ID: 1001304356

View in Genome Browser
Species Human (GRCh38)
Location 5:170560899-170560921
Sequence CCCAGATTCTCCCTCACTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 174}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001304347_1001304356 8 Left 1001304347 5:170560868-170560890 CCATTTCCTTCTCCTCTCCCACT 0: 1
1: 2
2: 27
3: 285
4: 2347
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174
1001304345_1001304356 12 Left 1001304345 5:170560864-170560886 CCCTCCATTTCCTTCTCCTCTCC 0: 1
1: 0
2: 27
3: 367
4: 3120
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174
1001304349_1001304356 -4 Left 1001304349 5:170560880-170560902 CCTCTCCCACTCCTTCCTCCCCA 0: 1
1: 2
2: 31
3: 287
4: 2680
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174
1001304351_1001304356 -10 Left 1001304351 5:170560886-170560908 CCACTCCTTCCTCCCCAGATTCT 0: 1
1: 0
2: 6
3: 105
4: 1012
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174
1001304344_1001304356 13 Left 1001304344 5:170560863-170560885 CCCCTCCATTTCCTTCTCCTCTC 0: 1
1: 1
2: 29
3: 347
4: 2604
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174
1001304350_1001304356 -9 Left 1001304350 5:170560885-170560907 CCCACTCCTTCCTCCCCAGATTC 0: 1
1: 0
2: 4
3: 59
4: 589
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174
1001304346_1001304356 11 Left 1001304346 5:170560865-170560887 CCTCCATTTCCTTCTCCTCTCCC 0: 1
1: 1
2: 28
3: 331
4: 2716
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174
1001304348_1001304356 2 Left 1001304348 5:170560874-170560896 CCTTCTCCTCTCCCACTCCTTCC 0: 1
1: 0
2: 44
3: 461
4: 3259
Right 1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG 0: 1
1: 0
2: 1
3: 7
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001304356 Original CRISPR CCCAGATTCTCCCTCACTAC AGG Intronic
900572034 1:3363396-3363418 CCCAGAGACTCCCTCCCTGCTGG - Intronic
900680576 1:3914178-3914200 CCCAGAGTCTACCTCAATATCGG - Intergenic
902399616 1:16150822-16150844 CTCAGTTTCTCCATCTCTACAGG + Intronic
904304363 1:29577991-29578013 TCCAGATCCTGCCTCACTCCCGG - Intergenic
906142937 1:43544508-43544530 CCCACCTTCTCCCTCCCTGCTGG + Intronic
907505709 1:54916591-54916613 CTCAGAGTCTACCTCCCTACCGG - Intergenic
912754766 1:112314797-112314819 CCCAGATGCTCCCTCACTCTGGG - Intergenic
914885375 1:151580211-151580233 CCATTTTTCTCCCTCACTACAGG - Intronic
915080669 1:153349649-153349671 CCCACATTCACCCTCACCCCAGG - Intergenic
918925678 1:190782543-190782565 GCTGGATTCTCCCTCAGTACTGG + Intergenic
1067682177 10:48448202-48448224 CCCTGACTCTCCCCCACTACAGG + Intronic
1067828121 10:49594035-49594057 CCCTGATTCTCCCACACTGGAGG + Intergenic
1069800205 10:71077261-71077283 CCCAGAGTCTCCCTGACTCAGGG - Intergenic
1070734901 10:78856685-78856707 ACCAGTTTCTCCCTGGCTACAGG - Intergenic
1072765111 10:98088818-98088840 CCCAGGGTCTCCCTCACAATGGG + Intergenic
1073000524 10:100282137-100282159 TCCAAATTCTCCCTCTCTCCTGG + Intronic
1073194605 10:101679045-101679067 CCAAGACTCTCCCTCTCTAGAGG + Intronic
1073484165 10:103806163-103806185 CCCAGGTTCTCCCAAACTTCGGG + Intronic
1073808530 10:107126764-107126786 CACAGATCCTCCCTCTCAACTGG - Intronic
1077339980 11:2021924-2021946 CCCAGGTTCTCTCTCGCCACGGG - Intergenic
1078052118 11:7974908-7974930 CCCAGGTTCCCCCTCTCTGCAGG - Intronic
1079269457 11:18970251-18970273 CTCAGATTGACCCTCACTAAGGG - Intergenic
1081736091 11:45405369-45405391 CCTAGACTTTCCCTCAGTACTGG + Intergenic
1082222616 11:49658501-49658523 CCTAGATTCCCCATCACTGCTGG - Intergenic
1084500314 11:69531212-69531234 CCCAGGTCGTCCCTCACTCCTGG - Intergenic
1085814865 11:79727212-79727234 CCAAGGTGCTCCCTGACTACTGG + Intergenic
1086626431 11:88960701-88960723 CCTAGATTCCCCATCACTGCTGG + Intronic
1087861224 11:103159388-103159410 GGCATATTCTCCTTCACTACAGG - Intronic
1088893724 11:114062728-114062750 TCCAAACTCTGCCTCACTACAGG - Intronic
1089095631 11:115917928-115917950 CACTCATTCTCCCACACTACAGG + Intergenic
1089625022 11:119745749-119745771 CCCACATCCTCCCTGGCTACTGG - Intergenic
1202822965 11_KI270721v1_random:77113-77135 CCCAGGTTCTCTCTCGCCACGGG - Intergenic
1091951386 12:4596046-4596068 CCCAGATTATGGCTCACTCCTGG - Intronic
1092658203 12:10709989-10710011 CCCAGTATCGCCCTCAGTACCGG - Exonic
1094854592 12:34397295-34397317 CCCTGGTTCTCACTCACTAAGGG + Intergenic
1095579335 12:43778964-43778986 CCCATATTCTGTCTCACCACTGG - Intronic
1096209531 12:49753544-49753566 CCCAGATTCTCTCTCAATACAGG - Intronic
1097061925 12:56291658-56291680 CCCAGATTCTCCCCTAATCCTGG + Intronic
1097691318 12:62737091-62737113 GGCAGATTCTTCCTCACAACGGG + Intronic
1098466884 12:70797378-70797400 ATCAGTTTCTCCTTCACTACTGG + Intronic
1098839313 12:75459736-75459758 CCTGGATTCTCCCTCAGCACTGG + Intergenic
1098852004 12:75607075-75607097 CACAGGTTCTCCCTCATTATGGG + Intergenic
1099902033 12:88722805-88722827 CCCAGCTTCCCACTCACTATAGG + Intergenic
1101704305 12:107207126-107207148 CACAGATTGCCCCACACTACTGG + Intergenic
1103597099 12:122030563-122030585 CCCAGCTCCACCCTCACTAGCGG - Intronic
1104752669 12:131249966-131249988 CTCAGACTCTCACTCACTATGGG + Intergenic
1104779213 12:131409034-131409056 CTCAGATTCTCACTCACTGTAGG - Intergenic
1104809633 12:131612477-131612499 CCCAGATGCTCACTCCCTGCGGG - Intergenic
1107834753 13:44404397-44404419 CCCAGATGCTCCCTGGCTGCGGG - Intergenic
1110077818 13:71271535-71271557 CCCAGATTGTCCCAAACTGCTGG - Intergenic
1112019569 13:95359898-95359920 CCTAGATCCTCCCTCACAAAAGG - Intergenic
1112465631 13:99642257-99642279 CCCAGGGTCACCCTCACTAGAGG - Intronic
1115728099 14:36239093-36239115 CCCAGATTCTCCTTCCCGTCTGG + Intergenic
1117003419 14:51394662-51394684 CCCTGATTTTACTTCACTACAGG - Intergenic
1117534291 14:56689083-56689105 CCCAGATTCTTCCAGATTACAGG + Intronic
1117769026 14:59113422-59113444 CTCAGGTTCTCCCTCTCTATTGG + Intergenic
1120442326 14:84556998-84557020 CCCAGATTCAGCCACACTGCAGG - Intergenic
1121048888 14:90807098-90807120 CCCAGAAGCTCCCTCAGTCCTGG - Intronic
1125472898 15:40021771-40021793 CCCACATTCGCCCACACTAAAGG + Intronic
1127654764 15:61045683-61045705 CCCAGCCTCTCCCTGACTCCTGG - Intronic
1128184308 15:65631459-65631481 CCTACACTCTCCCTCACTAAAGG - Intronic
1129719766 15:77871741-77871763 CCCAGATCCTCCCCCATGACTGG - Intergenic
1130339417 15:82986495-82986517 CCCATAATTTCCCTCACTTCTGG + Intronic
1132102340 15:99033218-99033240 CCCAGATGATCCCAAACTACTGG - Intergenic
1132160289 15:99535191-99535213 CACAGATTCTACCTCAGTAATGG - Intergenic
1136298770 16:29319461-29319483 CCCAGATTCGTCATCGCTACAGG + Intergenic
1139927830 16:70501167-70501189 CCCAAATTCCCCCTCCCCACTGG + Intronic
1142610290 17:1105747-1105769 CTCAGCCTCCCCCTCACTACAGG - Intronic
1146341146 17:32020900-32020922 CCCAAATCCTTCCTCACTAAGGG + Intronic
1147922677 17:43927578-43927600 CCCAAATCCTTCCTCACTAAGGG - Intergenic
1148174313 17:45550505-45550527 CCCAAATCCTTCCTCACTAAGGG - Intergenic
1148274949 17:46294942-46294964 CCCAAATCCTTCCTCACTAAGGG + Intronic
1148297056 17:46512521-46512543 CCCAAATCCTTCCTCACTAAGGG + Exonic
1148361609 17:47017001-47017023 CCCAAATCCTTCCTCACTAAGGG + Intronic
1150013326 17:61527163-61527185 CAAAGATTCTCCCTCTATACTGG + Intergenic
1150405534 17:64897427-64897449 CCCAAATCCTTCCTCACTAAGGG - Exonic
1152467440 17:80474224-80474246 CCCACCTTCTCCCTCCCCACCGG + Intronic
1154233537 18:12580908-12580930 CCCAGCCTGTCCCTCAATACTGG + Intronic
1156388389 18:36627000-36627022 CCCAGATGCCCTCTCTCTACAGG + Intronic
1156665160 18:39395985-39396007 CACATATTCTCACTCACAACTGG + Intergenic
1157800191 18:50613363-50613385 CCCAGCTTCTTACTGACTACTGG - Intronic
1159748661 18:72272262-72272284 TCAAGATTCATCCTCACTACTGG - Intergenic
1161537915 19:4831392-4831414 CCCAGATCCTCCCCCACTGTCGG - Intronic
1163054253 19:14706411-14706433 CCCAGCTTTTCCCTGACTTCTGG + Intronic
1163696976 19:18768972-18768994 CTCAGTTTCTCCATCTCTACAGG - Intronic
1165366022 19:35365560-35365582 ACCCAACTCTCCCTCACTACAGG + Intergenic
1167244430 19:48365038-48365060 CCCAGAATCACCCTCACCCCAGG + Intronic
925591205 2:5511789-5511811 CCCAGATTGTTCCCAACTACAGG + Intergenic
931155282 2:59621810-59621832 CTCTGCTTCTCCCTCAGTACTGG - Intergenic
933993036 2:87647307-87647329 CCCAGAGCCTCTCTCTCTACAGG - Intergenic
936105205 2:109617230-109617252 CCCAGATTTTCAGTAACTACAGG - Exonic
936300821 2:111303572-111303594 CCCAGAGCCTCTCTCTCTACAGG + Intergenic
937251038 2:120523975-120523997 CCCTGAATCTCCCTAACTCCTGG - Intergenic
937849611 2:126620872-126620894 GCCAGATTGTCCCTCATTATGGG + Intergenic
938187004 2:129240603-129240625 CCCAGAAGCTCCCCCACTGCAGG + Intergenic
939443931 2:142284897-142284919 CCCAGATTACACCTCACTATAGG - Intergenic
942482433 2:176403672-176403694 CCCAGACTTTCCCCCACTGCTGG + Intergenic
943259747 2:185643907-185643929 CCCAGATTTGACCTGACTACTGG + Intergenic
948462142 2:238134908-238134930 CCCAGCTTCTCCCTCGCAGCTGG + Intergenic
1169671370 20:8106323-8106345 ACTGGATTCTCCCTCAGTACTGG + Intergenic
1169751065 20:8995020-8995042 CTCAGATTCTTCCTCAATTCAGG - Intergenic
1169867215 20:10215121-10215143 CACAGGTTCTTCCTCCCTACTGG + Intergenic
1172785270 20:37464500-37464522 TCCAGTTTCTCCCTCTCTGCTGG + Intergenic
1174288659 20:49490818-49490840 CTCAGATTCTTCCCCACTAGTGG + Intergenic
1176078250 20:63258986-63259008 CCCAGCTTCTCCCTCCCGAAAGG + Intronic
1178806858 21:35846533-35846555 CCCAGATTCTGGCTCACACCTGG + Intronic
1180726802 22:17952425-17952447 CCCAGCCTCACCCTCGCTACAGG + Intronic
1182283246 22:29229947-29229969 CCCAGAGTCTTCCTCACCATGGG + Intronic
1182295707 22:29310433-29310455 CCCAGAATCTCCCTCACCTGAGG - Exonic
1182739147 22:32554275-32554297 CCCAGATGGTCCCTCAATACGGG + Intronic
1184444929 22:44541446-44541468 AGCAGATACTCCCTCACTCCTGG - Intergenic
949872531 3:8601583-8601605 CCCAGAGTCTCATCCACTACAGG - Intergenic
950072311 3:10162649-10162671 CCCAGGCTCTCCATCACCACTGG - Intergenic
953466618 3:43127321-43127343 CCTAAATTCTCTCTCACTTCTGG + Intergenic
954420964 3:50418813-50418835 CCCTGTTTCTCCCTCACAGCTGG + Intronic
954942313 3:54385377-54385399 CCCGGATGCTAACTCACTACAGG - Intronic
957927967 3:86839738-86839760 CCCAGATAGGCCCTCACTAAAGG + Intergenic
960124409 3:113982776-113982798 ACGAATTTCTCCCTCACTACTGG + Intronic
961088538 3:124090620-124090642 CTCAGAATCTCCCTCCCTATTGG + Intronic
961400971 3:126642613-126642635 CTCAGATTCTCTCTGACTGCAGG + Intronic
961553582 3:127682523-127682545 CCCAGCTGATCCCTCACTAGTGG - Intergenic
967648801 3:191960297-191960319 CCAGGATTCTCCCTCACTCAGGG - Intergenic
975987891 4:80220803-80220825 CCCAGTTGCTTCCTCACTTCAGG - Intergenic
977852059 4:101842180-101842202 ACCAGATTCTTCCCCACTTCTGG - Intronic
978346381 4:107774312-107774334 GCCTGATGGTCCCTCACTACTGG + Intergenic
982578499 4:157147637-157147659 CTCAGTTTTTCCTTCACTACTGG - Intronic
983738215 4:171090676-171090698 TCCAGAATCTCACTGACTACAGG - Intergenic
985291116 4:188388925-188388947 CCCAAATTCTTCCTCAGGACAGG - Intergenic
985482935 5:128762-128784 CCCAGAATCCTCCTCACAACTGG + Intergenic
986505588 5:8447154-8447176 CCAAGATTCTCCCTGGCTCCTGG + Intergenic
986718618 5:10542014-10542036 ACCAGACTCTCCCTCTCTCCAGG + Intergenic
989367749 5:40675612-40675634 CCCACATTCTCACTCACTGAAGG + Intergenic
996726682 5:126678772-126678794 CCCAGCTTCTCACACACTATTGG + Intergenic
998227995 5:140341735-140341757 CCCAGAGCCTCCCTCCCCACAGG + Intronic
998914245 5:146996888-146996910 CCCAGTTTCTCTCTCCCTCCAGG + Intronic
998965209 5:147532279-147532301 CCCAGGATATCCCTCACTTCTGG - Intergenic
999521308 5:152353218-152353240 CCCTGTTTCTCCCTCACCAGGGG - Intergenic
999869340 5:155732787-155732809 CCCAGTTGTTCCCTCACTCCCGG + Intergenic
999879867 5:155850350-155850372 CCCTGTTTCTTCCTCCCTACAGG - Intergenic
1000042266 5:157493527-157493549 TCCCCATTCTCCCTCACTCCTGG + Intronic
1000395944 5:160774888-160774910 CACAGAGTCTCCCTCACTGGAGG + Intronic
1001304356 5:170560899-170560921 CCCAGATTCTCCCTCACTACAGG + Intronic
1002762749 6:214590-214612 CCCAGAGTCCCCCTCAGCACAGG - Intergenic
1006581097 6:35078447-35078469 ACCAAATTCTCCTTCACTGCAGG - Intronic
1006982810 6:38159340-38159362 CCAAATTTCTCCCTCGCTACGGG - Intergenic
1009975248 6:70665010-70665032 CCCAGATTTTCCCAGGCTACTGG + Intergenic
1011173619 6:84535229-84535251 CCCAGATTCTCTCTTATTTCAGG + Intergenic
1012224351 6:96687762-96687784 CCCAGATTGTGCCCCACTATGGG + Intergenic
1013309470 6:108879746-108879768 CCCTGATTCTCCATAACAACTGG - Intronic
1013665571 6:112344095-112344117 CCCAGATTCTCCATTATTACAGG - Intergenic
1015579145 6:134704520-134704542 CTCAGAATCTCCCTCAACACTGG - Intergenic
1018938194 6:168287746-168287768 CCCATATGGTCCCTCACCACTGG - Intergenic
1021762985 7:23919457-23919479 CACATCTTCTCCCTCACTGCTGG - Intergenic
1023175713 7:37433646-37433668 CCCACCTTATCCCTCACTGCTGG + Intronic
1024045228 7:45581136-45581158 CTCAGTTTCTCCCTCACCAAAGG + Intronic
1034189693 7:149204499-149204521 ATCAGTTTCTCCCTCTCTACTGG - Intronic
1034412759 7:150949938-150949960 CCCACATTCTCCTTCCCTTCAGG - Intronic
1034466753 7:151234220-151234242 CCCGGATTGTCCCCTACTACAGG + Exonic
1034928570 7:155142666-155142688 CCTGGGTTCTCCCTGACTACGGG + Intergenic
1035678919 8:1473374-1473396 CTGAGATTCTCCCTCACTGCAGG - Intergenic
1037659558 8:20915259-20915281 CCCAGAGACTTCCTCACTCCAGG + Intergenic
1039247650 8:35627353-35627375 CCCTGATTCTCTGTCACTGCAGG - Intronic
1039434638 8:37551716-37551738 CCCAGATTCTCTCCCACCAGAGG + Intergenic
1043601671 8:81946780-81946802 CCCACATTCTCACTCACCATGGG + Intergenic
1045607958 8:103799366-103799388 CCTAGATTGTCCATCACTAATGG - Intronic
1046990353 8:120445526-120445548 CCCATGTTCTGCCTCCCTACTGG - Exonic
1047575523 8:126149913-126149935 ACCAGATTCTCCCTCTGTGCTGG + Intergenic
1047654249 8:126959505-126959527 CCCAGACTCAGCCCCACTACAGG - Intergenic
1047890575 8:129303787-129303809 ACCAGATTCTCCCTCAATGCTGG - Intergenic
1051528148 9:18070624-18070646 TTCAGATTCTCCCTCACAGCTGG - Intergenic
1052365655 9:27609206-27609228 CCCATATGGTCCCTCACCACTGG - Intergenic
1052990411 9:34516136-34516158 CCCAGCTGCTCCCTCACCATGGG - Intronic
1056672795 9:88645691-88645713 CCCAGACTTTCCCTCAATAAGGG - Intergenic
1056814641 9:89792363-89792385 CCTGGACTCTCCCTCCCTACCGG + Intergenic
1058389835 9:104482882-104482904 CCCTGATTCTCCTTCTCTTCAGG + Intergenic
1059996774 9:119918242-119918264 CCCAAATTTTCCCTCTCTGCTGG + Intergenic
1060390906 9:123275827-123275849 GCCAGCCTCTCCCTCTCTACTGG + Intergenic
1061297852 9:129686767-129686789 TCCGGATTCGCCCTCACCACCGG + Intronic
1062040295 9:134401461-134401483 CGCAAATTCACACTCACTACGGG - Intronic
1187125521 X:16451013-16451035 CCCAGATTCTTGCACACTATAGG - Intergenic
1189104438 X:38221369-38221391 CCCAGATTCACCCCCGTTACTGG + Intronic
1192762126 X:74104724-74104746 ACTAGATTCTCCCTCAGTACTGG + Intergenic
1193483830 X:82060872-82060894 CCAAGATGCTCTCTCACTGCTGG - Intergenic