ID: 1001304292

View in Genome Browser
Species Human (GRCh38)
Location 5:170560533-170560555
Sequence CACAACACTGCTGTGTGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 245
Summary {0: 1, 1: 0, 2: 0, 3: 48, 4: 196}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001304292_1001304304 3 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304304 5:170560559-170560581 CCGGGGATCAGGGACCAGGATGG 0: 1
1: 0
2: 3
3: 26
4: 262
1001304292_1001304297 -8 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304297 5:170560548-170560570 GTGTTGTGCCCCCGGGGATCAGG No data
1001304292_1001304308 23 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304308 5:170560579-170560601 TGGTCCTTTCTTGGTGGTGAAGG 0: 1
1: 0
2: 1
3: 20
4: 286
1001304292_1001304309 24 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304309 5:170560580-170560602 GGTCCTTTCTTGGTGGTGAAGGG No data
1001304292_1001304307 17 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304307 5:170560573-170560595 CCAGGATGGTCCTTTCTTGGTGG 0: 1
1: 0
2: 0
3: 12
4: 131
1001304292_1001304310 25 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304310 5:170560581-170560603 GTCCTTTCTTGGTGGTGAAGGGG No data
1001304292_1001304298 -7 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304298 5:170560549-170560571 TGTTGTGCCCCCGGGGATCAGGG 0: 1
1: 0
2: 0
3: 3
4: 67
1001304292_1001304311 26 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304311 5:170560582-170560604 TCCTTTCTTGGTGGTGAAGGGGG 0: 1
1: 0
2: 2
3: 35
4: 287
1001304292_1001304299 -1 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304299 5:170560555-170560577 GCCCCCGGGGATCAGGGACCAGG 0: 1
1: 0
2: 2
3: 26
4: 241
1001304292_1001304305 14 Left 1001304292 5:170560533-170560555 CCCTGTCACACAGCAGTGTTGTG 0: 1
1: 0
2: 0
3: 48
4: 196
Right 1001304305 5:170560570-170560592 GGACCAGGATGGTCCTTTCTTGG 0: 1
1: 0
2: 0
3: 12
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001304292 Original CRISPR CACAACACTGCTGTGTGACA GGG (reversed) Intronic
902599273 1:17530126-17530148 AACAAGACTGCTGTGTGGCCAGG - Intergenic
903333515 1:22609713-22609735 CACTCACCTGCTGTGTGACATGG - Intergenic
903880914 1:26508600-26508622 CACAAAACTGCTGTGTCAATTGG + Intergenic
904875271 1:33649985-33650007 CACACCATGGCTGGGTGACACGG + Intronic
907840131 1:58148918-58148940 CACACCACAGCTCTGAGACAGGG - Intronic
909311169 1:74151415-74151437 TACAACAGTACTATGTGACAAGG + Intronic
909498783 1:76310303-76310325 CACAACATTGCAATGTGTCAAGG - Intronic
910368112 1:86487873-86487895 CCCATAACTGCTGTGTGTCATGG - Intronic
911521527 1:98935805-98935827 CAGAACACTGCTTTATGCCATGG + Intronic
913123951 1:115768140-115768162 CACATCCCAGCTGTGTGACAAGG + Intronic
914804716 1:150983594-150983616 CACAACACCCCTGTGAGGCAAGG + Intronic
915210582 1:154305907-154305929 TGCAACACTGCTGAGTGACCTGG + Intergenic
915284747 1:154845609-154845631 CGCAGCATTGCTGTGTGGCATGG + Intronic
915733062 1:158067634-158067656 CACCAACCTGCTGTGTGACTTGG - Intronic
916421417 1:164641177-164641199 CACAAGTCTGCTGTGGCACATGG - Intronic
916542395 1:165769380-165769402 TACCACAGTGCTGCGTGACACGG + Intronic
919276715 1:195427666-195427688 CACAGAACTTCTGTGTGCCAAGG - Intergenic
919845650 1:201640503-201640525 CACCACACTTCTGGGAGACAGGG - Intronic
919998922 1:202780148-202780170 AACAAAACTGCTGGGTCACAAGG - Intronic
921671426 1:217928023-217928045 CCCAAAGCTGCTATGTGACAAGG - Intergenic
922068061 1:222163451-222163473 CACAATCTTGCTGTGTGACAAGG - Intergenic
922247289 1:223813048-223813070 TACAAGACTGCTGGGTCACAGGG + Intronic
1065958189 10:30711250-30711272 CTCCCCACTGCTGTGTCACAGGG - Intergenic
1066433334 10:35373364-35373386 CCCAACACTGCTGGGTGGCAAGG - Intronic
1068523687 10:58105029-58105051 CACAACAACGCTGTGAGAGAAGG + Intergenic
1071371480 10:84955961-84955983 TGCAACACTGCTTTCTGACATGG + Intergenic
1071941871 10:90599597-90599619 CCTAACTCTGCTTTGTGACAAGG - Intergenic
1077035173 11:490995-491017 CACACCATGGCTGGGTGACAGGG - Exonic
1077473178 11:2774383-2774405 CACAACACAGCTGTGCCCCATGG - Intronic
1078744831 11:14102534-14102556 CAAAACTGTGCTGTGTGATATGG - Intronic
1078847084 11:15128044-15128066 CACAAATTTGCTGTGTGACTTGG + Intronic
1081589333 11:44410083-44410105 CACCACTCCGCTGTGTGACCTGG + Intergenic
1083724868 11:64622842-64622864 CACCACCCTGCTGGCTGACATGG - Exonic
1086936662 11:92752710-92752732 TATCACAGTGCTGTGTGACATGG + Intronic
1087926383 11:103923457-103923479 CACAAGCCTGTTATGTGACAAGG + Intronic
1088717572 11:112562123-112562145 CACAACAATGCTATGAGACTGGG - Intergenic
1093461587 12:19412134-19412156 CAGAACACCTCTGTGTGACTTGG - Intronic
1095968374 12:47884323-47884345 CACAACAGTTCTGTGAGGCAGGG + Intronic
1101513144 12:105410596-105410618 CACAATACTGCTGTGAGGTAGGG - Intergenic
1105119175 13:16749709-16749731 TTCAACACTGCTGTATGAAAGGG - Intergenic
1109278928 13:60332976-60332998 AAGAAAACTGCTGTGTGAGAGGG + Intergenic
1112159796 13:96855344-96855366 CACACCACTGTTGAGTGACAAGG + Intergenic
1115306565 14:31939657-31939679 CAAAACACTGCTAAGTGTCAAGG + Intergenic
1116347239 14:43809857-43809879 CACGAGACTACTGTGTGATAGGG - Intergenic
1117474767 14:56082940-56082962 CAGAACACTGCTTTCTGCCAAGG - Intergenic
1117884894 14:60350022-60350044 CTCAACACTGGTTTGTGAAAAGG - Intergenic
1117950425 14:61077982-61078004 CCTAACAATGCTTTGTGACAGGG - Intronic
1118277450 14:64398115-64398137 CACAATTCTGCTCTGAGACAAGG - Intronic
1120194419 14:81466742-81466764 CACCACACTGGTGGGTGAGATGG + Intergenic
1122617037 14:103025840-103025862 CACAACACTGATGAATCACACGG + Intronic
1122855534 14:104558314-104558336 CACAACATTGCTGTTAGCCAAGG + Intronic
1122984041 14:105204015-105204037 CACACCAGTGCTGTGTGACCTGG - Intergenic
1123328657 15:18800393-18800415 CTCAAAACTGCTGTATGAAAGGG - Intergenic
1123374917 15:19568221-19568243 CTCAAAACTGCTGTATGAAAGGG - Intergenic
1125634864 15:41179073-41179095 CACAACACTGCACTCTGACCTGG - Intergenic
1126888107 15:53174298-53174320 CACAACAGTGCTGTGGCACCAGG - Intergenic
1128557596 15:68642256-68642278 CCCAACCCTGCTGTGTGACTTGG - Intronic
1130569814 15:85031973-85031995 CAAAGCACTGGTGTGTGCCAGGG - Intronic
1137433122 16:48434319-48434341 CAGAACACTGCTGCAGGACAGGG - Intronic
1137777251 16:51066254-51066276 CAGAACACTGCTCTGGGAGAGGG - Intergenic
1138047180 16:53737652-53737674 CATATTACTGCTGGGTGACAAGG - Intronic
1138408168 16:56815677-56815699 CACAACAGTGCTGTGAGGTAGGG + Intronic
1139964381 16:70737399-70737421 CACAACCCGGCTGTGTGTCTCGG + Intronic
1141829446 16:86501579-86501601 CGCTCCACTGCTGTGTGACATGG - Intergenic
1142394022 16:89821115-89821137 CCCCACACTGCTCAGTGACAAGG - Intronic
1144024662 17:11267442-11267464 CACAACTCCAATGTGTGACAAGG - Intronic
1144346329 17:14353297-14353319 AACCACAATGCAGTGTGACAAGG + Intergenic
1144909814 17:18672021-18672043 CTCATCACTGCTGCGTGACGTGG + Intronic
1145888876 17:28400830-28400852 CACCTCACAGCTGTGTGACCGGG + Exonic
1146589014 17:34111721-34111743 CAAAACACTGCTTTGGGAGAAGG + Intronic
1147941898 17:44054682-44054704 CCCATCACTGCTGAGTGGCAGGG - Intronic
1150135172 17:62691403-62691425 CACACCACTGATAAGTGACATGG - Intronic
1150729366 17:67678518-67678540 CAGACCACTGCTGAGTGAAAAGG - Intronic
1151362120 17:73595397-73595419 CACAATATTGGTGTGTGCCAGGG + Intronic
1153992607 18:10413690-10413712 CACAACAAAGCTGAATGACATGG + Intergenic
1155149795 18:23113825-23113847 CAAAACACTGCGGTGTGGGAGGG + Intergenic
1156397152 18:36708741-36708763 CACATCACTGCTGCTTGACAGGG - Intronic
1156401961 18:36747668-36747690 CACATCACTGCTGTGTCTCCAGG - Intronic
1157574906 18:48737036-48737058 CACAGGACTGCTGGGTGACATGG - Intronic
1158963493 18:62604992-62605014 CACAAAACTGCTCAGTGACAGGG + Intergenic
1160365478 18:78321835-78321857 CAGAGCACTCCTGTGTGACTGGG + Intergenic
1160684741 19:428363-428385 CACCACACTGCTGTCTGTCATGG + Intronic
1161009213 19:1952123-1952145 CCCAACCCTTCTGTGTGAAAGGG + Intronic
1161731485 19:5963680-5963702 GACAACACTGGTGTGTGAAGCGG + Intronic
1162930820 19:13956631-13956653 CACAACCAGGCTGTGTGACTTGG - Intronic
1163094815 19:15049383-15049405 CACACCACAGCTGTGTGCCAAGG + Exonic
1163215125 19:15871025-15871047 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1163228294 19:15980174-15980196 CTCAGCTCTGCTGTGTGACTTGG - Intergenic
1164825004 19:31278469-31278491 CACAACCCTGCTGGATGAGAAGG - Exonic
1165077754 19:33290277-33290299 CACACACCTGCTGTGTGACCCGG - Intergenic
928831805 2:35495172-35495194 CACATCACTGCTTTTTGCCATGG + Intergenic
930204400 2:48573550-48573572 CACAACACTGATGTGGGGCTTGG - Intronic
933726432 2:85430113-85430135 CCCAGCACTGCTGAGTCACAGGG + Intronic
934956679 2:98627793-98627815 CACTGAACTGCTGTGTGGCAGGG + Intronic
935373983 2:102376847-102376869 GACTACACTGCTGTGTGATTTGG - Intronic
935658670 2:105446882-105446904 CACACCCTTGCTGTGTGCCAGGG + Intergenic
935665576 2:105509463-105509485 CTCAACATTGCTGAATGACAGGG + Intergenic
936480627 2:112881647-112881669 CACACATCTTCTGTGTGACAAGG + Intergenic
938161519 2:128988678-128988700 CAAAGCACTGCTGTTTGTCAAGG + Intergenic
938586832 2:132699138-132699160 CACCACTCGGCTGAGTGACAAGG - Intronic
938903675 2:135819462-135819484 CACACGATGGCTGTGTGACAGGG - Intronic
939347291 2:140982202-140982224 CAGAGCATGGCTGTGTGACAGGG - Exonic
941664246 2:168228426-168228448 TACAACACTGATGAGTGAAAAGG - Intronic
943526527 2:189023221-189023243 CACACCACTGCTGTTTAACCTGG + Intergenic
948759620 2:240182680-240182702 CACAGCACTGCTGAGTGTCTGGG + Intergenic
948856195 2:240731807-240731829 CCCATCACTGCTGTGCCACAGGG + Intronic
1169359403 20:4935421-4935443 CACAACTCTGCTGTTTAATAAGG + Intronic
1170878128 20:20269967-20269989 CACAACAGGCCTGTGAGACAGGG - Intronic
1171717784 20:28510080-28510102 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171717891 20:28511958-28511980 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718006 20:28513834-28513856 CTCCAAACTGCTGTGTGAAAAGG - Intergenic
1171718111 20:28515712-28515734 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718196 20:28517252-28517274 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718302 20:28519130-28519152 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718416 20:28521007-28521029 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718526 20:28522885-28522907 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718634 20:28524762-28524784 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718744 20:28526640-28526662 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718852 20:28528519-28528541 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171718957 20:28530397-28530419 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719068 20:28532275-28532297 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719172 20:28534153-28534175 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719256 20:28535690-28535712 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719367 20:28537568-28537590 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719475 20:28539446-28539468 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719584 20:28541324-28541346 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719686 20:28543201-28543223 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719797 20:28545078-28545100 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171719903 20:28546956-28546978 CTCCAAACTGCTGTGTGAAAAGG - Intergenic
1171719998 20:28548816-28548838 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720103 20:28550694-28550716 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720235 20:28553085-28553107 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720341 20:28554963-28554985 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171720450 20:28556840-28556862 CTCAAAACTGCTGTGTGAAAAGG - Intergenic
1171728042 20:28645006-28645028 CTCAAAACTGCTGTGTGAAAAGG + Intergenic
1172832180 20:37845397-37845419 CACAGAGCTGCTGTGTGCCACGG + Intronic
1173351384 20:42248618-42248640 CTCAACACTGCTGTGTGGCCAGG - Intronic
1173383248 20:42565255-42565277 CCCCACGTTGCTGTGTGACAGGG + Intronic
1173402691 20:42739242-42739264 CAAAACATTGGTGTGTAACAAGG + Intronic
1177542897 21:22518887-22518909 CACTAGACTTCTGTGTTACATGG - Intergenic
1179668515 21:42929149-42929171 AACTACACTGCTGGGTGGCACGG - Intergenic
1179814219 21:43893685-43893707 TTCAACACTGCTGTGTAACAGGG + Intronic
1181994471 22:26864527-26864549 CACAACAGTTCTGTGAGGCAGGG - Intergenic
1183224581 22:36540732-36540754 CACAGCACTGCTTGGTGGCAGGG - Intergenic
1184527749 22:45035546-45035568 CCCAATACTGCTGTGAGGCAGGG + Intergenic
949533190 3:4977497-4977519 CACCCCACTGCTGAGTGACCTGG - Intergenic
950064942 3:10104536-10104558 CGCAACTCTGATGTGTGGCAGGG + Exonic
950264431 3:11563735-11563757 CAGACCCCTGCTGTGTGCCAGGG - Intronic
952028666 3:29114241-29114263 CTCAACCCTGCTGAGTGATATGG - Intergenic
952101038 3:30013309-30013331 CACAAGAGTGCTCTGAGACAGGG + Intergenic
952539583 3:34353637-34353659 CACAACACTGTTTATTGACAGGG + Intergenic
954612327 3:51952156-51952178 CAAAACTCAGCTGTGTGACCTGG + Intergenic
955897132 3:63712433-63712455 CACTGCACTCCTGGGTGACAGGG + Intergenic
955979313 3:64508779-64508801 GACTCCACTGCTGTGTGGCAAGG + Intergenic
956846570 3:73188978-73189000 CACATCACTAGTGTGTCACATGG - Intergenic
957708856 3:83827103-83827125 AACAATATTGCTCTGTGACAGGG + Intergenic
958904681 3:99928646-99928668 CTCAACACTTCAGTGTGAAATGG - Intronic
960307522 3:116079739-116079761 CAAAACTCTTCTGTATGACATGG - Intronic
960338215 3:116444636-116444658 AACACCACTGCTGCTTGACAGGG + Intronic
962280432 3:134048287-134048309 CACAACACTGGCCTGGGACATGG + Intronic
962487397 3:135857977-135857999 CACGCCACTGCTGGGTGACAGGG - Intergenic
966219883 3:177540861-177540883 CTCAACACAGCTGTGAGGCAAGG - Intergenic
966730146 3:183144116-183144138 CACAACAATGCTGAGCGAAAAGG - Intronic
967526198 3:190495966-190495988 CACAAAATAGCTGTGTGACGGGG - Intergenic
969621776 4:8282260-8282282 CACTGCACTGCTGTGTGGTAGGG + Intronic
969671941 4:8594472-8594494 CTCAACTCTGCTGTGTGACCTGG + Intronic
970190932 4:13516864-13516886 CACAACACTGGTGGGTGGTAAGG + Intergenic
973063446 4:45758878-45758900 CAGAACACAGATGTGTGATAAGG - Intergenic
973331755 4:48916307-48916329 CACAAGGCAGCTTTGTGACATGG - Intergenic
973428711 4:50112035-50112057 TTCAAAACTGCTGTGTGAAAAGG - Intergenic
973450244 4:50468760-50468782 TTCAAAACTGCTGTGTGAAAAGG - Intergenic
973476394 4:50899766-50899788 TTCAAAACTGCTGTGTCACAAGG - Intergenic
973487044 4:51076091-51076113 TTCAAAACTGCTGTGTGAAAAGG - Intergenic
973510690 4:51465727-51465749 TTCAAAACTGCTGTGTCACAAGG - Intergenic
975789299 4:77931124-77931146 CTCAAAACTGCTTTGTCACATGG + Intronic
976406165 4:84662417-84662439 CAAAACACTTCAGTGTGATAGGG + Intergenic
977290631 4:95161074-95161096 CACCCCACTTCTGTGTGTCATGG + Intergenic
977427219 4:96882615-96882637 CAAAACACTCCAGTGTGAGAGGG + Intergenic
978468714 4:109037919-109037941 CACAACACTGCCAAGTTACAAGG + Intronic
978560891 4:110032426-110032448 CACATCACTGGTGGGAGACAAGG - Intergenic
978748458 4:112221673-112221695 CACAATCCTGTTGAGTGACAAGG + Intergenic
979170740 4:117598868-117598890 CACATCACTCCTGTGAAACAGGG - Intergenic
979688011 4:123531980-123532002 CACAGCAGTGCTGTGTTCCAGGG - Intergenic
981181753 4:141754265-141754287 CACAACACTCAAGTGTCACATGG + Intergenic
982888285 4:160811931-160811953 CATCACACTGCTACGTGACAGGG - Intergenic
985555306 5:555224-555246 CACAGGACTGCAGTGTGAGAAGG - Intergenic
985745396 5:1643931-1643953 CAAAACACTGCTCAGTGACAGGG + Intergenic
986923794 5:12720740-12720762 CTCTTAACTGCTGTGTGACATGG + Intergenic
988400147 5:30751677-30751699 TACAACTCTGGTGAGTGACATGG + Intergenic
988460727 5:31435001-31435023 CACAACCAGGCTGTGTGCCAAGG + Intronic
989860181 5:46363415-46363437 CTCAAAACTGCTGTGTTAAAAGG + Intergenic
989863686 5:46419426-46419448 CACAAAACTGCTCTATGAAAAGG + Intergenic
992542416 5:77777994-77778016 CACAGCGCTGCTGTGTGACTTGG - Intronic
994090391 5:95804708-95804730 CACAATACAGCCTTGTGACACGG + Intronic
996894622 5:128465301-128465323 CCCACCAGTGCTGTGTGACATGG - Intronic
1000873308 5:166604531-166604553 CACAACTCTGCTGGTTGACTTGG + Intergenic
1001304292 5:170560533-170560555 CACAACACTGCTGTGTGACAGGG - Intronic
1001766901 5:174256462-174256484 CACAACAACGCTGTGATACAGGG - Intergenic
1002428409 5:179189052-179189074 CACAATCCTGCTGCGTGACTTGG + Intronic
1003112374 6:3260753-3260775 CACAACACTGCCTTGTAACCAGG + Intronic
1003498001 6:6681287-6681309 CCCATCGCAGCTGTGTGACATGG - Intergenic
1006998988 6:38290783-38290805 CACAACCCTGCTGTGTGCCTGGG + Intronic
1007094547 6:39205269-39205291 CACAGCAGTGCTGTGGGACCAGG - Intronic
1007464264 6:42041007-42041029 CACAACACTTCCATGTGCCAGGG - Intronic
1008982214 6:57497718-57497740 CACAACAATGCTTTGATACACGG - Intronic
1009170279 6:60390554-60390576 CACAACAATGCTTTGATACACGG - Intergenic
1011657624 6:89566057-89566079 CAGATCACTGCTCTGCGACAGGG + Intronic
1012205488 6:96455935-96455957 CACAAGACTCTTGTTTGACAAGG - Intergenic
1012472342 6:99586509-99586531 TTCAACACTGCTGTGTCTCAGGG + Intergenic
1013283851 6:108663717-108663739 CTCATCACTGCTGCGTGACGTGG - Exonic
1015841066 6:137477896-137477918 CCCAACACAGCTATGTGACCTGG - Intergenic
1017148889 6:151260384-151260406 GAGATCACTGCAGTGTGACAGGG + Intronic
1019171335 6:170134827-170134849 CCCAGGGCTGCTGTGTGACATGG + Intergenic
1019614662 7:1953813-1953835 CCCATCACTGCTGGGTGACACGG + Intronic
1022212392 7:28224408-28224430 TACCACACTGCTGTGGGAGAGGG + Intergenic
1022898215 7:34774319-34774341 TACAACCCTGGTGGGTGACATGG + Intronic
1024665898 7:51546766-51546788 CACAGCACAGCTGTGGCACAGGG + Intergenic
1028981379 7:96971177-96971199 AACAACACTGCTCTGTAACGTGG - Intergenic
1031045194 7:116879683-116879705 CACCTCCCTGCTGTGTGACCGGG + Intronic
1031050805 7:116943248-116943270 CACAAAACAGCTGAGTGCCAAGG - Intergenic
1032978378 7:137252050-137252072 CAAGAAACTGCTGTGTTACATGG + Intronic
1033540212 7:142349431-142349453 CATGACACTGCTGTGTGCCCAGG + Intergenic
1035039052 7:155914247-155914269 CAGCACACTGCTGGGTCACAAGG + Intergenic
1036437819 8:8751266-8751288 CCCAACACTCCTGGGTGAGAAGG + Intergenic
1037713127 8:21371539-21371561 CACACCACTGCTTTCTGAGAGGG - Intergenic
1038372020 8:27003725-27003747 CACAACACTGCTTTGAAAAAGGG - Intergenic
1039273851 8:35913503-35913525 CAAAACCCTGCTGTGTAGCAGGG + Intergenic
1047926083 8:129683926-129683948 CAGAACACAGCTGTTTGGCAAGG + Intergenic
1049365410 8:142234607-142234629 CCCAGCCCTGCTGTGTGACCAGG + Intronic
1051259777 9:15251799-15251821 CATAACAATTCTGTGTGAAAAGG - Intronic
1051779698 9:20676301-20676323 CATAAAACTGCTGTGTGATAGGG - Intronic
1052394777 9:27925738-27925760 GACAACACAGCTGTGTGTCCAGG + Intergenic
1053439589 9:38105299-38105321 CACTGCACTCCTGGGTGACAGGG - Intergenic
1054814462 9:69461679-69461701 CACTTCACAGCTGTGTGACCTGG - Intronic
1058703690 9:107621559-107621581 GACAACACAGCTGTGTGACCTGG - Intergenic
1058917085 9:109578007-109578029 CACAACAAAGCTTTCTGACATGG - Intergenic
1061242179 9:129381184-129381206 CACAGCACTGCTTTGTCAAAAGG + Intergenic
1061989423 9:134150523-134150545 CCCAACAATGCTGAGTAACATGG - Intronic
1185722858 X:2395826-2395848 CATACTACAGCTGTGTGACATGG - Intronic
1189036504 X:37499072-37499094 CACAACAACCCTGTGAGACATGG + Intronic
1189149385 X:38688625-38688647 AACAACACAGCTTTGTAACAGGG - Exonic
1190116320 X:47628048-47628070 CCCACCAGTGCTGGGTGACAGGG + Intronic
1190775827 X:53551578-53551600 CTCAACACTGCAGTGAGGCAAGG - Intronic
1192156418 X:68750159-68750181 CTCAGCACTGCTGTTTGCCAGGG - Intergenic
1192328994 X:70159458-70159480 CACAGCAGTGCTGTGTTCCAAGG + Intronic