ID: 1001302574

View in Genome Browser
Species Human (GRCh38)
Location 5:170546361-170546383
Sequence AGTGCTCTATGCAGCTCAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 132}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001302574_1001302577 15 Left 1001302574 5:170546361-170546383 CCACCTGAGCTGCATAGAGCACT 0: 1
1: 0
2: 2
3: 14
4: 132
Right 1001302577 5:170546399-170546421 CGTTAAAGCCAACAGTCACTTGG 0: 1
1: 0
2: 0
3: 10
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001302574 Original CRISPR AGTGCTCTATGCAGCTCAGG TGG (reversed) Intronic
900947372 1:5838689-5838711 AGATCTCTATTCTGCTCAGGTGG - Intergenic
904707479 1:32402280-32402302 GGTGCTCTGTGTAGCTCAGGAGG + Intergenic
905925929 1:41749790-41749812 TGTGCTCTACGGAGCTCCGGGGG + Intronic
906648785 1:47495363-47495385 ATTGCTCTGTGCAGCTCAGCAGG + Intergenic
906964663 1:50444458-50444480 TGTGTTCTGTGCAGCTCTGGGGG + Intronic
914788962 1:150859602-150859624 AGTGCTCTGGGAAGCTGAGGTGG - Intronic
922232528 1:223699459-223699481 AGGGCTCTAGGCAGCTCTGGTGG - Intergenic
923005820 1:230048800-230048822 AGTCTTCTGTCCAGCTCAGGTGG - Intergenic
923057590 1:230438858-230438880 AATGCTCCATGCAGATGAGGAGG - Intergenic
923093224 1:230755090-230755112 GGTGCTGAGTGCAGCTCAGGAGG + Intronic
923418509 1:233789335-233789357 TGTGATCTCTGCTGCTCAGGAGG + Intergenic
923651155 1:235875265-235875287 AGTGATCTATGCAGCTACAGTGG - Intronic
1063685208 10:8230431-8230453 AGTGCTCTATGTACATCAGCTGG + Intergenic
1073544067 10:104334416-104334438 AGTGCTATATGCAAATCAAGAGG - Intronic
1078478720 11:11657533-11657555 AGTGCTCCAGCCAGCCCAGGAGG + Intergenic
1080592072 11:33733181-33733203 AGGGCTCTGTGCTGCTCTGGAGG - Intronic
1083715399 11:64572363-64572385 AGGGCTCTTTCCAGCACAGGAGG + Exonic
1085722598 11:78925925-78925947 AGTGCACTATTTGGCTCAGGAGG + Intronic
1086688775 11:89764441-89764463 AGTGCTTTGGGCAGTTCAGGCGG + Intergenic
1086717082 11:90075516-90075538 AGTGCTTTGGGCAGTTCAGGCGG - Intergenic
1088735653 11:112725752-112725774 AGTGCTTCAGGGAGCTCAGGAGG + Intergenic
1088866954 11:113857294-113857316 AGTGCTTTATGCAACCCAGAAGG - Intronic
1089561237 11:119344284-119344306 AGTGCTCCATGCAGAACGGGAGG - Intronic
1091219740 11:133923070-133923092 TGTGCTCTGTGTAGCTCATGGGG - Intronic
1093067535 12:14674156-14674178 ATTGATCCATGCAGCTCAGGAGG + Intronic
1096262390 12:50100987-50101009 AGTGCTCTGGGGAGCTCAGATGG - Intergenic
1097359626 12:58644774-58644796 TGTGCACTTTGCAGCTCAGGAGG + Intronic
1097951474 12:65433906-65433928 AGTACTCCCTGCAGATCAGGTGG - Intronic
1098270008 12:68761006-68761028 GTTGCTCCATGCAGATCAGGAGG + Intronic
1100507090 12:95232925-95232947 TGTGCTCTTAGCAACTCAGGAGG - Intronic
1103972152 12:124679009-124679031 AGTGCTCAATGCATGTCAGCTGG - Intergenic
1107399561 13:40056041-40056063 AGTGCTCTACTGAGATCAGGAGG + Intergenic
1108000423 13:45900976-45900998 AGTGCCATTGGCAGCTCAGGTGG - Intergenic
1117665444 14:58051847-58051869 AGTGCTCTATGAAACTCAGTTGG - Intronic
1118345420 14:64937144-64937166 CCTGATCTATTCAGCTCAGGAGG - Intronic
1118632393 14:67717674-67717696 AGTGCTCCAGGCATCTCAGTGGG + Intronic
1119418535 14:74492878-74492900 AGGGCTGTATCCAGCTCTGGTGG - Intronic
1121806721 14:96833148-96833170 ATTGCTCTATGAAGCTGAGAGGG - Intronic
1125056904 15:35370680-35370702 AATGCTCAATGCTGGTCAGGAGG + Intronic
1125727250 15:41874381-41874403 AGAGCTCCATGTTGCTCAGGTGG + Exonic
1128853086 15:70981912-70981934 AGGGCTCTATGCATCTGTGGAGG - Intronic
1134084570 16:11347454-11347476 AGTGCTCCAGGCAGCTCAGTTGG - Intronic
1136612081 16:31372371-31372393 AGTCCTCCACGCAGCTCTGGGGG - Exonic
1139303908 16:65967315-65967337 ACTGCTCTATGCTGGTCAGTGGG - Intergenic
1139752166 16:69115538-69115560 AGTGCCCTCTGGAGCCCAGGAGG - Exonic
1139959443 16:70709355-70709377 AGTGATCTCTGCAGCTCAGGAGG - Intronic
1142355394 16:89599273-89599295 AGGGCCCTGTGCAGGTCAGGGGG + Intergenic
1143592984 17:7896904-7896926 AGTGCTTTAGGAGGCTCAGGCGG - Intronic
1149268860 17:54955290-54955312 AGTTCTGGATCCAGCTCAGGTGG + Intronic
1150986351 17:70201972-70201994 ATAGCTGTATGCAGCTCAGCAGG + Intergenic
1152093208 17:78258160-78258182 GGTGCTATAGGCAGCACAGGAGG - Intergenic
1152284935 17:79406886-79406908 ACTCCTCTATGCAGCTGAAGTGG + Intronic
1158378546 18:56902117-56902139 ACTGCTATATGCAGTTCCGGAGG - Intronic
1159021100 18:63143848-63143870 AATGCTGTGTGCAACTCAGGCGG - Intronic
1160160471 18:76466557-76466579 AGTGCTCTATGCAGGTGCCGGGG + Intronic
1160439432 18:78878008-78878030 AGTGTTCTCTGCAGCTCAGCGGG + Intergenic
1161725456 19:5925812-5925834 GCAGCTCCATGCAGCTCAGGGGG - Intronic
1162359754 19:10211810-10211832 AGTGCTCTAGGAGGCTCAGGCGG - Intronic
1162803610 19:13124662-13124684 AGTCCTTCATGCAGCTCAGCAGG - Intronic
1166867032 19:45845232-45845254 TGTGGTCTCAGCAGCTCAGGAGG - Intronic
1167172655 19:47843527-47843549 AGTGCTCTGAGAAGCTGAGGAGG + Intergenic
1168168473 19:54571416-54571438 AGTTCTCTGTGCAGGGCAGGTGG + Intergenic
926417424 2:12663580-12663602 GCTTCTCTCTGCAGCTCAGGGGG + Intergenic
926947153 2:18200924-18200946 AGTGCTCTACACAGTTCAGATGG - Intronic
930186425 2:48416342-48416364 AGGGCTCTTTGCAGTTCAGGTGG - Intergenic
934605483 2:95692011-95692033 AGTTGCCTATGCAGCTCTGGAGG - Intergenic
935756312 2:106278678-106278700 AGTGCTCCATGAAGCTCTGTGGG + Intergenic
936113167 2:109681799-109681821 AGTGCTCCATGAAGCTCTGTGGG - Intergenic
936538942 2:113334556-113334578 AGTTGCCTATGCAGCTCTGGGGG - Intergenic
940666996 2:156621049-156621071 GGTTCTCTATGCAGCCTAGGAGG + Intergenic
945335247 2:208584191-208584213 ATTGCTCAATGGACCTCAGGAGG - Intronic
945651377 2:212564651-212564673 AGTGCTCTATGCATTTCTGAGGG + Intergenic
945806904 2:214501315-214501337 AGTGTTCTCTCCAGCTCTGGTGG + Intronic
946099166 2:217304047-217304069 AGTGCTCAATGCATGTCAGCTGG + Intronic
946228200 2:218276043-218276065 CATGCTCTATGCTGCTCTGGGGG - Exonic
946896025 2:224325139-224325161 AGTGCTCTGAGAAGCTGAGGTGG + Intergenic
1172221266 20:33276652-33276674 GGTGCTTTCTGAAGCTCAGGAGG - Intronic
1172318521 20:33976712-33976734 AGTGTTCTATGCAGCCTACGAGG + Intergenic
1173229487 20:41183039-41183061 AGTGCACTAGGCAGCTGGGGCGG - Exonic
1173561264 20:44007334-44007356 AGTGCCCTATGCAAATCAGTTGG + Intronic
1174341693 20:49901157-49901179 GCTGCTCTATGAAGCTGAGGGGG - Intergenic
1175751126 20:61498843-61498865 AGTGCTCTGAGGACCTCAGGTGG + Intronic
1177905317 21:26966377-26966399 AGCGCACTATGCTGCTCGGGTGG - Exonic
1182895318 22:33854985-33855007 AGAGCACTTTCCAGCTCAGGAGG + Intronic
1184144938 22:42604332-42604354 AGGGCTCGATGCTGCTTAGGAGG - Intronic
949508614 3:4749403-4749425 AGGGCTATAATCAGCTCAGGGGG - Intronic
951638473 3:24806902-24806924 AGTGCTCTTCACAGCTAAGGTGG - Intergenic
952399579 3:32951098-32951120 AGTGCTTTAGGAAGCTGAGGTGG + Intergenic
953980849 3:47412313-47412335 ACTGCTCTATGCAGCTGTGCAGG + Exonic
954701496 3:52453124-52453146 AGTGCTATAGCCAGCTCTGGGGG - Intronic
955220256 3:57017436-57017458 ACTGCTCCCTGCAGCTCAAGGGG + Intronic
955858310 3:63298540-63298562 ATTGCTCAAGGCTGCTCAGGAGG - Intronic
957855857 3:85877058-85877080 AGTGTTATATGCAGCTAAGATGG + Intronic
961652363 3:128422867-128422889 AGTGCTCCCAGCAGGTCAGGTGG - Intergenic
966659117 3:182394386-182394408 AGTGCTATATCCATCTGAGGAGG - Intergenic
966928535 3:184660963-184660985 AGAGCTCTCTGGAGCTGAGGAGG + Intronic
967138535 3:186532992-186533014 AGAGCTCTGTGCAGCTGAGGGGG - Intergenic
970867284 4:20773514-20773536 AGGGCTCTCTGGAGCTCAGACGG + Intronic
971017672 4:22505407-22505429 AGTGCTTTGGGCAGCTGAGGTGG + Intronic
975878384 4:78870842-78870864 AGTACTCTATGCTGCTGTGGCGG - Exonic
976649082 4:87416097-87416119 AGTTCTCTCTGCAGCTAAAGGGG - Intergenic
982107127 4:152020876-152020898 ACTGCTCCCTGCAGCTCAGCAGG - Intergenic
984550849 4:181157096-181157118 AGTGCTCTCTTCAGCCCTGGAGG - Intergenic
984704406 4:182837201-182837223 GGTGCTCTGAGCAGCTCAGGTGG - Intergenic
985710604 5:1426289-1426311 AGTGCTCTGGGAAGCTGAGGCGG + Intronic
988064791 5:26219636-26219658 AGTGCTCTTTGCTGAGCAGGAGG - Intergenic
992062346 5:73066243-73066265 AGTGCTCCCTGAAGCTCAGAGGG - Intronic
997515657 5:134487526-134487548 GCAGCTCTCTGCAGCTCAGGTGG + Intergenic
999503088 5:152166199-152166221 AGTGGTCTTGGCAGCTAAGGAGG + Intergenic
1001167523 5:169384061-169384083 AGTGCTCTAGGCTGGTCAGCTGG + Intergenic
1001302574 5:170546361-170546383 AGTGCTCTATGCAGCTCAGGTGG - Intronic
1001803715 5:174565563-174565585 AGAGCTCTATGCATCTCATTGGG - Intergenic
1010939645 6:81901210-81901232 AGTGTTCTATGCAGACCATGAGG + Intergenic
1011476224 6:87751781-87751803 AGTGCTCAATGGTGCCCAGGCGG - Intergenic
1017173973 6:151484515-151484537 AGTGCTTTAAGAGGCTCAGGTGG - Intergenic
1017606914 6:156144644-156144666 AGTGCTGTAGGGAGCTCAGCAGG + Intergenic
1018900875 6:168051163-168051185 GGTGCTCTGTGCACCTCAGTGGG - Intergenic
1019290572 7:248197-248219 TGTGCTCTGTGCGGCTCAGCGGG - Intronic
1019290588 7:248265-248287 TGTGCTCTGTGCGGCTCAGCGGG - Intronic
1021647269 7:22800545-22800567 AGTGCTCAATGGTGCCCAGGCGG + Intergenic
1021692570 7:23244999-23245021 AGTGCTGTAGGCAGCTGAGGTGG + Intronic
1023773545 7:43582873-43582895 CGCGCCCTCTGCAGCTCAGGGGG - Intronic
1026375634 7:69747672-69747694 AGTACTCCAAGCAGCTCATGCGG - Intronic
1028433809 7:90778581-90778603 AGTCCTTTATGCAGCCCAGAAGG + Intronic
1029278974 7:99424731-99424753 GGAGCACTCTGCAGCTCAGGAGG - Intronic
1032737072 7:134702362-134702384 AGCTTTCTATGCAGCTGAGGGGG - Intergenic
1034684148 7:152954958-152954980 AGTGCTCTGGCCAGCTTAGGGGG + Intergenic
1036463278 8:8973280-8973302 AGTGATCTGTGGAGCTCAGATGG + Intergenic
1038536154 8:28354038-28354060 AGTGCTAGCTGCAGCCCAGGTGG + Intronic
1039999875 8:42566818-42566840 AGTCCTCTTTGCAGCCTAGGAGG - Intergenic
1040597309 8:48851538-48851560 AGGGCTCTTAGCAACTCAGGAGG + Intergenic
1041031915 8:53745482-53745504 CGTGCTCTGTGAAGCTCAGTGGG - Intronic
1041152267 8:54947721-54947743 AGTGCTCTGGGAAGCTGAGGTGG + Intergenic
1042588021 8:70363978-70364000 AATGCTATATGCAGTACAGGTGG + Intronic
1042799100 8:72698673-72698695 AGTTCTCTATTCTGCTCAGTTGG - Intronic
1044151255 8:88777157-88777179 AGTACTCTATCCAGCTCAGGTGG + Intergenic
1045063194 8:98425735-98425757 GGTGCTCTGTGTAGCTCTGGAGG - Intronic
1052066723 9:24031205-24031227 AGTGATCTATGCAACTCTGTGGG + Intergenic
1053424442 9:38001904-38001926 CGTGCTCTCTGGAGCTCATGGGG - Intronic
1057727812 9:97580674-97580696 TGTACTCTATGCAGTTTAGGTGG + Intronic
1058244304 9:102603968-102603990 AGTGCTCAATGTTGCCCAGGCGG - Intergenic
1060940083 9:127538150-127538172 GGTGCTCTGTGGATCTCAGGGGG + Intronic
1061200501 9:129135752-129135774 AGTGCTCGATGCTTCACAGGTGG + Intronic
1187840603 X:23483221-23483243 AGTGCTAAATGCATCTCAGGTGG + Intergenic
1192265006 X:69531833-69531855 AGTGCTCTTTTCAGCTGGGGAGG + Exonic
1195696115 X:107668824-107668846 AGTGCTCTGGGAAGCTCAGCTGG + Intergenic
1196864467 X:120058407-120058429 AGTCCTCTATGGAGTTCTGGAGG - Intergenic
1196878634 X:120177924-120177946 AGTCCTCTATGGAGTTCTGGAGG + Intergenic
1198478275 X:137016897-137016919 AGTGCTTTGTGAAGCTGAGGTGG - Intergenic