ID: 1001308590

View in Genome Browser
Species Human (GRCh38)
Location 5:170594386-170594408
Sequence GGCCATACCCCTCTTCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001308590_1001308596 19 Left 1001308590 5:170594386-170594408 CCCACCAGAAGAGGGGTATGGCC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1001308596 5:170594428-170594450 ACTTCATAGTATGAAAGCCAGGG 0: 1
1: 0
2: 0
3: 10
4: 173
1001308590_1001308595 18 Left 1001308590 5:170594386-170594408 CCCACCAGAAGAGGGGTATGGCC 0: 1
1: 0
2: 0
3: 9
4: 87
Right 1001308595 5:170594427-170594449 CACTTCATAGTATGAAAGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 88

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001308590 Original CRISPR GGCCATACCCCTCTTCTGGT GGG (reversed) Intronic
902334727 1:15748359-15748381 GGCCACACAGCTCTTCTGGCAGG + Intergenic
902381449 1:16054452-16054474 GGCCTTATCCCTCTTGGGGTGGG - Intronic
912322491 1:108727457-108727479 AGCCATTCCCCTCTTCTGCCTGG - Intronic
912483932 1:110008882-110008904 GGCCTTCCCCCATTTCTGGTGGG + Intronic
912756592 1:112329566-112329588 GGCTCTGCCCCTCCTCTGGTGGG - Intergenic
915085661 1:153386922-153386944 GGCCACCTTCCTCTTCTGGTAGG + Intergenic
918265065 1:182834393-182834415 TATTATACCCCTCTTCTGGTTGG + Intergenic
922789155 1:228300521-228300543 GGCCAGGCCCCTCTTCAGGCTGG + Intronic
1065021070 10:21501793-21501815 GCCCATTCCTCTCTTCAGGTTGG - Intergenic
1071616664 10:87081216-87081238 GGCCAGCCGCCTCTTCTGGGAGG + Intronic
1083096069 11:60252864-60252886 GCCCATACCACTGTTCTGGAGGG + Intergenic
1086501048 11:87454080-87454102 GACAAAACCACTCTTCTGGTTGG - Intergenic
1092331391 12:7590125-7590147 GGCCAGCCCCCTCGTCTGGGAGG - Intergenic
1094796925 12:33985323-33985345 GGCCTTACCCCTCAACTTGTGGG + Intergenic
1095704282 12:45220829-45220851 GCTCTTACCCCTCTTCAGGTTGG - Intronic
1098522263 12:71446468-71446490 GTCAATACCCCCCTTGTGGTGGG + Intronic
1098532349 12:71555258-71555280 GCACATACCCAGCTTCTGGTGGG - Intronic
1099404852 12:82247344-82247366 GGACATACCCTTCTTTTGGCAGG + Intronic
1103983618 12:124752761-124752783 GGCCATGCCTGACTTCTGGTGGG - Intergenic
1105773002 13:23630437-23630459 GGGCATACAGCTCATCTGGTGGG - Intronic
1113851977 13:113423064-113423086 GGCCAAACCCCAATTCTGCTGGG + Intronic
1114483550 14:23049495-23049517 GTCCACACCCATCTTCTGTTGGG + Intronic
1114666522 14:24380527-24380549 GGCCTAACCCCTCTTCTCTTTGG + Intergenic
1116968688 14:51042242-51042264 GGCCATAACTATCTTCTGCTGGG - Intronic
1118568445 14:67168772-67168794 GACTATACCTCTGTTCTGGTTGG + Intronic
1119275124 14:73348416-73348438 GGCCATAGCCCAATACTGGTCGG + Intronic
1122016098 14:98797987-98798009 GGGGATTCCCCTCTTCTGGCTGG + Intergenic
1123033243 14:105460987-105461009 GGCCATGCCCATCTCCAGGTAGG + Intronic
1125520201 15:40344135-40344157 GGCCACACAGCTCTTCTGGAAGG + Intergenic
1133245316 16:4444760-4444782 GGCCTTTCCTCTCTTCGGGTGGG + Intronic
1138517213 16:57542780-57542802 GGCCATACCCATGTCCAGGTGGG + Exonic
1143428675 17:6862671-6862693 GGCCATAACACTCTGCTGGTTGG + Intergenic
1143724589 17:8836537-8836559 GGCCACTCACCTCTCCTGGTAGG + Exonic
1146472975 17:33139288-33139310 GGCCAGCCCCCTCTTCTGACTGG + Intronic
1147605923 17:41773638-41773660 GGCCATTCCCCTCTGTTGCTGGG - Intronic
1148736756 17:49869429-49869451 GGCAAGACCCCTCTTCTCCTGGG - Intergenic
1150005015 17:61463913-61463935 GGCCCTGCCTCTCTCCTGGTGGG - Intronic
1152095058 17:78267913-78267935 GGCCATTGCCCTTTTCTGGTGGG + Intergenic
1157319046 18:46620291-46620313 GGCAAGACCCCTCTTCAGGGTGG + Intronic
1157557837 18:48624318-48624340 GGCCAAACCCCACTGCTGGGTGG + Intronic
1158516617 18:58135926-58135948 GGCCATACCCCTTGTGTGGTTGG + Intronic
1160153010 18:76409561-76409583 GGCCAGACTGTTCTTCTGGTAGG + Intronic
1160750168 19:730212-730234 GGCTGGACCCCTCTTCTGGTTGG + Intronic
1161051979 19:2168939-2168961 GGCCCTGCCCTTCTTCTAGTGGG + Intronic
1162806078 19:13138700-13138722 GGCCAGCCCCCTCCCCTGGTGGG - Exonic
1165742401 19:38211787-38211809 AGCCATACCCCGCCTCTGGGCGG - Exonic
1167375510 19:49108849-49108871 GACCATACCCCTGTCTTGGTGGG + Intergenic
1167540497 19:50084111-50084133 GGCAGTACCCCTTTTCTGCTAGG - Intergenic
927494644 2:23544257-23544279 GGCAATACCCGGCCTCTGGTAGG - Intronic
932418417 2:71587226-71587248 GGCCAAACGCCTCTCCTGGCAGG + Intronic
937970022 2:127542216-127542238 GGGTATGCCCCTCTTCTGGAAGG - Intronic
938105310 2:128526103-128526125 GGTCAGACCCCTCTTCTCCTGGG + Intergenic
946725288 2:222655970-222655992 GGCCCTACGCCTCTTCTCGGAGG - Intronic
947274643 2:228376537-228376559 GTCCATACCCCTCTTCATATGGG + Intergenic
1169207007 20:3746179-3746201 GGCCCACTCCCTCTTCTGGTGGG - Intronic
1173473496 20:43341570-43341592 GGCCATACCCCACCTCTGCTTGG - Intergenic
1175869332 20:62200713-62200735 CCCCAGACCCCTGTTCTGGTGGG - Exonic
1176867704 21:14063175-14063197 GGCGATACCCCTCCAGTGGTGGG + Intergenic
1179475414 21:41640062-41640084 GGAAATGCCACTCTTCTGGTTGG - Intergenic
1181762831 22:25069660-25069682 GGCCACACCCTCCTTCTGGGGGG + Intronic
1184789215 22:46689083-46689105 TGCCACACCCCTCCTCTGGCTGG - Intronic
949573430 3:5315284-5315306 GGCCCAACTCCTCTTCTGGGAGG + Intergenic
951537276 3:23751376-23751398 CTCCATACCCCTCCTCTGGCAGG + Intergenic
957467731 3:80616475-80616497 TGCCATAGCCCTCTTTTGGCTGG - Intergenic
961101967 3:124207269-124207291 TGCCATACCCCTTTCCTGGCAGG - Intronic
962468911 3:135687677-135687699 TGCCATACCCTTCTTCTTCTGGG - Intergenic
964288301 3:155145883-155145905 GGCCAAACCCATTTTCTTGTAGG - Intronic
966099457 3:176248973-176248995 GGTGAGAGCCCTCTTCTGGTTGG - Intergenic
969217658 4:5735063-5735085 GGCCACACCCCTGTGCTGGATGG - Intronic
980768299 4:137336901-137336923 GACCATTCCCTTCTTCTGGGAGG - Intergenic
985222281 4:187720397-187720419 AGCCATTCCCATCTTCTGGAAGG + Intergenic
985672206 5:1212887-1212909 GGCCATCCCTTTCTTCTGGTGGG + Intronic
987761982 5:22176755-22176777 GATCATACCACTCTTCTGCTAGG + Intronic
993152020 5:84173733-84173755 GGCCATCCCCCTCCTCAGCTGGG + Intronic
995714865 5:115072466-115072488 GGCCATACCCAGCTTCTGAATGG - Intergenic
997288263 5:132699985-132700007 GTCCATGCCCCTCTTGTGGTGGG + Intronic
998822649 5:146070636-146070658 GATCATATCCCTCTTCTTGTGGG - Intronic
1000326950 5:160179428-160179450 GCCCATCCCCCTCTCCTGCTGGG - Intergenic
1001308590 5:170594386-170594408 GGCCATACCCCTCTTCTGGTGGG - Intronic
1001513429 5:172338983-172339005 GGCCAGGCCCCTCTCCTGGGAGG + Exonic
1012417042 6:99022839-99022861 GGGCATACCCCTCTTCCTGATGG - Intergenic
1013037842 6:106404029-106404051 GGGCAGAGCCCTCTTCTGATAGG - Intergenic
1016986344 6:149898470-149898492 GGCCCTACCTCATTTCTGGTGGG + Intergenic
1021293461 7:18874554-18874576 GGCCACACCCCTCCTCTAGGAGG + Exonic
1028022692 7:85796463-85796485 GGCAATACCCCTGTGCTTGTGGG - Intergenic
1029459160 7:100685478-100685500 GGCCATCTCCCTCTTCTAGGTGG - Exonic
1033367604 7:140683614-140683636 GGCCAGGCCCCTCTTCAGCTGGG - Intronic
1034839485 7:154382464-154382486 GGAGATACGCCTATTCTGGTAGG + Intronic
1039233959 8:35481170-35481192 GGTCAATCCCCTCTTCTGGTAGG - Intronic
1041830581 8:62148267-62148289 GGCCATTCACCTTTTCTTGTTGG - Intergenic
1043027173 8:75084523-75084545 GGTCATTCCCCTCTTCCCGTTGG + Intergenic
1043269524 8:78313941-78313963 ATCCATACCCCTTTTCTGTTTGG - Intergenic
1043884934 8:85588138-85588160 GGCTATTCCCCTCTTCCGGTGGG - Intergenic
1047703494 8:127473607-127473629 GGCCATCCTCCTCTCCTGTTTGG + Intergenic
1047994909 8:130325024-130325046 GGACATACCCCACCTCTGGAAGG - Intronic
1053005802 9:34603636-34603658 GGCTATAGCCCTCTTGGGGTTGG + Intergenic
1061541499 9:131279990-131280012 GCCCACACACCTCTGCTGGTAGG - Intergenic