ID: 1001300084

View in Genome Browser
Species Human (GRCh38)
Location 5:170527094-170527116
Sequence AGCCAGCCTTGTGATGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 7, 3: 17, 4: 271}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001300084 Original CRISPR AGCCAGCCTTGTGATGAGGG AGG (reversed) Intronic
900379122 1:2375084-2375106 AACCAGGCTTGTTATGAAGGAGG - Intronic
900766453 1:4509274-4509296 AGCCAGCTCTGTGAGAAGGGTGG + Intergenic
900970139 1:5987502-5987524 AACCAGCCTTGGGTTGAGTGAGG - Intronic
901035514 1:6333834-6333856 GGCATGCCTTGTGATGGGGGTGG - Intronic
901848860 1:12002263-12002285 AGACAGCCTGGTGAGGAGGGCGG + Intronic
903728875 1:25474621-25474643 GGACAGCCTTGTGATAAGGGTGG + Intronic
903742926 1:25568688-25568710 GGCCAGCCTTGGCACGAGGGGGG + Exonic
904163304 1:28536822-28536844 AGGCAGCCTGGAGATGAGGGTGG - Exonic
904842723 1:33383803-33383825 AGCCAGCCACGTGAAGATGGAGG + Intronic
904993409 1:34612448-34612470 AGCCAGCCATGTGAAGAACGGGG - Intergenic
905506223 1:38481583-38481605 AGCCAGCCATGGGACTAGGGAGG - Intergenic
906681001 1:47725391-47725413 ATCCAGCCTTGGGCTGGGGGAGG - Intergenic
908984509 1:70000681-70000703 AGTCAGCCTTATGAAGAGTGGGG - Intronic
910850572 1:91646065-91646087 AACCAGCCATGTGATTAGCGGGG - Intergenic
911009406 1:93263147-93263169 ATCCAGGCTTGTGATGGGAGAGG + Intronic
911035233 1:93536558-93536580 AGAGAGCCTTATAATGAGGGTGG - Intronic
911511259 1:98809619-98809641 ATCCAGGCCTGTGATGAGTGGGG + Intergenic
912139228 1:106701443-106701465 AGACAGCCATATGAAGAGGGAGG + Intergenic
912855547 1:113165918-113165940 AGCCTGCCGTGTGACAAGGGAGG - Intergenic
913136672 1:115897510-115897532 AGCCAGCCTCGTGATTAGCAAGG + Intergenic
920362536 1:205429259-205429281 ACACAGCCTTGTGGGGAGGGTGG + Intronic
921382874 1:214542953-214542975 AGCCAAGCTTGTGATTTGGGGGG + Intronic
922488155 1:225992561-225992583 AGCCATTCTGGGGATGAGGGAGG + Exonic
922540340 1:226414395-226414417 AGCCAGTGTGGGGATGAGGGAGG - Intergenic
922979703 1:229815198-229815220 AACCAGCCCTGTTCTGAGGGAGG - Intergenic
923375267 1:233355808-233355830 AGCCATGCTGGTGATGAGTGAGG - Intronic
924264834 1:242270751-242270773 ACCCAGCCTTGGGTTTAGGGAGG - Intronic
1063064268 10:2592490-2592512 AGACAGTCATGTGATGTGGGAGG - Intergenic
1063486675 10:6426735-6426757 TTCCAGCCATGTGATGAGGTAGG + Intergenic
1063981003 10:11451785-11451807 AGCCAGCCTGGTCCTCAGGGAGG - Intergenic
1064326159 10:14353553-14353575 AGGCAGCCTTGTGGAGACGGAGG - Intronic
1066719975 10:38327731-38327753 ACCCAGCCTTGGGTTTAGGGAGG + Intergenic
1067570446 10:47367751-47367773 AGCCAGCCTTTGGCAGAGGGGGG - Exonic
1069581669 10:69570910-69570932 AGGCTGCCAGGTGATGAGGGAGG + Intergenic
1069704614 10:70450492-70450514 AGCCAGCCTAGTGCTGGGGAGGG - Intergenic
1070080362 10:73180196-73180218 AGCTAGCCATGTGAAGAGTGAGG + Intronic
1070469169 10:76760821-76760843 AGCCAGCCATGTGGTGATGAGGG - Intergenic
1071962361 10:90819393-90819415 AGGCAGCTTAGTGATAAGGGAGG - Intronic
1071968559 10:90878218-90878240 AGGCAGACTTGTGCTGAGGCAGG - Intronic
1072206611 10:93210520-93210542 AGGCAGCCATGTGAAGATGGGGG + Intergenic
1073867313 10:107819670-107819692 AGCCAGAAATGTGTTGAGGGTGG + Intergenic
1074357149 10:112796544-112796566 AGCCAGTTTTGTGAAGAGGTGGG - Intronic
1075646259 10:124098889-124098911 AGCCAGGCTTGGGAAGAGGACGG - Intergenic
1076152914 10:128177936-128177958 GGCCAGCCTGGTTATGGGGGCGG - Intergenic
1077333964 11:1995105-1995127 GGCCAGCCTTGGGCAGAGGGGGG - Intergenic
1077582702 11:3427083-3427105 AGGCAGCCATGTGATGAGGGAGG + Intergenic
1079078787 11:17399503-17399525 AGCCAGCCTTATGAAGAGCAAGG - Intronic
1079159504 11:17978835-17978857 AGCTAGCCTTGGGATGAGGCTGG - Intronic
1081233618 11:40618271-40618293 AGACAGCCATATGATGATGGAGG + Intronic
1081747686 11:45484463-45484485 AGGCAGCCTTGTCAGGAGAGAGG + Intergenic
1081749386 11:45498842-45498864 AGCCAGCTTTCTGCAGAGGGAGG - Intergenic
1082026829 11:47578741-47578763 AGCCAAGCTTTTGACGAGGGCGG - Intronic
1082653621 11:55825339-55825361 AGTCATCCTAGTGCTGAGGGTGG + Intergenic
1084239600 11:67809903-67809925 AGGCAGCCATGTGATGAGGGAGG + Intergenic
1084832823 11:71782947-71782969 AGGCAGCCATGTGATGAGGGAGG - Intergenic
1086755563 11:90557938-90557960 CCCCAGGCTTGTGATGGGGGAGG - Intergenic
1087294197 11:96350697-96350719 AGCCAGACTAGTGATTAAGGTGG - Intergenic
1087381374 11:97408961-97408983 GGCCAGCCTGGTGCTGGGGGTGG - Intergenic
1087643871 11:100785088-100785110 AAACAGCATTGTGAAGAGGGAGG + Intronic
1088700430 11:112406759-112406781 AGCCTGCCTGGTGATCAGTGGGG + Intergenic
1090440969 11:126725531-126725553 AGCCAGCTTGGGGATGAGCGGGG - Intronic
1202816947 11_KI270721v1_random:50287-50309 GGCCAGCCTTGGGCAGAGGGGGG - Intergenic
1095885557 12:47185353-47185375 AGACAGCCCTGTGAAGAAGGAGG + Intronic
1098150070 12:67537540-67537562 AGCCAGCCATGTGAGGACGCAGG - Intergenic
1100324447 12:93527933-93527955 AGCCAGCCATGAGATCAGGAGGG - Intergenic
1100435693 12:94569466-94569488 AGACAGCCATGAGATCAGGGTGG + Exonic
1102111200 12:110366756-110366778 AGCCCTCCTAGTGAGGAGGGTGG + Intergenic
1102114503 12:110392240-110392262 ATCCAGGCTTATGATGAGAGAGG + Intronic
1103836431 12:123824741-123824763 AGACAGCAATGTGATGAGGGAGG - Intronic
1104380393 12:128302280-128302302 AGCCAGCACTGTGATGACAGTGG - Intronic
1105572841 13:21620308-21620330 AGGCAGCCCTCTGCTGAGGGAGG - Intergenic
1106627670 13:31437211-31437233 AGCCAGCAGTGTGATGTTGGAGG + Intergenic
1112437897 13:99404643-99404665 AGCCAGTGGTGTGATGAGGAGGG - Intergenic
1113728968 13:112626110-112626132 AGGGAGCCTTGAGCTGAGGGTGG - Intergenic
1114423168 14:22601659-22601681 AGCCAGCCTTGAGACCTGGGAGG - Exonic
1117491154 14:56249344-56249366 AACCAACAATGTGATGAGGGTGG - Intronic
1117613216 14:57505169-57505191 AGGCAGCCGTGTGGTCAGGGTGG + Intergenic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118014396 14:61643567-61643589 GGACAACCTTGTGATGAGCGTGG + Intronic
1118589412 14:67390359-67390381 AGCCTGCTTTGTGAGTAGGGAGG - Intronic
1119635481 14:76269856-76269878 AGCCCGCATTGTGGAGAGGGAGG - Intergenic
1119684746 14:76622765-76622787 AGACAACCATGTGAAGAGGGAGG - Intergenic
1121961503 14:98264401-98264423 AGACAGCCATGTGATGGTGGAGG + Intergenic
1122091350 14:99343010-99343032 AGCCAGGCTTGTGAATAAGGTGG + Intergenic
1122896673 14:104761010-104761032 AGCAAGCCTTGGGATAGGGGAGG - Intronic
1123879575 15:24664427-24664449 AGATAGCCATGTGATGATGGAGG - Intergenic
1127458811 15:59179180-59179202 AGCCAGCCGAGTGATGAGTTTGG - Intronic
1127848689 15:62894472-62894494 AGCCAGCCATGTGATGGGGGAGG - Intergenic
1128832453 15:70781796-70781818 AAACAGCCATGTGATGATGGAGG - Intergenic
1128930703 15:71702733-71702755 AGCCAGCCTTGTGAAGAGCAGGG - Intronic
1128983652 15:72203574-72203596 AACCAGCCATGTGAGGAGGGAGG - Intronic
1129460520 15:75698105-75698127 AGCCAGCCTGCTGGGGAGGGAGG + Intronic
1129724343 15:77893931-77893953 AGCCAGCCTGCTGGGGAGGGAGG - Intergenic
1133351286 16:5102334-5102356 AGGCAGCCATGTGATGAGGGAGG + Intergenic
1134077512 16:11302285-11302307 AGGAGGCCTTGTGAAGAGGGAGG - Intronic
1138066679 16:53948589-53948611 ATCCAGCCTTGCGAGGAGGCAGG + Intronic
1138216300 16:55207841-55207863 GCCCAGCCTTGTGATGACGGGGG - Intergenic
1138480286 16:57298213-57298235 AGCCACGTTTGTGATGAGGGGGG + Intergenic
1140065287 16:71606237-71606259 AGCCAGCCCTGGAATGTGGGAGG - Intergenic
1140692106 16:77494425-77494447 AGACAGCCATGTGATGAAGGAGG - Intergenic
1141806535 16:86345565-86345587 AGCCAGCCATGTGGTGAGCTGGG - Intergenic
1141807559 16:86351946-86351968 AGCCAGCCATGTGGTGAGCTGGG + Intergenic
1143369413 17:6429160-6429182 TGCCACCCTTGGGATGAAGGAGG + Intronic
1144769740 17:17752873-17752895 AGGCACACGTGTGATGAGGGCGG - Intronic
1145764056 17:27445832-27445854 GGCCAGCCTGGAGGTGAGGGAGG + Intergenic
1147198449 17:38783265-38783287 AGACAGCCTTGTGGTGAAGGTGG - Intronic
1147404621 17:40202006-40202028 AACCTGCCTGGGGATGAGGGAGG + Intergenic
1147444194 17:40464803-40464825 AGCCAGCCTTGTGAAGAGCAGGG - Intergenic
1149009851 17:51844992-51845014 AGACAGCCATGTGAAGATGGAGG + Intronic
1151673257 17:75584673-75584695 AGGCAGCCTTCTGGAGAGGGAGG - Intergenic
1151915918 17:77117922-77117944 TGCCAGCCTTGTGTAGGGGGAGG - Intronic
1153811599 18:8756959-8756981 AGACACCCTAGTGATGAGTGAGG + Intronic
1156651065 18:39227888-39227910 CTCCAGCCCTGTGATGAGAGGGG - Intergenic
1157334024 18:46724189-46724211 AGCTAGACTTCTGAAGAGGGAGG - Intronic
1157504111 18:48213990-48214012 AGCCTGCCTTGCGGTGAGAGCGG + Intronic
1158218953 18:55129983-55130005 AGTCAGCCCTGTGAAGATGGAGG + Intergenic
1158414221 18:57235100-57235122 AGCCAAGCTTGTGATAATGGAGG + Intergenic
1159956089 18:74519490-74519512 AGCCAGCCTTGGGAGCAGGAGGG + Intronic
1160174185 18:76579491-76579513 AGGGAGCCTGGTGAGGAGGGAGG - Intergenic
1161479591 19:4503864-4503886 AGCCTGCCTTGGGATGATGATGG + Exonic
1162029161 19:7909950-7909972 TGCCAGCCCTGGGAGGAGGGTGG + Intronic
1162060849 19:8094348-8094370 AGCTAGGGTTGTGATGAAGGTGG - Intronic
1162152231 19:8654858-8654880 TGGGAGCCTTGCGATGAGGGAGG - Intergenic
1164551330 19:29214818-29214840 AGCCAGCTGTGTGATGAGCCTGG - Intergenic
1164647618 19:29871280-29871302 AGCCAGCCTTGTGAGCAGGGAGG + Intergenic
1165408714 19:35645322-35645344 TGCCCGCCCTGTGATGAGAGAGG + Intergenic
1165430178 19:35767707-35767729 ATCCAGCCTTGGGTGGAGGGGGG - Intronic
1166306109 19:41937936-41937958 AGACAGCATTGTCATCAGGGAGG - Intergenic
1166748681 19:45154270-45154292 ACCCAGCCTGGGGATCAGGGAGG - Intronic
925781726 2:7387848-7387870 TGCCAGCCTGGTGATGGTGGGGG + Intergenic
927905472 2:26852601-26852623 AGCCTGGATTGTGACGAGGGAGG - Intronic
929527838 2:42722517-42722539 AGGTAGCCTTGGGGTGAGGGGGG - Intronic
930105227 2:47634007-47634029 AGAGAGCCCTGTGATGACGGAGG - Intergenic
930126792 2:47804894-47804916 AGCCAGCCTGTGAATGAGGGAGG - Exonic
932334604 2:70922817-70922839 AGCCAGGCTTGTGCTCAGAGAGG + Intronic
932497167 2:72151534-72151556 GGACAGGCTTGTGAAGAGGGTGG + Intergenic
932584394 2:73016949-73016971 AGTCAGCCATGTGATCACGGGGG - Intronic
932618706 2:73252868-73252890 AGCCAGCCATGTGATGGGTGGGG - Exonic
933030205 2:77319092-77319114 AGCCAGCCCTGGGATGGGCGTGG + Intronic
933339030 2:80998184-80998206 ACCCAGCCTCTTGATGAGTGAGG + Intergenic
935251479 2:101265758-101265780 ATCCAGCTGTGTGATGGGGGCGG - Intronic
935516048 2:104040214-104040236 AGGGAGCCTTGTGATGAGCTAGG - Intergenic
935609014 2:105001467-105001489 GGCCAGCCTAGTGCTGGGGGTGG - Intergenic
936402456 2:112175731-112175753 AGCCAGCCTTGTCAAAATGGTGG + Exonic
937425754 2:121797175-121797197 AGCCAACCTTGTGCTCTGGGTGG - Intergenic
937589072 2:123591750-123591772 ATCCAGGCCTGTGATGAGAGGGG + Intergenic
940797899 2:158099880-158099902 GTCCAGCCTTGTGATCAGGAGGG - Intronic
941092870 2:161198369-161198391 AGCCAGCAATGTGATGAAGTAGG - Intronic
942385497 2:175438624-175438646 AGACATCCTTGTGAAGATGGAGG - Intergenic
942693497 2:178612552-178612574 AGCCAGCGTGGTGGTGATGGAGG + Exonic
942951786 2:181729707-181729729 ATCCAGCCTTCTGAGTAGGGTGG + Intergenic
945057176 2:205879234-205879256 AGCCAGCGGTGTGATGCGGTCGG - Intergenic
945150488 2:206785332-206785354 TGCCAGCCTGGTGAAGAGGAGGG + Intronic
946145247 2:217725697-217725719 AGCCAACCTTGTGACTTGGGTGG - Intronic
946328838 2:218998701-218998723 AGCCAGCCTAGTGCTCAGGACGG + Intergenic
947289070 2:228551461-228551483 TGCCAGCTTTGAGATGAAGGAGG + Intergenic
947872848 2:233449379-233449401 AACTGGCCTTGTGATGAGGAGGG + Intronic
948353773 2:237361125-237361147 GGCTATCCTGGTGATGAGGGTGG - Exonic
948647808 2:239419170-239419192 ATCCAGCTTTGTCATGATGGGGG - Intergenic
1169095308 20:2892549-2892571 AGTCAGCCATGTGATCAGGAGGG + Intronic
1169262141 20:4147011-4147033 AGCAAGCCATGTGAGGAGGCAGG - Intronic
1169285533 20:4304255-4304277 AGCCTGCCCTGTGCTGGGGGAGG + Intergenic
1169813480 20:9632287-9632309 AGACAGGCTTGTGATCTGGGGGG + Intronic
1170814797 20:19704691-19704713 AGCCAGCCATGGGAAGAGAGGGG + Intronic
1171143847 20:22765009-22765031 AACCAGCCCTGTGATGGTGGGGG - Intergenic
1173126668 20:40342507-40342529 AGCCAGCCTGGTGCTGAGATGGG - Intergenic
1174263937 20:49318264-49318286 AGCCTGCCTTGAGTTGGGGGCGG - Intergenic
1177851780 21:26357815-26357837 AGACGGCCATGTGATGATGGAGG + Intergenic
1179470564 21:41607321-41607343 AGACAGCCATGTGAGGAGGCAGG + Intergenic
1180741517 22:18056264-18056286 AGCCAGTCTGGTGCTGAGGAAGG + Intergenic
1182412155 22:30196378-30196400 AGACAGCATTGTGTTGGGGGTGG + Intergenic
1182823089 22:33236010-33236032 AGAAAGCCATGTGATGATGGAGG + Intronic
1183063273 22:35348143-35348165 AGCCTGCCATGTGAGGTGGGAGG - Intergenic
1183301664 22:37061829-37061851 AGCCAGGCTGGTGGGGAGGGAGG + Intronic
1183406284 22:37632192-37632214 ACCCTGCCTTGAGAGGAGGGAGG - Intronic
1184853453 22:47134042-47134064 AGGCAGCTTTCTTATGAGGGAGG - Intronic
1184869015 22:47221836-47221858 AGAAGGCCATGTGATGAGGGAGG + Intergenic
1185203210 22:49521212-49521234 ACCCAGCCTTGTGAGGACTGGGG + Intronic
949535144 3:4989569-4989591 ATCCAGTCTTGTGATGTGGCTGG + Intergenic
953403532 3:42648048-42648070 AGGCAGCCTTGAGGTGAGAGAGG - Exonic
953418392 3:42735986-42736008 AGCCTGCTTTGGGGTGAGGGAGG - Intronic
954410209 3:50367282-50367304 AGCCAGCCTTGTGTTGGAGAGGG + Intronic
954653498 3:52179408-52179430 AGACAGCCATGTGAAGAAGGAGG - Intergenic
957470566 3:80653503-80653525 CTCCAGGCCTGTGATGAGGGGGG - Intergenic
959583155 3:108002422-108002444 AGCCAGCGATGTGAAGATGGAGG - Intergenic
960871457 3:122253998-122254020 ATCCAGACTTGTAATGTGGGTGG - Exonic
960892488 3:122464304-122464326 AGCCAGCTATGTGATGAGCAAGG - Intronic
961299293 3:125912003-125912025 TGGCAGCCATGTGATGAGGGAGG - Intergenic
963026498 3:140924315-140924337 AGCCAGCCACGTGAAGAGGTGGG - Intergenic
964011756 3:151899985-151900007 ATCCATGCATGTGATGAGGGAGG + Intergenic
965115100 3:164478220-164478242 AGCCTGCAGTGTGATGGGGGTGG - Intergenic
967134071 3:186497969-186497991 AGGCAGCCTAGTGCTGAGGGTGG - Intergenic
968271619 3:197407642-197407664 AGCCTGCCCTGTGAAGAGGTGGG + Intergenic
969279227 4:6158439-6158461 AGCCAGGCCTGTGCTGTGGGTGG - Intronic
969815986 4:9687853-9687875 AGGCAGCCATGTGATGAGGGAGG - Intergenic
970221875 4:13820174-13820196 AGACAGCCATGTGATGACGAAGG + Intergenic
971154274 4:24065113-24065135 CTCCAGCCATGAGATGAGGGAGG - Intergenic
971744803 4:30566189-30566211 CTCCAGGCTTGTGATGAGAGGGG - Intergenic
973253610 4:48086145-48086167 AGAATGCCTTGTGAAGAGGGTGG - Intronic
975461226 4:74655694-74655716 ATCCAGCAATGTGATGAGGAAGG - Intergenic
976913315 4:90336717-90336739 AGCAATCCTGGTGATGATGGTGG + Intronic
977452525 4:97217269-97217291 AGCAAGACTTGTAATGAAGGAGG + Intronic
977565336 4:98574938-98574960 AGCTAGCCAGGTGAAGAGGGTGG + Intronic
978829702 4:113069408-113069430 AGCAACCCTTGTCATGAAGGCGG + Intronic
982418351 4:155163757-155163779 AGACAGCCATGTGACGACGGAGG - Intergenic
982447237 4:155506956-155506978 AGCTGGCCTTGTGATGAGCAGGG + Intergenic
986746255 5:10747738-10747760 GTCCAGCCTTGGGAAGAGGGTGG + Intronic
988563042 5:32298119-32298141 AGCCAGCCTTCTGCTGAACGCGG - Intronic
988829480 5:34973554-34973576 AAACAGCCCTGTGATGAGTGAGG + Intergenic
989279160 5:39621768-39621790 AGCCAGCCTTGAGCAAAGGGCGG - Intergenic
990277740 5:54216053-54216075 AGCCAGCTATAGGATGAGGGTGG - Intronic
990520793 5:56578444-56578466 AGCCAGCTTTGTAGTAAGGGAGG + Intronic
990716778 5:58646165-58646187 ACTCAGCCTTGGGATGAGGATGG - Intronic
992804105 5:80320033-80320055 AGACAGCCTTGTGGGGAGGAAGG - Exonic
997057948 5:130467302-130467324 AGCCGGCCTTGTGATGTGGCAGG - Intergenic
997868575 5:137486890-137486912 AGCCAGCCTTGTCATGACTCTGG - Intronic
999021611 5:148172229-148172251 AGCCACCCAGGTGAAGAGGGGGG + Intronic
999872841 5:155770346-155770368 AGCCAGCCATAGGATGTGGGGGG + Intergenic
1000693931 5:164356902-164356924 AGTCAGCCCTGTGATCAGGAGGG - Intergenic
1001300084 5:170527094-170527116 AGCCAGCCTTGTGATGAGGGAGG - Intronic
1001333336 5:170777601-170777623 AGTCAGCCATGTGTTGAGGAAGG - Intronic
1002295723 5:178230111-178230133 AGCCAGCCGTGTGACGGAGGCGG - Intronic
1002451232 5:179319948-179319970 AGCAAGCCTTGAGATCAGGCAGG - Intronic
1002467622 5:179415585-179415607 AGCCAGCCTTAGGATGAAGCTGG + Intergenic
1003566328 6:7225687-7225709 AGACAGCCTTGTGATAAGCATGG + Intronic
1003939187 6:11007407-11007429 AGACGGCCATGTGAAGAGGGAGG + Intronic
1004488593 6:16092211-16092233 AGGCAGCCTGGTGATTGGGGTGG + Intergenic
1004691553 6:17996520-17996542 AGCCCACATTGTGATGAGAGAGG + Intergenic
1006102617 6:31695112-31695134 AGCCAGGAATGTGATGATGGTGG + Intronic
1006950252 6:37816161-37816183 TGGCAGCCTTGTGATGAATGAGG + Intergenic
1008230616 6:48982177-48982199 AGAAAGTCTTGTGATGATGGAGG - Intergenic
1008613718 6:53206775-53206797 CACCAGCCTGGAGATGAGGGTGG + Intergenic
1008747502 6:54690685-54690707 ATCCAGCCTAGTTAAGAGGGAGG - Intergenic
1009990995 6:70842776-70842798 AGCCAGTGCTGTGATGAGGGCGG - Intronic
1011384881 6:86784952-86784974 AGCCAGCCTTGTTTTGAAGACGG + Intergenic
1013642316 6:112097860-112097882 AGACAGACTTGGAATGAGGGGGG + Intronic
1015818067 6:137230723-137230745 AGTCAGCCTTAAGATGAGGAAGG - Intergenic
1017112012 6:150941153-150941175 AGCCGGCCTTGTGAAGAATGAGG + Intronic
1019511888 7:1421832-1421854 AGCCAGTCTTGTGGTATGGGGGG - Intergenic
1020493852 7:8822509-8822531 CTCCAGGCTTGTGATGGGGGGGG + Intergenic
1020942761 7:14561953-14561975 CCCCAGGCCTGTGATGAGGGGGG - Intronic
1021500750 7:21329903-21329925 AGCCAGACTTGAGAAGAGGAGGG - Intergenic
1022627345 7:32051487-32051509 AGCCAGACTTGTGAAGAGCTGGG + Intronic
1023442663 7:40200478-40200500 AGCCAGCCATGTAATGAGCAAGG + Intronic
1024042368 7:45565352-45565374 GGGCAGCCTTGTGATAAAGGTGG - Intergenic
1024081440 7:45859365-45859387 AGGCAGCCAGGTGATGAGGAAGG + Intergenic
1024282988 7:47734780-47734802 ACACAGCGTTGTGATGATGGTGG - Intronic
1025604071 7:63026149-63026171 AGCCAACGTTGTGATTAGGAAGG - Intergenic
1027605405 7:80292911-80292933 CTCCAGGCTTGTGATGAGAGGGG + Intergenic
1033126232 7:138709661-138709683 AGCCATCCTTCTGATCATGGAGG - Exonic
1033259327 7:139828851-139828873 AGCCAGCATTTTGATCAGGCTGG + Intronic
1034959929 7:155358814-155358836 AGCCCGGCCTGTGATGATGGGGG - Intronic
1034997977 7:155590477-155590499 AGCCAGGCTTGTGAGAAGTGAGG + Intergenic
1035634795 8:1136467-1136489 AGCCAGCCTGACGATGAGGAGGG - Intergenic
1035643650 8:1201757-1201779 ATGCTGCCTGGTGATGAGGGAGG - Intergenic
1035695276 8:1591296-1591318 AGCCAGCGTTAGGAAGAGGGAGG - Intronic
1035761743 8:2073554-2073576 AGGCAGCCCTGGGAGGAGGGAGG + Intronic
1035782702 8:2241209-2241231 CCGCAGCCTTGTGATGAGGAAGG + Intergenic
1036781111 8:11648508-11648530 AGCCAACGTTGTGATTAGGAAGG + Intergenic
1037150259 8:15627097-15627119 AGCCAGACTTGAGAAGAGGATGG + Intronic
1037765191 8:21768425-21768447 AGGCCGCCCTGTGATGAGGCGGG - Intronic
1040847479 8:51859056-51859078 AGCCAAACTTGGGATGGGGGAGG - Intronic
1041332286 8:56739883-56739905 AGCCAGCCCTGAGAGGAGAGCGG - Intergenic
1042359038 8:67861462-67861484 ATCCAGCCTGGAGAGGAGGGAGG + Intergenic
1044125608 8:88455512-88455534 AGCCACCTTTGTGAAGAGTGTGG - Intergenic
1044529393 8:93290515-93290537 ACCCTGCCTAGTGATCAGGGAGG + Intergenic
1044672808 8:94700388-94700410 AGGCAGCAATGTGACGAGGGAGG + Intronic
1045356352 8:101392547-101392569 AGCCAGCATTGTTCTGAGGTTGG - Intergenic
1046600882 8:116315553-116315575 GGCCAGGCTTGTGATGGGAGGGG + Intergenic
1046938448 8:119907994-119908016 AGCTAGCCTCATGATGAGGCTGG + Intronic
1050032378 9:1400240-1400262 GGGAAGCCCTGTGATGAGGGAGG - Intergenic
1050878892 9:10675026-10675048 GCCCTGCCTTGTGATGAAGGGGG - Intergenic
1051957408 9:22713018-22713040 CTCCAGTCTTGTGATGAGAGGGG - Intergenic
1052048558 9:23821784-23821806 AGCCGGCCGGGTGAGGAGGGCGG - Intronic
1053140647 9:35680595-35680617 GGCCAGCCAAGGGATGAGGGTGG - Intronic
1053564747 9:39237192-39237214 AAGCAGCCCTGTGAGGAGGGAGG - Intronic
1053830526 9:42075093-42075115 AAGCAGCCCTGTGAGGAGGGAGG - Intronic
1054132404 9:61381842-61381864 AAGCAGCCCTGTGAGGAGGGAGG + Intergenic
1054600034 9:67112362-67112384 AAGCAGCCCTGTGAGGAGGGAGG + Intergenic
1056445357 9:86660766-86660788 AGCCAGCCCTGTGATCACGAGGG - Intergenic
1059674866 9:116528664-116528686 CTCCAGGCTTGTGATGAGAGGGG - Intronic
1061890158 9:133615032-133615054 AGCCAGCCAGATGAGGAGGGAGG - Intergenic
1061996953 9:134190984-134191006 AGTCAGCCTTGGGAAGAGGCGGG - Intergenic
1062456636 9:136642819-136642841 AGCCAGCCACGTGTTGAGAGCGG - Intergenic
1203565165 Un_KI270744v1:83050-83072 AACCTGCCTTGTGATCAGGATGG - Intergenic
1186641694 X:11462382-11462404 AGCAAGCCTTGGGATGATGTGGG + Intronic
1187564384 X:20433988-20434010 AGACGGCCATGTGATGATGGAGG - Intergenic
1188129247 X:26410724-26410746 AGTCAGCCATGTGACAAGGGAGG + Intergenic
1192506231 X:71685328-71685350 GGCCTGCCTGGTGATGAGGTGGG + Intergenic
1192520466 X:71796220-71796242 GGCCTGCCTGGTGATGAGGTGGG - Intergenic
1192524301 X:71828348-71828370 GGCCTGCCTGGTGATGAGGTGGG + Intergenic
1196778863 X:119363978-119364000 AGACAGCCATGTGATGACAGAGG + Intergenic
1197687542 X:129457665-129457687 AGCCAGCCTTGTGAGGTAGTGGG - Intronic
1197708402 X:129649943-129649965 AGCCAGGCTTGTCTTGGGGGTGG - Intronic
1199817706 X:151413478-151413500 AGACAGCCATGTGAAGATGGAGG + Intergenic
1200876920 Y:8166235-8166257 AGACAGCCATGTGAAGAGAGAGG - Intergenic