ID: 1001299518

View in Genome Browser
Species Human (GRCh38)
Location 5:170523813-170523835
Sequence ACTGAGAGGCAGACTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001299518_1001299528 28 Left 1001299518 5:170523813-170523835 CCTACCCCAGTCTGCCTCTCAGT 0: 1
1: 0
2: 1
3: 32
4: 350
Right 1001299528 5:170523864-170523886 TAACCTCCCAGACCTCCACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001299518 Original CRISPR ACTGAGAGGCAGACTGGGGT AGG (reversed) Intronic
900172246 1:1274641-1274663 CCTGAGAGGCAGTCAGGGTTGGG - Intergenic
900782769 1:4628787-4628809 GCAGAGAGGCAGCCTGGGTTGGG + Intergenic
901089075 1:6629549-6629571 ACTGAGGGGCAGGAAGGGGTCGG - Intronic
902359018 1:15931909-15931931 GCTGAGAGGCAAACTTGGTTCGG - Exonic
902614883 1:17618386-17618408 GCTGCGAGGCAGGCTGGGGTGGG + Intronic
902811906 1:18892716-18892738 AGTGGGAGGCAGAGTGGGGGTGG - Intronic
903127102 1:21255698-21255720 ACAGAGAAGCAGCCTGGTGTCGG + Intronic
903661181 1:24979811-24979833 ACAGAAAGGCAGGCTGGGCTGGG + Intergenic
903947180 1:26971323-26971345 ACGGTGAGGCAGGGTGGGGTGGG + Intergenic
905289159 1:36909749-36909771 ACTGAGAGCCAGAGTTGGGGAGG + Intronic
906124590 1:43419944-43419966 GGTGAGAGGCACACTGAGGTGGG + Exonic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
911009028 1:93260056-93260078 ACTTAGAGGCTGAGTGGGGAGGG - Intronic
911879871 1:103223755-103223777 CTTGAGAGGCAGACGGGGATGGG + Intergenic
912451974 1:109772955-109772977 ACTGAGGGGCAGAGTTGGGGAGG - Intronic
912797110 1:112699992-112700014 ACTAAGAGGGAGAATGGGGTGGG - Intronic
915616713 1:157045224-157045246 TCTGAGAATCAGGCTGGGGTAGG - Exonic
916028387 1:160855292-160855314 ACTGAGAGTCCAGCTGGGGTTGG + Intronic
917491903 1:175505136-175505158 ACAGCGAGGCAGCCTGGGTTTGG - Intronic
917684166 1:177399018-177399040 CCTGAGAGCCATCCTGGGGTGGG - Intergenic
917891081 1:179438978-179439000 TCTGGGCGGCAGACTGGGATTGG + Intronic
918385744 1:184005635-184005657 ACGGAGAGGCAGAGTGTGGATGG - Intronic
919774485 1:201185233-201185255 ACCCTGAGGCAGACTGGGGCAGG - Intergenic
920261214 1:204689255-204689277 ACTGTGAGACAGACTGGCCTGGG + Intergenic
922336628 1:224623582-224623604 GCTCAGAGGCAGTCAGGGGTGGG - Intronic
922613079 1:226944221-226944243 ACAGAGGGGCAGCTTGGGGTTGG + Intronic
923114043 1:230917682-230917704 ACCGAGAGGCACACTGAGGCTGG + Intronic
923479744 1:234373104-234373126 CCTGGGAGGCAGGCTGAGGTGGG + Intergenic
1062957378 10:1549178-1549200 ACTGAAAGGTGGAGTGGGGTGGG + Intronic
1063016835 10:2086830-2086852 ACTCAGATGCAGACTGTGGGAGG - Intergenic
1064321799 10:14311730-14311752 TCTGAGAGACAGATGGGGGTTGG - Intronic
1067043434 10:42970573-42970595 GCTGAGGGCCGGACTGGGGTCGG - Intergenic
1067571406 10:47374033-47374055 ACTGAGAAACAGCGTGGGGTGGG + Intronic
1068714738 10:60175754-60175776 CCTCAGAGGCAGACTGGGTTTGG + Intronic
1069343197 10:67437314-67437336 CCTGAGAGGAAGACTGGGAGTGG + Intronic
1070754157 10:78981411-78981433 GGTGATGGGCAGACTGGGGTAGG + Intergenic
1071228427 10:83558834-83558856 ACTGAGAGGCAAGATGGAGTGGG + Intergenic
1072226326 10:93373265-93373287 GCTGGGAGGCAGACTGTGGCTGG + Intronic
1072662203 10:97370023-97370045 ACAGGGAGGCAAACTGGGCTGGG + Intronic
1072691205 10:97573223-97573245 ACTGAGTGGGAGGCTGGGGCAGG + Intronic
1072873060 10:99141176-99141198 AATGAGAGGGAGAATTGGGTAGG - Intronic
1073237458 10:102030214-102030236 ACTGAGACTCAGACTGGGCTGGG - Intronic
1074160780 10:110834838-110834860 ACAGTGAGGCAGACTGGGACAGG - Intronic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1075403053 10:122174476-122174498 ACAGAGAGGGAGACACGGGTGGG - Intronic
1076133198 10:128027949-128027971 GCTGAGAGGCACAGTGAGGTGGG + Intronic
1076412542 10:130262292-130262314 ACTGGAAGGCAGGCTGGGGTGGG - Intergenic
1077096052 11:799618-799640 ACTCCGAGGCAGAGTGTGGTGGG - Intronic
1077302853 11:1855164-1855186 ACTGAGAGCCCCAGTGGGGTAGG + Intronic
1077356711 11:2122144-2122166 ACTGAAAGGCAGACTTGGAGAGG + Intergenic
1078315579 11:10290520-10290542 TCTTAGATCCAGACTGGGGTAGG + Intronic
1078332111 11:10431415-10431437 GCTGAGAGGAAGCCTGGTGTTGG + Intronic
1078996545 11:16706603-16706625 AATGAGAAGCAGAGAGGGGTTGG + Intronic
1079306448 11:19327832-19327854 AATGACAGCCAGACTGAGGTTGG - Intergenic
1081529366 11:43947459-43947481 AAGGAGAGGCAGGCTGGGGCCGG + Intergenic
1081561964 11:44226082-44226104 GCAAAGAGACAGACTGGGGTTGG - Intronic
1081653398 11:44840565-44840587 TCTGGGAGGCAGCCTGGGGCTGG - Intronic
1082813108 11:57490601-57490623 TCTGAAGGGCTGACTGGGGTTGG - Intronic
1082856697 11:57814642-57814664 CCAGAGAAGGAGACTGGGGTAGG - Intronic
1083277029 11:61602734-61602756 ATTGATAGGCAGCCTGGGGCTGG + Intergenic
1083303340 11:61750104-61750126 ACTGACAGGGAGGCTGGGGTGGG + Intergenic
1083343842 11:61975921-61975943 ACTGTGAGGCAGTCGGGGCTGGG + Intergenic
1083902870 11:65652186-65652208 AAGGAGAGGCAGGCTGGGGATGG + Intergenic
1084944531 11:72631639-72631661 ACTGGGCGCCAGGCTGGGGTAGG - Intronic
1085045976 11:73353679-73353701 GGTGAGAGGCAGTATGGGGTAGG - Intronic
1085764444 11:79270761-79270783 ACAGAGAGGCAGCCTGAGGCTGG - Intronic
1085846984 11:80077290-80077312 ACTGTGATGCAGCCTGGGGCAGG + Intergenic
1088690370 11:112321579-112321601 TCCGAGAGGCAGATTGGGGCAGG + Intergenic
1089047056 11:115510578-115510600 ACTGACAGACAGCCTTGGGTGGG + Intergenic
1089632034 11:119789847-119789869 ACTGAGCTGGAGACTGTGGTGGG - Intergenic
1091054899 11:132408697-132408719 ACTAAGAGGAGGAATGGGGTAGG + Intergenic
1092856865 12:12682021-12682043 ACTGGGAGTCAGACTGGATTAGG + Intronic
1092885513 12:12921247-12921269 ACTGGGAGCCAGGGTGGGGTGGG + Intergenic
1096497082 12:52044821-52044843 ACTGAGAGGGAAACTGAGGGAGG + Intronic
1096622920 12:52875451-52875473 ACTGTGAGAGGGACTGGGGTGGG + Intergenic
1097107997 12:56636365-56636387 CCTGTGTGACAGACTGGGGTGGG + Exonic
1097327085 12:58289104-58289126 CGGGAGAGGCAGACTGGGGAGGG + Intergenic
1097886750 12:64736550-64736572 TCTGAGAGGCAGCCTGGTTTGGG - Intronic
1097961142 12:65532952-65532974 ACCTAGAGGCAGGCTGGGGGAGG - Intergenic
1100405504 12:94269384-94269406 AGAAAGAGACAGACTGGGGTAGG - Intronic
1101734211 12:107450793-107450815 ACTGAGAGGCAGGAGGGGGAGGG + Intronic
1102306076 12:111805611-111805633 ACTGAGAGCCAGGCTGGGTGTGG - Intronic
1104254652 12:127125418-127125440 AATGGGAGGCAGGCTGGGGTGGG + Intergenic
1105634345 13:22203056-22203078 CCACAGGGGCAGACTGGGGTGGG - Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1108903519 13:55442743-55442765 AATGAGAAACAGATTGGGGTGGG + Intergenic
1113024095 13:105921464-105921486 TCTGAGAGAGAGACTGGGGAGGG + Intergenic
1114629883 14:24152051-24152073 TCAGAGATGGAGACTGGGGTAGG - Intronic
1114720746 14:24879469-24879491 ACTGAGAGTCAGCCTGGAGCAGG - Intronic
1115003430 14:28450117-28450139 ACTGAGAGGAAAAGTGAGGTTGG + Intergenic
1118336277 14:64855926-64855948 ACTGAGAGGCTCACAGGGCTGGG + Intronic
1118503274 14:66383600-66383622 AGAGAGAGGCTGACTGGGTTGGG + Intergenic
1118567643 14:67159854-67159876 ACTAAAAGGCAGGGTGGGGTGGG - Intronic
1118713195 14:68539415-68539437 ACTGAGAGGCAGGCGGAGGAGGG - Intronic
1118734579 14:68692146-68692168 GATGAGAGGGAGACTGGGGGCGG - Intronic
1118780856 14:69006575-69006597 AGTTAGAGGCAGCCCGGGGTTGG + Intergenic
1119259650 14:73230208-73230230 ACTGAAAGGCAGACTGTGACGGG - Intergenic
1119547924 14:75486637-75486659 ACTGGGATGCAGAGTGGGGTTGG + Intergenic
1119556911 14:75560297-75560319 ACTGGCAGTCAGAATGGGGTCGG + Intergenic
1119666296 14:76487310-76487332 ACTGAGAGGCAGACTTGCCAGGG + Intronic
1119788502 14:77329636-77329658 ACTGAGTGACAGACTGGGCATGG - Intronic
1120891940 14:89499150-89499172 CCTGACAGGCAGGGTGGGGTGGG - Intronic
1121050991 14:90818806-90818828 CTGGAGAGGCAGACTGGAGTTGG - Intergenic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121520162 14:94580827-94580849 AATTAGGGGCAGAGTGGGGTTGG - Intronic
1121826843 14:97017177-97017199 ACTGAGACACAGAGTGGGTTCGG + Intergenic
1122288738 14:100668138-100668160 ACTCAGCGGCTGGCTGGGGTCGG + Intergenic
1126809064 15:52382328-52382350 ACTGGGAGGCCGAGTGGGGACGG + Intronic
1128552286 15:68606088-68606110 GCAGAGAAGCAGATTGGGGTGGG + Intronic
1129186686 15:73911594-73911616 ACTGGGAGGTGGGCTGGGGTGGG + Intergenic
1129253525 15:74321339-74321361 ACTGGGGGGCAGGCGGGGGTGGG - Intronic
1129694161 15:77731139-77731161 CCTGGCAGGCAGGCTGGGGTGGG + Intronic
1129711128 15:77820634-77820656 ACTGAGGTGCAGAGAGGGGTCGG - Intronic
1130342416 15:83011041-83011063 TCTGAGAAACGGACTGGGGTTGG + Intronic
1131423317 15:92325701-92325723 ACTGAGAGGCAGAATGGTTATGG - Intergenic
1131508597 15:93036585-93036607 ACTGGGAGGCTGACTGAGGAGGG - Intronic
1131643064 15:94313202-94313224 AATGAGAGGCAGAGTGGAGGGGG - Intronic
1131983221 15:98016396-98016418 ACTCAGAGGAAACCTGGGGTAGG - Intergenic
1133924867 16:10183909-10183931 CCTGAAAGGCAGACAGGCGTTGG - Intergenic
1134013770 16:10874328-10874350 ACAGAGAGGAAGCCTGGGGTGGG + Intergenic
1134247226 16:12548823-12548845 ACTGAGAGCTAGACAGGGCTGGG - Intronic
1134273830 16:12758182-12758204 CCTGTGAGGCACACTGGGGGTGG - Intronic
1134610601 16:15605329-15605351 TCTGAGAGGCAGAGAGAGGTGGG + Intronic
1134690879 16:16190476-16190498 GCTGAGAGGCAGACAGGTTTGGG - Intronic
1136296499 16:29307041-29307063 AGTGAGAGGCAGACTGGGAATGG - Intergenic
1137608226 16:49801181-49801203 ACAGAGAGGCAGGCTGTGGCAGG - Intronic
1138511193 16:57509385-57509407 CCTGTGAGGCACAGTGGGGTGGG + Intergenic
1139593040 16:67943749-67943771 ACTGAGAGTCACAGTGTGGTGGG + Exonic
1139789891 16:69424985-69425007 CCTCAGAGGGAAACTGGGGTGGG + Intronic
1142058080 16:88013160-88013182 AGTGAGAGGCAGACTGGGAATGG - Intronic
1142781053 17:2181666-2181688 ACAGAGAGGCAGAGGGGGTTGGG - Intronic
1143040070 17:4027924-4027946 TCTGAGAGGCTGAGTGAGGTGGG - Intronic
1143217161 17:5233659-5233681 ACTGAGAGGCAGGCGGGGCATGG - Intronic
1143418068 17:6764801-6764823 ATGGAGAGCCAGACTGGAGTGGG - Intronic
1143626145 17:8111168-8111190 GATGAGGGTCAGACTGGGGTTGG - Intronic
1143761631 17:9108429-9108451 ACTGTGAGGAAGTCTGGGGAGGG + Intronic
1144494568 17:15738149-15738171 ACTGAGAGGCAGACGGTGCCAGG - Intronic
1144656737 17:17042123-17042145 GCAGAGAGGCAGCCTGAGGTCGG + Intergenic
1144766975 17:17738285-17738307 ACTGAGGGGTGGGCTGGGGTGGG + Intronic
1146471479 17:33128435-33128457 ACTGGGAAGCAGAATGGGGATGG + Intronic
1146538182 17:33671497-33671519 ACTGACAGCCAGAATGGGATGGG + Intronic
1146572715 17:33966914-33966936 GCTAGGAGGAAGACTGGGGTGGG - Intronic
1146831307 17:36071520-36071542 ACTGAGAGGAATTCTGGGGGAGG + Exonic
1147392541 17:40119257-40119279 AAAGAGAGGAAGACTGGGCTGGG + Intergenic
1148811667 17:50296877-50296899 CCTGAGAGTCAGACTTGGGCTGG - Intergenic
1149002520 17:51771756-51771778 TCTGAGTGGCAGAATGGGGCAGG + Intronic
1149216672 17:54362872-54362894 ACTGAGAAGCAAACTGGTATTGG + Intergenic
1150483739 17:65530315-65530337 ACTGAGCAGCAGCCTGGGCTGGG + Intronic
1151833602 17:76569594-76569616 ACTGGGAGGGAGACTGGGTAGGG + Intronic
1151871704 17:76841207-76841229 ACAGAGAGGCAGAGAGAGGTGGG - Intergenic
1152089655 17:78239571-78239593 GCTGAGTGGCAGAGTTGGGTGGG + Intronic
1152291547 17:79442747-79442769 CCGGAGGGGCAGACTGGGGTGGG + Intronic
1152343905 17:79740084-79740106 ACTGGCAGGGAGACTGAGGTGGG + Intronic
1152795101 17:82302746-82302768 CCTGGGAGGGAGACTGGGGAGGG + Intergenic
1153166233 18:2264728-2264750 TCTGAGAGGAACACTGGTGTGGG + Intergenic
1154095740 18:11413582-11413604 ACTCACAGGGAGACAGGGGTGGG - Intergenic
1156362973 18:36400573-36400595 TCTGAGAAGGAGACTGTGGTTGG + Intronic
1159012573 18:63071902-63071924 ACGGAGTGGCAGAGTGGTGTTGG - Intergenic
1159081483 18:63740480-63740502 TCTGAGATTCAGACTGTGGTGGG + Intergenic
1159931194 18:74314897-74314919 ACAGAGAGCCAGACAGGGTTAGG - Intergenic
1160017920 18:75158330-75158352 ACTGGGACAGAGACTGGGGTAGG - Intergenic
1160066656 18:75581726-75581748 ACTGGGAGGGAGCCTGTGGTGGG + Intergenic
1160560119 18:79750926-79750948 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1160560190 18:79751131-79751153 ACTCAGAGGCAGGCCGGGGAGGG + Intronic
1161040642 19:2109219-2109241 ACAGGGAGGCTGACTGCGGTGGG + Intronic
1161768256 19:6218346-6218368 ACTGGGAGGGAGGCTGGGGCAGG + Intronic
1162018446 19:7857917-7857939 ACTGAGAGCCAGAGTGGGGAAGG + Intronic
1162080340 19:8214242-8214264 ACAGACAGACAGACAGGGGTGGG - Intronic
1162248878 19:9425897-9425919 ACTGAGAGGCAGAAGGGGTAAGG + Intronic
1164831356 19:31323733-31323755 ACTGTGTGGGAGACTGTGGTGGG - Intronic
1165832782 19:38737436-38737458 CCTGAGAGGCTTCCTGGGGTGGG - Intronic
1166166185 19:40990681-40990703 ACTGAGAGGCTGGCTGGGTGCGG - Intergenic
1166946098 19:46397417-46397439 ACTCAGAGGCAGGCTGGTGTAGG - Intergenic
1167035063 19:46990305-46990327 ACAGAGAGGCAGGCTGGGGCAGG - Intronic
1167826704 19:51979863-51979885 TCTGAGCAGCAGACTGGGATTGG - Intronic
924979335 2:206969-206991 AAAGAGAGGGAAACTGGGGTGGG + Intergenic
925414064 2:3657218-3657240 GCTGAGAGACGGGCTGGGGTTGG + Intergenic
926657129 2:15420312-15420334 ATTAAGAGGTAGACTGAGGTGGG + Intronic
926712648 2:15894290-15894312 GCTGAGGTGCAGACTGGGGAGGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927515527 2:23669699-23669721 GCTCAGAGGCTGACTGGGGGTGG - Intronic
928175491 2:29030937-29030959 ACAGAGAGGCAGACTTGGAGAGG - Intronic
929033462 2:37670611-37670633 ACTGAGAGCCAGGCTGTGGCTGG - Intronic
929285200 2:40127746-40127768 CCAGAGAGGCAGGATGGGGTGGG + Intronic
929511619 2:42569174-42569196 ACTCAGTGGGAGCCTGGGGTGGG + Intronic
931171178 2:59805092-59805114 ACTAACAGGCAGACAGGGGTGGG + Intergenic
931916542 2:66962782-66962804 CCTGAGAGGCAGAGAGGGGGTGG - Intergenic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932752369 2:74379574-74379596 TCTGAGAGGCTTATTGGGGTTGG - Intronic
934118037 2:88814098-88814120 AGAGAGAGGAAAACTGGGGTGGG + Intergenic
934753327 2:96808578-96808600 GCTGAGCGGCTGAGTGGGGTGGG - Exonic
935199617 2:100845002-100845024 ACTTAGAGGCAGGCAGGGGGTGG + Intronic
935292248 2:101620546-101620568 ACTGAGAGGGTGGCTGGGGAAGG - Intergenic
935379342 2:102435146-102435168 ACTGAGTGGCTCACTGTGGTGGG + Intronic
940621631 2:156120885-156120907 ACTGAGTGACAGACAGAGGTTGG + Intergenic
940738701 2:157482362-157482384 TCTGAAAGGAAGACTGAGGTGGG + Intronic
941069055 2:160935865-160935887 ACTGAGAGGAAGTCTGGTGGGGG - Intergenic
942534592 2:176949833-176949855 AATGACAGGGAGACTAGGGTTGG - Intergenic
942832516 2:180253719-180253741 ACTGTGAGACAGACTGAGGCTGG - Intergenic
946412361 2:219521704-219521726 ACTCAGAGGCAGCCTGAGGCCGG - Intronic
948293906 2:236847077-236847099 GCTGGGAGGCAGACTGTGTTGGG + Intergenic
1169194733 20:3677045-3677067 AGTGAGTGCCAGGCTGGGGTAGG - Exonic
1169210961 20:3766120-3766142 ACTGAGCCCCAGGCTGGGGTAGG - Intronic
1169267705 20:4176753-4176775 CCTGAGAGCCGGACTGGGGCAGG - Intronic
1170014578 20:11766325-11766347 AATGAGAGGAAGGCAGGGGTAGG - Intergenic
1171337037 20:24394145-24394167 ACTGAGAGAGGGACAGGGGTCGG - Intergenic
1171363271 20:24605433-24605455 ACAGAGATACAGACTGGGGGAGG - Intronic
1171460877 20:25297184-25297206 ACTGAGGGGGACACTGGAGTGGG + Exonic
1171474255 20:25395762-25395784 TCTGGGTGGCAGACTGGGATTGG + Intergenic
1172187968 20:33043218-33043240 AAGGAGTGGCAGCCTGGGGTAGG - Intronic
1172474321 20:35226297-35226319 CCTGAGAGGCAGCCTGGGGGAGG - Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173577187 20:44120076-44120098 AATGAGAGGCAGGATGGCGTAGG - Intronic
1174151600 20:48489923-48489945 TCTGAGAGCCAGACCGGGGGTGG + Intergenic
1174158246 20:48531226-48531248 GCTGAAATGCAGACAGGGGTGGG + Intergenic
1174185401 20:48702708-48702730 GCGGACAGTCAGACTGGGGTGGG - Intronic
1175281408 20:57806539-57806561 GCTGGGAGGCTGACTGGAGTTGG - Intergenic
1175799205 20:61791676-61791698 AGTGAGGGGCAGGCTGGGATGGG + Intronic
1176137343 20:63530028-63530050 CATGAGAGGCAGAGTGGGGGAGG - Intronic
1179999167 21:44987350-44987372 TCCGAGAGCCAGGCTGGGGTGGG + Intergenic
1180130122 21:45821740-45821762 GCTGTCATGCAGACTGGGGTTGG + Intronic
1180171395 21:46060553-46060575 ACTGAGAGCCAGGGTGGGGAAGG - Intergenic
1180971960 22:19820496-19820518 ACTGAGGGGCAGAATGGGGTGGG - Intronic
1181085990 22:20439557-20439579 TCTGGGTGGCAGACAGGGGTGGG - Intronic
1181182587 22:21078347-21078369 GCTGAGGGACAGGCTGGGGTAGG - Intergenic
1181414665 22:22750715-22750737 AATGAGAGGCAGGCCGAGGTGGG - Intronic
1181423035 22:22815007-22815029 AATGAGAGGCAGGCTGAAGTGGG - Intronic
1182020792 22:27080087-27080109 TCTGAGAGGCAGGCTGCCGTGGG + Intergenic
1182111260 22:27725335-27725357 ACAGAGTGGCAGAGTGGGGCTGG - Intergenic
1182733291 22:32512456-32512478 CATGAGAGGCAGACTGGTATAGG + Intergenic
1183045249 22:35214299-35214321 ACTGAGAGGAAGTCTGCTGTAGG - Intergenic
1183160608 22:36110556-36110578 AGCGGGAGGCAGATTGGGGTCGG + Intergenic
1183623848 22:38989964-38989986 GCGGAGAGACAGACTGGGGCAGG + Intronic
1184099835 22:42336290-42336312 AGAGAGAGGCTGTCTGGGGTGGG - Intronic
1184190154 22:42889138-42889160 ACTGAGACGGAGCATGGGGTGGG + Intronic
1185380598 22:50505990-50506012 AGAGAGAGGCAGACAGGGCTCGG - Intronic
949437592 3:4046365-4046387 ACTGCAAGGGAGACTGGGGCAGG - Intronic
952616186 3:35276685-35276707 ACTAGGAGGCAGACTCGGCTTGG - Intergenic
952945470 3:38475789-38475811 CCTGAAAGGCTGACTGGAGTAGG - Intronic
953461847 3:43087766-43087788 ACTGAGAGCCAGGCTGGTTTGGG - Intronic
953803475 3:46047716-46047738 TCTGGGTGGCAGACTGGGATTGG + Intergenic
954440321 3:50518206-50518228 ACTGATGGGCAAACTGAGGTTGG - Intergenic
954803161 3:53199137-53199159 AATGAGAGGCAGGCTGTGCTGGG - Intergenic
954861336 3:53693288-53693310 ACCAATAGGCAGAGTGGGGTGGG - Intronic
956033160 3:65061310-65061332 AATGAGAGGGAGGCTGTGGTTGG + Intergenic
956278430 3:67529001-67529023 ATTGAAAGGCACACTGAGGTTGG - Intronic
956621608 3:71226596-71226618 AATGAGATGCAGAAGGGGGTAGG - Intronic
956696265 3:71921761-71921783 GCAGAGCGGGAGACTGGGGTGGG - Intergenic
957982708 3:87531080-87531102 AGTGAGAGGCTGAATGGGGCTGG + Intergenic
960538592 3:118840251-118840273 ACTGAGTGACAGGCAGGGGTTGG - Intergenic
960854274 3:122086744-122086766 TCAGAGAGACAGACTGGGGTGGG - Intronic
961197594 3:125015846-125015868 ACTGACAGCCAGTCTGGGCTGGG - Intronic
961518680 3:127454746-127454768 GCTGAGAGTCAGACAGGGCTTGG + Intergenic
962344520 3:134609666-134609688 ACTGTGAGGCACAGTGGGGCAGG - Intronic
963102191 3:141618386-141618408 ACTGACAGGCAGAATGTGGAAGG + Intergenic
965462086 3:168978396-168978418 TCTGTGAGGCTGACTGGGTTTGG + Intergenic
966915157 3:184580630-184580652 GCTGGGAGGGAGACTGGGGGCGG + Intronic
967038133 3:185663354-185663376 ACTGAGAGGCAGAGGGAGATGGG + Intronic
967108319 3:186271466-186271488 GCTGAGGGCCCGACTGGGGTGGG - Intronic
968635654 4:1677305-1677327 ACGGAGATGCAGACCAGGGTGGG - Intronic
973019860 4:45189104-45189126 AATGAGAAGCAGAGTGTGGTTGG - Intergenic
973328168 4:48885095-48885117 ACTGAGAGGGAGGCTGAGGCAGG - Exonic
973576956 4:52299226-52299248 ACTGAGAGGGAGGGTGGGATTGG - Intergenic
975737300 4:77393823-77393845 TCTGGGTGGCAGACTGGGATTGG + Intronic
976124059 4:81814836-81814858 CCTGAGAGGCAGTATGGTGTGGG - Intronic
977605924 4:98984867-98984889 AAAGAGAGGCAGTCTAGGGTGGG + Intergenic
979593607 4:122508251-122508273 ACTGAAAGGAAGATTGGGTTGGG + Intergenic
980982349 4:139665456-139665478 AGTGAGAGGCAGCCTGGTGCAGG + Intergenic
980989811 4:139729514-139729536 ACTGTGAGGCAGACTTATGTTGG + Intronic
982325950 4:154128284-154128306 GCTGGGAGGCAGCCTGGGGTAGG + Intergenic
982643988 4:157999015-157999037 ATTGAGAGGCAGACAGGGGGAGG + Intergenic
982891869 4:160863988-160864010 AGTCAGAGGCAGACTGAGTTAGG - Intergenic
983413074 4:167423037-167423059 ACTGAAAGGCAGACTGGAGAGGG + Intergenic
986020106 5:3793842-3793864 ACTGAGAGGCTCACTGTGGCTGG - Intergenic
986287088 5:6367326-6367348 ACACAGAGGGAGACTTGGGTAGG + Intergenic
986661360 5:10062956-10062978 ACTCAGAGGCAGACAGAGGAGGG - Intergenic
987332615 5:16870459-16870481 TCTGACAGGCAGGTTGGGGTGGG - Intronic
989594388 5:43142656-43142678 TCTGAGAGACAGAATGGGGGTGG - Intronic
990566618 5:57036212-57036234 AGAGAAAGGCAGACTAGGGTAGG + Intergenic
992860459 5:80904109-80904131 AATAACAGGCAGACTGGGGAGGG + Intergenic
993426136 5:87766205-87766227 AATGAGAGCCAGAAAGGGGTGGG + Intergenic
993491168 5:88551854-88551876 ACTGACAGGCAAACTGTGCTGGG - Intergenic
997523581 5:134538640-134538662 ACTGAGAAGCGCACTGGGGGTGG + Intronic
997526484 5:134556171-134556193 CTTGAGAGGCATCCTGGGGTCGG - Intronic
997590755 5:135070818-135070840 ACTGAGAGCCAGACTGTGCCAGG + Intronic
997611685 5:135220085-135220107 CCTGAGAGGCTGGCAGGGGTTGG + Intronic
999444438 5:151628185-151628207 ACTGGGAGCAAGACTGGGCTGGG - Intergenic
999629774 5:153558957-153558979 ACTGAGAGGCAGCCTGGCTTAGG + Intronic
999636553 5:153629060-153629082 ACAGAGAGACAGGCAGGGGTGGG + Intronic
1000455336 5:161441960-161441982 AATGGGAGGCTAACTGGGGTGGG + Intronic
1000507968 5:162145509-162145531 AGTGAGAGGCAGAGTAGGGATGG - Intronic
1001299518 5:170523813-170523835 ACTGAGAGGCAGACTGGGGTAGG - Intronic
1001437577 5:171712203-171712225 AATGAGAGGCAGGCTGAGGGTGG - Intergenic
1001950086 5:175810259-175810281 ACTGAGACCCAGAGTGGGGAGGG + Intronic
1003402645 6:5803523-5803545 TCTGAGGGGCAGCCTGGGCTTGG + Intergenic
1004468576 6:15908011-15908033 ACTGCGAGGCAAACAGGAGTTGG + Intergenic
1004681104 6:17895546-17895568 ATTGAGATGCAGCCAGGGGTAGG - Intronic
1005699054 6:28381719-28381741 ACTGAGAGGTAAACTAAGGTAGG + Exonic
1006020364 6:31114335-31114357 TCTGAGAGGTGGCCTGGGGTGGG + Intergenic
1006171799 6:32097361-32097383 CCTGTGAGCCAGGCTGGGGTGGG - Intronic
1006191146 6:32210311-32210333 CCTGAGAGGCAGGCAGGGCTGGG + Intronic
1007243682 6:40444797-40444819 ACTGAGAGGGAGACTGTGCGGGG - Intronic
1007402633 6:41612464-41612486 ACGGAGTGGCAGAGTGGGGTAGG - Intergenic
1009424685 6:63501079-63501101 AATGAGAGGAAGACTGGGCCTGG + Intergenic
1009729228 6:67578501-67578523 ACTGGGAAACAGGCTGGGGTTGG + Intergenic
1011233723 6:85192313-85192335 CCAGAGAGGCAGACAGGGTTTGG + Intergenic
1011645834 6:89457017-89457039 TCTGAAAGGTTGACTGGGGTGGG + Intronic
1011888316 6:92125768-92125790 GGAGAGAGGCAGAATGGGGTGGG - Intergenic
1012758400 6:103263571-103263593 ACTTCTAGGCAGACAGGGGTGGG + Intergenic
1012926435 6:105272870-105272892 ACTGAGAAGCAGGCAGGGGGAGG - Intergenic
1017125990 6:151065316-151065338 AGTGAGAGGGAGCCTGGGGCAGG - Intronic
1017801685 6:157901916-157901938 ACTGGGATGAAGACTGGGATGGG + Exonic
1018245253 6:161816351-161816373 AAGGGGAGGCAGAGTGGGGTGGG + Intronic
1018590631 6:165417735-165417757 GCTGAGGGGCAGACAGTGGTGGG + Intronic
1019497440 7:1347039-1347061 GCTGAGAGGCAGGCTGAGGTCGG - Intergenic
1019724730 7:2595273-2595295 ACTGAGAGGCAGGAGGGGCTTGG + Intronic
1021387586 7:20050798-20050820 GCTGAGAGGCAGACTGTAGAAGG - Intergenic
1021457363 7:20844247-20844269 ACTAAGAGGCAGAATGTGGTTGG + Intergenic
1022652410 7:32289296-32289318 ACTCAGAGGCAGGCTGAGGCAGG + Intronic
1023003312 7:35835520-35835542 ACTGAGCAGTAGACTGGGTTTGG - Intronic
1023109133 7:36792482-36792504 ACTGGGAGGCAGTGTGGGATGGG - Intergenic
1023215506 7:37858615-37858637 ACACAGAGGCAGAATGGGCTTGG + Intronic
1024273841 7:47661398-47661420 TCCTAGAGGAAGACTGGGGTGGG + Exonic
1024667541 7:51561768-51561790 TCTGAAAGGCAGACTGTGATGGG + Intergenic
1026737977 7:72960924-72960946 ACTGAGAGGCACATGGGGCTGGG - Intronic
1027054903 7:75043179-75043201 ACTGAGAGGCAGGGCCGGGTCGG - Intronic
1027105757 7:75404144-75404166 ACTGAGAGGCACATGGGGCTGGG + Intronic
1027513178 7:79109186-79109208 ACTGAGTGGCAGGCAGAGGTTGG + Intronic
1029618279 7:101673705-101673727 ACCAAGAGGCAGACTGGGCGCGG + Intergenic
1031172818 7:118313041-118313063 ACTGAGAGGAGGACAGGGGAAGG + Intergenic
1031976286 7:128095615-128095637 CCTGTGTGGTAGACTGGGGTTGG - Intergenic
1032324900 7:130918332-130918354 ACTGAGAGACAGACTTTGCTGGG - Intergenic
1033101012 7:138472067-138472089 AGTGAAAGCCAGATTGGGGTAGG + Intronic
1033438271 7:141354005-141354027 ACTATGAGGTAGACAGGGGTAGG - Intronic
1033794423 7:144831022-144831044 GATGAGAGGCAGGCTGGAGTCGG - Intronic
1034291379 7:149934767-149934789 ACTCAGAGGCAGCGTGGTGTGGG - Intergenic
1034814719 7:154162127-154162149 ACTCAGAGGCAGCGTGGTGTGGG + Intronic
1035168665 7:157006000-157006022 ACTTAGAAGCAGAATGGGGAGGG + Intronic
1035934976 8:3826587-3826609 ACTGAGAGGAAAGCTGGGCTGGG - Intronic
1035970216 8:4239493-4239515 TCTGAGGACCAGACTGGGGTGGG - Intronic
1036149756 8:6286505-6286527 ACAGAAAGGAAGACTCGGGTAGG - Intergenic
1037661932 8:20935257-20935279 ACAGAGAGGAAGGCAGGGGTGGG - Intergenic
1038188871 8:25300526-25300548 AATGAGAGGCTAACTGGGGTTGG - Intronic
1039408949 8:37335832-37335854 TCAGAGAGGCAGACTAGGGCCGG + Intergenic
1040334434 8:46408879-46408901 ACGGAGAGGCAGAGTGAAGTGGG + Intergenic
1040666213 8:49636721-49636743 AATGAGTAGAAGACTGGGGTTGG - Intergenic
1041734819 8:61098748-61098770 TCAGAGAGGCAGACTGGGGGTGG - Intronic
1041935835 8:63331014-63331036 ATTGAGAGGGAGCCTGGGTTCGG + Intergenic
1044664284 8:94620146-94620168 AAAGAGAGGCAGGCTGGGCTCGG + Intergenic
1044858403 8:96498130-96498152 ACTTAGAGGCAGACTGGACGTGG - Intronic
1049210402 8:141383905-141383927 ACTGAGAGACAGGCTGGAGCTGG - Intergenic
1049614253 8:143569264-143569286 CCTGGGAGGGAGACTGGGGGCGG + Intronic
1049662467 8:143825760-143825782 AATGAGAGGCAGCCTTGGCTGGG - Intronic
1050512031 9:6406361-6406383 ACAGAGAGAGAGACGGGGGTCGG + Intergenic
1051431659 9:16985801-16985823 ACTGGGAGGAAGGATGGGGTGGG + Intergenic
1052820382 9:33133835-33133857 ATTGAGATGCCCACTGGGGTAGG - Intronic
1052939952 9:34125626-34125648 ACTGAGAGGGAGAAGGGGGCTGG - Intronic
1054946894 9:70805206-70805228 GGTGAGAGAGAGACTGGGGTGGG + Intronic
1056526398 9:87446867-87446889 ACTGAGGGGCAGGGTGGGGATGG - Intergenic
1057255955 9:93547248-93547270 ACAAAGATGCAGACTGGGTTAGG + Intronic
1057836673 9:98451071-98451093 ACTGAGACTCAGAAAGGGGTGGG - Intronic
1058116456 9:101090529-101090551 TCTGGAAGCCAGACTGGGGTGGG - Intronic
1058634009 9:107018939-107018961 ACTTAGAGGCTGAGTGGGGTGGG - Intergenic
1060967088 9:127717424-127717446 GGTGAGAGGCAGACCTGGGTGGG + Exonic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1061620849 9:131810424-131810446 ACTGAGACCCAGAGTGCGGTGGG - Intergenic
1062343173 9:136102702-136102724 AGTGAGGGCCAGACTGGGCTGGG + Intergenic
1062454739 9:136630128-136630150 GCTGAGGGGCAGCCTGGGGCTGG - Intergenic
1203454380 Un_GL000219v1:151427-151449 TCAGAGAGACGGACTGGGGTGGG - Intergenic
1187033130 X:15509227-15509249 CCTGAGAGGGAGATTGGGGTGGG - Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188864076 X:35292908-35292930 ATTGAGAGGCAGATTGTGGTTGG - Intergenic
1189159135 X:38792696-38792718 ACTGGAAGCCAGAATGGGGTGGG + Intergenic
1189296259 X:39920409-39920431 ACTGAGACCCAGACAGGGGAGGG + Intergenic
1189356068 X:40310691-40310713 ACTGAAAACCACACTGGGGTTGG + Intergenic
1190921671 X:54859341-54859363 ACTGGGAGGCACACTGAAGTAGG - Intergenic
1191049612 X:56177509-56177531 ACTGGGAGGCACACTGAAGTAGG - Intergenic
1192175069 X:68880306-68880328 GCAGAGAGGCAGACTGGGAGGGG - Intergenic
1192212703 X:69137711-69137733 TGGGAGAGGCAGCCTGGGGTGGG - Intergenic
1192260380 X:69502937-69502959 ACTCAGAGGTGGACTGGGGTGGG - Intergenic
1195199468 X:102533496-102533518 ACAGAGAGGGAGACTCGGTTTGG + Intergenic
1196263828 X:113617666-113617688 ACTGAGAGGGAAAGTTGGGTTGG + Intergenic
1199055510 X:143289297-143289319 AGTGAGAGAGAGAGTGGGGTGGG + Intergenic
1199214688 X:145251032-145251054 GTTGAGAGGCAGCATGGGGTGGG + Intronic