 19:50549810-50549832 CAGCTGGCATGAGTCCCATCGGG - Intronic
1168325884 19:55538039-55538061 CAGCTGGGTGGGGTCAAGGCAGG + Intergenic
1168420212 19:56197028-56197050 CAGCTAGGTGGAGGCCGAGGAGG + Intronic
925076271 2:1018857-1018879 CAGCAGGGTTGGCTCCCAGCAGG + Intronic
926223982 2:10954616-10954638 CATGTGGGTGGGGCCCCAGCAGG - Intergenic
926671655 2:15582344-15582366 TAGCTGGGATGAGACCCAGCTGG - Intergenic
926706121 2:15838853-15838875 CAGCTGGGTCCAGACCCAGGAGG - Intergenic
927142359 2:20139165-20139187 CAGCTAGGTTGAGACACAGCTGG + Intergenic
927152762 2:20205211-20205233 CAGCTGGGTGGAGACAGGGCAGG + Intronic
927198450 2:20564004-20564026 CAGCTGGGAGGAGAGCCAGGAGG + Intronic
928196771 2:29221911-29221933 CAGCAGGGCTGAGTCTCAGCTGG - Intronic
930518373 2:52434391-52434413 CTGCTGTGGGGTGTCCCAGCAGG - Intergenic
931147570 2:59535671-59535693 CAGTTGGGTGGGGTCCTAGTTGG - Intergenic
931698550 2:64890347-64890369 CTGCTGTGGGGTGTCCCAGCAGG + Intergenic
932319692 2:70812635-70812657 CTGCTGGTAGGAGTCCCAGAAGG + Intronic
932334590 2:70922774-70922796 CAGCTGGAGGGAGGCCCCGCAGG - Intronic
932436737 2:71706258-71706280 CAGGTGTGGGGAGGCCCAGCTGG - Intergenic
933817380 2:86079241-86079263 CTTCTGGCTGGAGTCCCAGAGGG + Intronic
933967604 2:87442753-87442775 TTGCTGGCTGGAGTGCCAGCAGG + Intergenic
936329786 2:111537637-111537659 CAGCAGGGGCGAGTCCCACCAGG - Intergenic
937005866 2:118513327-118513349 CAGGTGCCTGTAGTCCCAGCTGG - Intergenic
937442813 2:121931333-121931355 CAGATGGGTGGAGACCAGGCAGG + Intergenic
937911802 2:127079218-127079240 CTGCTGCGTGGAGTCTCACCTGG - Intronic
938246459 2:129781098-129781120 CTGCTGGGTGCCGTCCCAACAGG - Intergenic
938543309 2:132304816-132304838 ATGCTGGGTTGAGTCCCGGCTGG + Intergenic
941580922 2:167294112-167294134 CAGCTTGGTGGAGGCAGAGCGGG + Intergenic
941936608 2:170986697-170986719 CTGCAGGTTGGAGTCCCAACTGG - Intergenic
942037860 2:172028348-172028370 CAGGAGGGTGGAGTGCCAGGAGG + Intronic
942444304 2:176067901-176067923 CGGCTGGGTGGATCTCCAGCGGG + Intergenic
943407792 2:187511039-187511061 AAGCTGGCTGGAGTCCCCACAGG - Intronic
946311931 2:218886774-218886796 GAGCTGGGTGCAGACCCAGTGGG + Intronic
946475962 2:220006476-220006498 CTGCTGGCTGGAGAGCCAGCGGG - Intergenic
947729261 2:232419128-232419150 CAGCTGGTTGAGGTCCCAGCTGG + Intergenic
948289755 2:236816379-236816401 CACCTCTGTGGAGGCCCAGCAGG + Intergenic
948777846 2:240299151-240299173 AAGCTGGGTGCAGCCCCTGCAGG - Intergenic
1168772889 20:427499-427521 TAGGTGGGGGGAGTCCCTGCAGG - Intronic
1172602744 20:36195178-36195200 CAGCTGGGTGGGCCACCAGCAGG - Intronic
1172646431 20:36473018-36473040 CATGTGGGTGTGGTCCCAGCCGG + Intronic
1173201227 20:40956670-40956692 CAGCTGGTTGGTGGCTCAGCTGG + Intergenic
1173800554 20:45891913-45891935 CAGGTTTGTGGAGTCCCAGAAGG + Exonic
1175676787 20:60953069-60953091 CAGCTGAGTGCAGTCCCAGATGG + Intergenic
1175756173 20:61531700-61531722 CAGCACGGTGGAGCCCCAGCTGG + Intronic
1179558055 21:42193254-42193276 CAGCAGGGTGAAGCCCCCGCGGG + Intergenic
1179826290 21:43968251-43968273 GAGCTGGGCGGGGTCCCAGGAGG + Intronic
1180066655 21:45415788-45415810 CAGCCGGGTGGAGCCCCAGGTGG + Intronic
1180815616 22:18787531-18787553 CAGCTCGGAGCAGTCCCAGAAGG - Intergenic
1181201805 22:21221866-21221888 CAGCTCGGAGCAGTCCCAGAAGG - Exonic
1181699950 22:24615105-24615127 CAGCTCGGAGCAGTCCCAGAAGG + Exonic
1183693265 22:39403452-39403474 CAGCTGGGTGGAGTGCCTTGGGG + Intronic
1183716115 22:39534692-39534714 CCGCTGGGTTGAGGCCCAGGAGG + Intergenic
1184831458 22:46991426-46991448 CAGCTGCCTGCAGTGCCAGCCGG + Intronic
1184889307 22:47369731-47369753 CAGCTGGGAGGAGTCAGAGCTGG + Intergenic
1184995289 22:48201152-48201174 GGGCTGGGTGGATTCCAAGCAGG + Intergenic
1185108173 22:48885828-48885850 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1185128840 22:49026017-49026039 CAGCTGGGTGGGGTCCCTGGGGG + Intergenic
1185141274 22:49102647-49102669 CAGGTGGGAGGAGTCCCGGGTGG - Intergenic
1203225107 22_KI270731v1_random:73562-73584 CAGCTCGGAGCAGTCCCAGAAGG + Intergenic
1203265721 22_KI270734v1_random:13222-13244 CAGCTCGGAGCAGTCCCAGAAGG - Intergenic
950643451 3:14363204-14363226 TGGCTAGGTGGAGTCCCAGAGGG + Intergenic
952344057 3:32467887-32467909 CAGCTGGGAGGTGTGGCAGCAGG - Intronic
952888408 3:38025353-38025375 AAGCTGAGGGGAGTCCCAGTGGG + Intronic
953557024 3:43953932-43953954 CAGCTGAGTGCAGTCCCAGAGGG + Intergenic
953786396 3:45914863-45914885 CAGCTGGGTGGCGTCCCTGCTGG + Intronic
953889171 3:46737676-46737698 CTGCTGGGAAGGGTCCCAGCTGG + Intronic
953980301 3:47410182-47410204 CAGCTGGGTGGGGCCCGAGTAGG - Exonic
959973448 3:112432183-112432205 CTGCTAGGTGGCGTCCCAGTAGG - Intergenic
961037635 3:123653558-123653580 CAGCTGGGAGGGGTGGCAGCAGG + Intronic
966734076 3:183175181-183175203 CAGCTGGAGGCAGTCACAGCTGG + Intergenic
967337206 3:188357925-188357947 CAGCTGGCTGGAGTCACACTTGG + Intronic
967472004 3:189872640-189872662 CACCTGTGTGCATTCCCAGCTGG - Intronic
968051652 3:195658534-195658556 CACCGGGGTGGAGTCCTGGCTGG + Intergenic
968104163 3:195989799-195989821 CACCGGGGTGGAGTCCTGGCTGG - Intergenic
968302465 3:197627389-197627411 CACCGGGGTGGAGTCCTGGCTGG - Intergenic
968801571 4:2746544-2746566 CAGCTGGGTGGATTCCAGGCGGG - Intronic
969075393 4:4574223-4574245 TAGCTGGCTGGATTCCCGGCTGG - Intergenic
969246027 4:5933533-5933555 CAGGTGGCTGGAGTCCCTGAGGG + Intronic
969576235 4:8037749-8037771 CTGCTGAGGGGTGTCCCAGCTGG - Intronic
971918705 4:32909542-32909564 GAGCTGTGTGGAATCCCAGCAGG + Intergenic
974220448 4:58962594-58962616 CACCTGGGTGAAGTCCCAAATGG + Intergenic
980143752 4:128954441-128954463 CAGGTGCCTGTAGTCCCAGCTGG - Intronic
981016582 4:139980112-139980134 CAGCTAGCTGGAGTCCGGGCTGG - Intronic
982026853 4:151259650-151259672 CTGCTGTGTGGAGACCCATCAGG + Intronic
982118723 4:152118928-152118950 CTGCTGAGTGGAGACCCAGCAGG - Intergenic
984929376 4:184833209-184833231 CAGCTGGGTGGTTCCCCTGCTGG + Intergenic
985522307 5:381131-381153 CCACTGGCTGGAGGCCCAGCTGG - Intronic
986568526 5:9140550-9140572 CAGCCAGGTGGAGTCACAGCAGG - Intronic
986955482 5:13145299-13145321 CAGATGGGTTGGGTCCCACCAGG - Intergenic
988688799 5:33550906-33550928 CAGCTGGGAGGGCTCCCAGTGGG + Intronic
990309408 5:54523817-54523839 AAGATAGCTGGAGTCCCAGCAGG + Intronic
992192194 5:74304146-74304168 CTGCTGGGAGGGGTCCCAACTGG + Intergenic
996013016 5:118502178-118502200 CTGCTGGGGGGTGTCCCAGTTGG + Intergenic
997422738 5:133781980-133782002 CAGCTGGGTTTATTCCAAGCAGG + Intergenic
997426787 5:133808727-133808749 CAGCTGAGTGCAATCCCAGCTGG - Intergenic
1001299231 5:170522091-170522113 CAGCTGGGTGGAGTCCCAGCTGG + Intronic
1002332695 5:178455395-178455417 CAGCAGGGTGGAACCCCAGGGGG + Intronic
1003157520 6:3608919-3608941 AAGAGGGGTGGCGTCCCAGCTGG - Intergenic
1003263993 6:4550302-4550324 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264000 6:4550318-4550340 CAAGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264007 6:4550334-4550356 CAGGTGGGTGGAGCCCCAAGTGG - Intergenic
1003264024 6:4550380-4550402 CAGGTGGGTGGAGCCCCAGGTGG - Intergenic
1003264029 6:4550396-4550418 CAGGTGGGTGGAGCTCCAGGTGG - Intergenic
1003264054 6:4550463-4550485 CATGTGGGTGGAGTCCCACAGGG - Intergenic
1004374042 6:15076389-15076411 CAGTTAGGCTGAGTCCCAGCTGG - Intergenic
1008606833 6:53148804-53148826 CTGCTGGTTCAAGTCCCAGCAGG + Exonic
1011820333 6:91245527-91245549 CAGCTGGGACAAGCCCCAGCTGG + Intergenic
1012611862 6:101228265-101228287 CTGCTGTGGGGTGTCCCAGCAGG + Intergenic
1012742871 6:103042483-103042505 CAGCTGGGTGGATTTGCATCTGG + Intergenic
1014397709 6:120946460-120946482 CATGTGGGTGGAGTCCGAGAAGG - Intergenic
1016792312 6:148078888-148078910 CACCTGTTTGGAGTCCCAGCAGG + Intergenic
1017113048 6:150950380-150950402 TGGCTGGGTGGATTCCCAGAAGG - Intronic
1018837587 6:167496958-167496980 CACCTGGGTGGAGTAGCACCTGG + Intergenic
1019623351 7:2003128-2003150 CTGCGGGGTGGAGGCCCAGCAGG + Intronic
1019914401 7:4123495-4123517 GAGCCGGGTGGAGCCACAGCTGG + Intronic
1020120726 7:5501783-5501805 CAGCTGGCTGGCGTCGAAGCCGG + Exonic
1022708196 7:32826056-32826078 TAGCAGAGTGGAGGCCCAGCAGG - Intergenic
1023015991 7:35968912-35968934 CAGGTGGGAGGGGTCTCAGCAGG + Intergenic
1024086641 7:45897438-45897460 CAGCAGGCTGGAGACCTAGCAGG + Intergenic
1024241622 7:47440362-47440384 TAGCTGGGTGGGGTCCCAGCGGG - Intronic
1024246714 7:47476274-47476296 GAGTTGGGTTGAGTCCCATCCGG - Intronic
1024980715 7:55155553-55155575 CAGCTGTTTTGCGTCCCAGCAGG - Intronic
1025829650 7:65038280-65038302 CAGCTGGGTCGGGTCCCGACGGG + Intergenic
1026554291 7:71392446-71392468 CTCCAGGGTGGAGTCCCAGGGGG - Intronic
1026835529 7:73636528-73636550 CAACTGGCTGGGGTGCCAGCAGG + Intergenic
1027057326 7:75058712-75058734 AAGCTGGGTGGAGACCTGGCGGG - Exonic
1030100039 7:105937739-105937761 CAGCTGTGGGGAGTACCATCAGG - Intronic
1030238317 7:107291775-107291797 CAGCTGGGAGGAGCCCCTCCTGG - Intronic
1030830289 7:114211290-114211312 GAGCTGTGTGGATTCTCAGCAGG - Intronic
1034253061 7:149707561-149707583 CAGCTTTGAGGAGGCCCAGCTGG + Intergenic
1034412624 7:150949152-150949174 CAGCTGGGTCGCCTGCCAGCCGG + Intronic
1034492153 7:151399228-151399250 CAGCTCGCTGGAGTCGCAGGTGG - Intronic
1034940498 7:155227350-155227372 CAGCTGGGTGGAGAATCAGCAGG + Intergenic
1036005204 8:4654364-4654386 CAGAGGGGTGGAGACCCAGCAGG - Intronic
1038606576 8:29012337-29012359 CATCTGGGTGGATTCCAATCAGG - Intronic
1039072570 8:33660086-33660108 GAGCTGAGTGGAGCCCCAGTGGG + Intergenic
1039438574 8:37578671-37578693 CAGCTAGTTGGAGTCACATCTGG - Intergenic
1040481021 8:47826816-47826838 CCGCTGGGTCGAGGCTCAGCAGG + Exonic
1041559911 8:59205191-59205213 CATTTGGGTGGCATCCCAGCAGG - Intergenic
1042563170 8:70088690-70088712 CGGCTCGGTGGAGTCTCAGCGGG - Intergenic
1046954931 8:120053166-120053188 AAGGTGTGTGGAGTCCCAACTGG - Intergenic
1049413401 8:142484024-142484046 CAAGTGGGAGGAGGCCCAGCTGG + Exonic
1053350688 9:37411536-37411558 CAGCTAGATGGAGTCTGAGCTGG + Intergenic
1055321459 9:75087441-75087463 CAGCAGGGTTGAGTAGCAGCTGG - Intronic
1057206552 9:93176696-93176718 CAGGTGGCTGTAATCCCAGCTGG + Intergenic
1059483897 9:114612421-114612443 CAGCAGGGTGGAGGCAGAGCAGG - Intronic
1060036059 9:120256814-120256836 CAGATGGGTGGAGACCAAGCAGG - Intergenic
1060747354 9:126146341-126146363 GATCTTGGTGGTGTCCCAGCAGG - Intergenic
1060816028 9:126635737-126635759 CAGCTGGGTGGCCTCGGAGCAGG - Intronic
1062366609 9:136212581-136212603 CAGCTGGGCGGTGTCTCAGATGG + Intronic
1186593175 X:10952926-10952948 GAGCTGTATGGAGTCTCAGCAGG + Intergenic
1192225121 X:69222464-69222486 CTGGTGGTTAGAGTCCCAGCCGG + Intergenic
1192441436 X:71177465-71177487 CAGTTGGGTGTATTCACAGCTGG - Intergenic
1193637385 X:83969120-83969142 GAGCTGTGTGGAGTCTCAGTGGG + Intergenic
1195053891 X:101124213-101124235 CAGCAGGCTGGAGACCCAGGAGG + Intronic
1197705218 X:129630026-129630048 CAGCTGCTTGGAGAGCCAGCGGG - Intergenic
1197734483 X:129840689-129840711 CAGCTGGCTTGAGTAACAGCAGG - Intronic
1197941594 X:131795777-131795799 CAGCTGGATGGTGGCCCAGCCGG - Intergenic
1200227012 X:154423500-154423522 CAGGTGCCTGTAGTCCCAGCTGG + Intergenic
1200267140 X:154652724-154652746 CAGCTGGGTGGGGTTGCTGCAGG - Intronic