ID: 1001308858

View in Genome Browser
Species Human (GRCh38)
Location 5:170596281-170596303
Sequence CTATGGGTGTGATGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 1, 2: 0, 3: 28, 4: 188}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001308858_1001308866 23 Left 1001308858 5:170596281-170596303 CCCTGTGCCCATCACACCCATAG 0: 1
1: 1
2: 0
3: 28
4: 188
Right 1001308866 5:170596327-170596349 AGATGAAAGTGCTGTCATCATGG 0: 1
1: 0
2: 1
3: 27
4: 247
1001308858_1001308862 -9 Left 1001308858 5:170596281-170596303 CCCTGTGCCCATCACACCCATAG 0: 1
1: 1
2: 0
3: 28
4: 188
Right 1001308862 5:170596295-170596317 CACCCATAGTATCAACTGTCAGG 0: 1
1: 0
2: 1
3: 2
4: 95
1001308858_1001308867 24 Left 1001308858 5:170596281-170596303 CCCTGTGCCCATCACACCCATAG 0: 1
1: 1
2: 0
3: 28
4: 188
Right 1001308867 5:170596328-170596350 GATGAAAGTGCTGTCATCATGGG 0: 1
1: 0
2: 2
3: 23
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001308858 Original CRISPR CTATGGGTGTGATGGGCACA GGG (reversed) Intronic
900252514 1:1678494-1678516 CTGGCGGTGTGATGGGCAGACGG - Intronic
900874681 1:5333234-5333256 CAGTGCTTGTGATGGGCACAAGG - Intergenic
901159549 1:7164423-7164445 CTAGGGGTTTGATGGGCAGGTGG + Intronic
902877534 1:19349796-19349818 CTTGGGGAGTGAGGGGCACAGGG + Intronic
904260344 1:29284212-29284234 CCTTGGGGGTGATGGGTACAGGG + Intronic
904648044 1:31982911-31982933 ATCTGGGTGTGATCAGCACAAGG + Intergenic
906609325 1:47190915-47190937 CTATGAGGGTGACGGGCCCAGGG - Intronic
906693130 1:47806020-47806042 AGAAGGGAGTGATGGGCACAAGG + Intronic
907914792 1:58858779-58858801 CTATGGGTGTGCTGAGGACAGGG + Intergenic
908461176 1:64349656-64349678 CTATGTGTGTGGTGTGTACATGG + Intergenic
908956264 1:69632185-69632207 CAATGGGTGCTGTGGGCACATGG - Intronic
914432812 1:147634783-147634805 CTCTGGGTTTGATGAGCTCAGGG - Intronic
914781687 1:150791379-150791401 CTATGCCAGAGATGGGCACATGG - Intergenic
916582038 1:166117654-166117676 CTATGGGTTTTATAGGTACATGG + Intronic
917001723 1:170367965-170367987 CTATGGCAGTGATGGTCCCAGGG + Intergenic
918236498 1:182585525-182585547 CTATGGGAGTGAGAGCCACAGGG - Exonic
919291843 1:195643162-195643184 CAATGGGGGGGAGGGGCACAGGG + Intergenic
920000711 1:202796765-202796787 CTATGGTTGTCATGGGACCATGG - Intronic
921546239 1:216478245-216478267 CTATGGATGTGTTGGGCAGGGGG + Intergenic
923048028 1:230369622-230369644 CTGTGTGTGTGCTGGGGACAGGG + Intronic
1065052523 10:21810476-21810498 CAATGGGTGTGATGACCATAGGG - Intronic
1066352801 10:34652367-34652389 ATATGGGTGTGATGGGGAGAGGG + Intronic
1066440499 10:35434288-35434310 ATTTGGGTGTGATGGGTTCAGGG + Intronic
1067084430 10:43230341-43230363 CGAGGGGTGGGCTGGGCACATGG + Intronic
1070417420 10:76203962-76203984 AGATGGGTGGGATGGGCACATGG - Intronic
1070440330 10:76436648-76436670 GTCTGGGTGTGAAGAGCACAGGG - Intronic
1072542357 10:96407684-96407706 CATTGGGTGGGATGGGCCCAAGG - Intronic
1074188179 10:111114702-111114724 CTATGGGTGTGATGGGGACAGGG + Intergenic
1076689341 10:132213336-132213358 CTGTGGGTGTGTTGGGAAGATGG - Intronic
1077366207 11:2162350-2162372 CTATGGGGGTGATGGTGTCATGG - Intergenic
1078746545 11:14120814-14120836 CTATGGTTGTGATGGGGTTACGG - Intronic
1081657726 11:44868448-44868470 GTATGGGTGTGGAGGGCACCTGG + Intronic
1082175616 11:49055668-49055690 CAGGGGGTGTGATGGGCAGAGGG - Intronic
1082959670 11:58906364-58906386 CTATGGGTGCAAAGGGCACCAGG - Intronic
1083265146 11:61543166-61543188 CTAAGGCTGTGCTGGCCACAGGG - Intronic
1084548759 11:69828232-69828254 CTTGGGGTCTGATGGGCAGACGG + Intergenic
1084779224 11:71397652-71397674 CTAATGATGTGATGGGAACATGG + Intergenic
1084927356 11:72524234-72524256 GTATGGCTGAGATGTGCACAGGG - Intergenic
1086690131 11:89780401-89780423 CAAGGGGTGTGATGGGCAGAGGG + Intergenic
1086698531 11:89872571-89872593 CAAGGGGTGTGATGGGCAGAGGG - Intronic
1086707635 11:89971925-89971947 CAAGGGGTGTGATGGGCAGAGGG + Intronic
1086715723 11:90059556-90059578 CAAGGGGTGTGATGGGCAGAGGG - Intergenic
1088154798 11:106790258-106790280 CTATGGTGGTGGTGGCCACAGGG - Intronic
1088196407 11:107278787-107278809 CTGTGGGGATGATGGGCTCATGG + Intergenic
1089446568 11:118557553-118557575 CTGCTGGTTTGATGGGCACAAGG - Intronic
1089696593 11:120219637-120219659 GCATGGCTGGGATGGGCACAGGG + Intronic
1092750519 12:11714956-11714978 AACTGGGTGTGATGGGCCCATGG - Intronic
1094407559 12:30134207-30134229 CTACAGGTGTCAGGGGCACATGG + Intergenic
1096000623 12:48126895-48126917 CTATGTGTGTGAAAGGAACAAGG - Intronic
1100506285 12:95224096-95224118 TTATGGGTCTGAGGGACACAGGG - Intronic
1102765052 12:115425520-115425542 CTATTGGTGTGATGGCTATACGG + Intergenic
1103199023 12:119071178-119071200 GTTTGGTTGTGATGGGCACTAGG - Intronic
1107387347 13:39926282-39926304 GTATGAGTGTGATGGGAAGAGGG + Intergenic
1107668678 13:42719558-42719580 CTATGACTGTGTTGGGCTCATGG + Intergenic
1109336643 13:61003252-61003274 CTATGGTAGTGGTGGCCACAAGG - Intergenic
1110281550 13:73699514-73699536 CTATGAGGGTGAAGGTCACATGG + Intronic
1110501352 13:76231719-76231741 CTGTGGTGGTGATGGCCACAAGG + Intergenic
1112517669 13:100069103-100069125 CAATGGGTGAGATGGGAATAGGG + Intergenic
1117159329 14:52973437-52973459 CTGTGGTGGTGATGGCCACAGGG - Intergenic
1118760040 14:68875270-68875292 TTATAGGTGTAATTGGCACATGG - Intronic
1123489306 15:20767686-20767708 GTTTGGGTGTGATGGCAACACGG - Intergenic
1123545805 15:21336773-21336795 GTTTGGGTGTGATGGCAACACGG - Intergenic
1123682487 15:22772756-22772778 GTATGGGTGGGGTGGGCACTTGG + Intergenic
1124334235 15:28845280-28845302 GTATGGGTGGGGTGGGCACTTGG + Intergenic
1125350475 15:38761887-38761909 CCAGGGTTGTGATGGGCATAAGG + Intergenic
1125502579 15:40248654-40248676 CACTGGGTGTGAGGGGCAGAGGG - Intronic
1125723543 15:41856705-41856727 CTTTGGGAGTCATGGGGACAGGG - Intronic
1126469554 15:48993478-48993500 CTAGAGGTGTAATGGGCTCAAGG + Intronic
1126474140 15:49048269-49048291 CTAGGTGTGTGATAGGCACCAGG - Intergenic
1127993067 15:64134860-64134882 CTCTGGGTGGGATGGGCCCTGGG - Intronic
1128450622 15:67804101-67804123 CTCTGGGTGTAATGGCCCCAGGG + Intronic
1129604191 15:77016840-77016862 TTAGGGGTGTGAGGGGAACAGGG - Intronic
1130906014 15:88241384-88241406 GGATGGGGGTGATGGGCGCAGGG + Intronic
1202954147 15_KI270727v1_random:64044-64066 GTTTGGGTGTGATGGCAACACGG - Intergenic
1132555932 16:572673-572695 CTAAGGGCGTGGTGGGCACTGGG + Intronic
1132555947 16:572728-572750 CTAAGGATGTGGTGGGCACTGGG + Intronic
1132676108 16:1121878-1121900 CTCTGTGTGTGAGGGGCACAGGG + Intergenic
1132871983 16:2119435-2119457 CAATGTGTGGGATGGGCCCAGGG - Intronic
1134520544 16:14917461-14917483 CAATGTGTGGGATGGGCCCAGGG + Intronic
1134551030 16:15138513-15138535 CAATGTGTGGGATGGGCCCAGGG - Intronic
1134951386 16:18352533-18352555 CAATGTGTGGGATGGGCCCAGGG - Intergenic
1136777973 16:32881718-32881740 CGGTGGGGGTGATGGGCACAGGG + Intergenic
1136892649 16:33979796-33979818 CGGTGGGGGTGATGGGCACAGGG - Intergenic
1137716548 16:50601748-50601770 CTGTGGCTGTGGTGGGCTCAGGG + Intronic
1138653951 16:58479704-58479726 CTATGACAGTGCTGGGCACAGGG - Intronic
1141580999 16:84998616-84998638 CAGTCGGTGTGATGGGCACAGGG - Intronic
1142186575 16:88697689-88697711 CTGTGTGGGTGATGGGCAGAGGG - Intronic
1203080391 16_KI270728v1_random:1143827-1143849 CGGTGGGGGTGATGGGCACAGGG + Intergenic
1146321500 17:31850342-31850364 CTTTGGGTCTGACGGGCTCAAGG - Intergenic
1146890247 17:36502078-36502100 CAATGGCTGTGAGGGGCCCAGGG + Intronic
1147867020 17:43559854-43559876 CCAGGGGTGTGATGGCCCCATGG - Intronic
1148206865 17:45784648-45784670 CTGTGGGTGTGATGGGGGCGGGG + Intronic
1151661046 17:75518263-75518285 ATATGGGTGCCATGAGCACATGG + Intronic
1152593955 17:81229245-81229267 CTGGGGGTGGGGTGGGCACAGGG + Exonic
1153739712 18:8111123-8111145 CTCTGTGTGTGTTGGGCACCTGG + Intronic
1155822796 18:30399201-30399223 CTAGGGGTGTGAGAGGCCCAGGG + Intergenic
1156213654 18:34975629-34975651 CAATGTGTGAAATGGGCACAAGG - Intergenic
1158495505 18:57951765-57951787 CTAGGGGGGTGATGGGGAAAGGG - Intergenic
1160487551 18:79308225-79308247 CTGTGGGTGGGATTGGAACAGGG + Intronic
1160529649 18:79556160-79556182 CCCTGGGTTTGATGGGCTCAGGG + Intergenic
1160745742 19:709996-710018 CTGTGGGAGTGAGGGGCAGAGGG - Intronic
1161064474 19:2230935-2230957 CTGTGGGTGTGCTGGGGCCAGGG + Exonic
1161403429 19:4078812-4078834 CTGTGGGGGTGCTGGGGACAGGG - Intergenic
1163421562 19:17216216-17216238 CTCTGGCTGTGGTTGGCACACGG - Exonic
1164601625 19:29566876-29566898 GAAGTGGTGTGATGGGCACAAGG + Intergenic
1164601747 19:29567322-29567344 GGACAGGTGTGATGGGCACAGGG + Intergenic
1164601792 19:29567479-29567501 GTGCTGGTGTGATGGGCACAGGG + Intergenic
1167400232 19:49261669-49261691 CTAGGGGGGTGCTGGGCAGAGGG + Intergenic
1168234592 19:55054102-55054124 CTAGGGCTGTGAGTGGCACAAGG + Intronic
925907856 2:8550093-8550115 CTATAGGTGGGATGGGCCCTTGG + Intergenic
926168026 2:10533779-10533801 CAATGGGTGCGCTGTGCACAAGG + Intergenic
928949614 2:36803110-36803132 TTGTGGGTGTGAATGGCACAGGG - Intronic
929131068 2:38572355-38572377 CTATGCGTGGGAGGGGAACATGG - Intronic
929450093 2:42030994-42031016 CTCTGGGTCTGCTGGGCACTGGG - Intergenic
929467666 2:42159763-42159785 CTATGGATGTGTAGGGCAGAGGG - Intergenic
930002710 2:46871752-46871774 GTATGGGTGTGATGGGCCTGCGG + Intergenic
932421498 2:71604071-71604093 CTAGGAGTGTGCTAGGCACAGGG + Intronic
935170803 2:100610377-100610399 CAAAGGGTGTGATGGGGGCATGG - Intergenic
935892553 2:107694904-107694926 ATGTGGGTGTGATGTGCACGTGG - Intergenic
936491986 2:112979813-112979835 CTAGGGCAGTGATTGGCACATGG + Intronic
938143338 2:128813490-128813512 CTCTGGCTGGGATGGGAACAGGG - Intergenic
938643514 2:133307973-133307995 CTATTTTTGTGATGGGCAGAAGG + Intronic
940373510 2:152927556-152927578 CTGTGGGTTAGATGGGTACAAGG + Intergenic
942189061 2:173453294-173453316 CTGGGGGTGTGATGGGGAAAGGG + Intergenic
946127092 2:217572461-217572483 CTAAGGGTCTGGAGGGCACAGGG + Intronic
947687831 2:232105860-232105882 CCATGGGGATGATAGGCACAGGG - Intronic
947866341 2:233400411-233400433 CACTGGGTGTGAAGGGCAAAGGG - Intronic
948064652 2:235068060-235068082 TTAGGACTGTGATGGGCACAGGG - Intergenic
948264457 2:236626861-236626883 CTCTGGTTGAGATGGGAACAGGG - Intergenic
948589657 2:239040839-239040861 CTCTGGGTGTGTTCTGCACATGG + Intergenic
1173252866 20:41373928-41373950 CTCTAGCTGTGGTGGGCACAGGG - Intergenic
1173980537 20:47220458-47220480 AGGTGGGAGTGATGGGCACAGGG + Intronic
1174251337 20:49221766-49221788 CTTTTGATGAGATGGGCACAGGG + Intronic
1174368010 20:50068058-50068080 CTAGGGCAGTGCTGGGCACACGG + Intergenic
1174867562 20:54152090-54152112 AAATGGGTGTGAGGAGCACAGGG - Intergenic
1178662909 21:34521878-34521900 CTATGGGAGTCACAGGCACAGGG + Intronic
1180229337 21:46417115-46417137 CTTCGTGTGTGATGGGCATAGGG + Intronic
1180234869 21:46452225-46452247 CTACTGGCATGATGGGCACATGG - Intergenic
1181115580 22:20631089-20631111 TTCTGGGCATGATGGGCACAGGG - Intergenic
1181551320 22:23640425-23640447 TGCTGGGTGTGAGGGGCACAGGG + Intergenic
1181796942 22:25318236-25318258 TGCTGGGTGTGAGGGGCACAGGG - Intergenic
1182267078 22:29125426-29125448 CTTGGGCAGTGATGGGCACAGGG - Intronic
1183521036 22:38296161-38296183 CTATGGGTTGGATGGGACCATGG - Intronic
1184411449 22:44328704-44328726 CCATGGTTGAGGTGGGCACAGGG - Intergenic
1185344135 22:50304080-50304102 CTCTGGGTGTGAAGGGCTCCAGG + Intronic
950654877 3:14430405-14430427 CTCTGGGGGTGCTGGGGACATGG - Intronic
950962676 3:17122025-17122047 ATATGATTGGGATGGGCACAGGG + Intergenic
954428817 3:50458361-50458383 ATGGGGGTGTGTTGGGCACAGGG - Intronic
955784681 3:62524716-62524738 ATATGGATGCTATGGGCACAAGG + Intronic
959818952 3:110709491-110709513 CTATCTGTGTGATGGGGGCAGGG - Intergenic
961237419 3:125379161-125379183 CTATGGTTTAGAGGGGCACAAGG + Intergenic
961714253 3:128847826-128847848 GGCTGGGTGTGCTGGGCACATGG + Intergenic
962670069 3:137695772-137695794 CTATGGGTCTTATGTTCACATGG - Intergenic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
964918460 3:161865736-161865758 CTAATGGTGTGATGAGCAAAAGG + Intergenic
965367133 3:167814811-167814833 CAATGGATGAGATGGGAACAGGG - Intronic
966703702 3:182886529-182886551 CAATAGTTGTAATGGGCACAAGG + Intronic
972474623 4:39438697-39438719 CTAGGGCAGTGCTGGGCACATGG + Intronic
972629328 4:40829673-40829695 CCATGGGTGTGTAGGGCAGAGGG + Intronic
972644459 4:40954357-40954379 CTTTGGGTGTGAAAGGCACGGGG + Intronic
973329746 4:48901021-48901043 GAATGGTTGTGATGGGCAGAGGG - Intronic
974991574 4:69097429-69097451 CTGTGTGAGTGATGGCCACAGGG - Intronic
975015353 4:69409745-69409767 CTATGTGAGAGATGGCCACAGGG - Intronic
975448913 4:74501307-74501329 CTATGTGTGTGAGGGGAAAAGGG + Intergenic
985933520 5:3077898-3077920 CTCTGGGTCTGATGAGCACGAGG + Intergenic
986393095 5:7303292-7303314 GTATGGGTGGGGTGGGCACTTGG + Intergenic
992402976 5:76428278-76428300 CTATGGGTCTGCTGGGTACCTGG + Intronic
995078970 5:108024067-108024089 CTATAGGAGTGATGGGGACAAGG - Intronic
996095022 5:119389351-119389373 CTATGGGAGTCATTGGCACATGG + Intronic
996957455 5:129201326-129201348 CAATGGGTGGGATGGCCATAGGG + Intergenic
998494196 5:142572896-142572918 CTTTGTGTGTCCTGGGCACAGGG + Intergenic
1001308858 5:170596281-170596303 CTATGGGTGTGATGGGCACAGGG - Intronic
1001411842 5:171517853-171517875 CTTTGGGAGTCATTGGCACACGG + Intergenic
1002312944 5:178325632-178325654 CAATGGGACTGATGGGCAGACGG - Intronic
1006816823 6:36857074-36857096 CAATGTCTGTGATGGGCACAGGG - Intronic
1006923013 6:37638548-37638570 CACTGGGGCTGATGGGCACATGG + Exonic
1007280812 6:40710886-40710908 CTATGTGTGTTCTGGGCACCAGG + Intergenic
1008382032 6:50846823-50846845 CTATGGGTGTGGAGGCCAGAAGG - Exonic
1009478149 6:64121062-64121084 CTATGGGGGAGGGGGGCACATGG - Intronic
1017574458 6:155786700-155786722 CTATTGATGTGATGGGGAAAGGG - Intergenic
1019303443 7:321336-321358 CCACAGGTGTGATGGGAACAGGG - Intergenic
1019604500 7:1901750-1901772 CTGTGGGTGGGCTGGGCTCAAGG - Intronic
1031875974 7:127141234-127141256 GTGTGGGTGGGATGGGCACTAGG - Intronic
1032851462 7:135799059-135799081 GCATGGGTGTGGTGGGCACAAGG - Intergenic
1035906834 8:3520972-3520994 CTTTGACTTTGATGGGCACATGG - Intronic
1036631115 8:10515934-10515956 CCTTGGATGTGATGGGCAGAGGG + Intergenic
1037516649 8:19638358-19638380 CGATGGGTGTGATCGCCACTTGG - Intronic
1038433956 8:27521668-27521690 TTTTGTGTGTGATGGGGACAGGG + Intronic
1038955891 8:32468168-32468190 CTGTGGGGGTGATGGGGACTGGG + Intronic
1040552254 8:48446596-48446618 CTATGGGTGAGCGGGGCCCACGG - Intergenic
1041306835 8:56470488-56470510 CTGTGTGTGTGATGGGAATAAGG + Intergenic
1041762350 8:61380170-61380192 CTATAGAAGTGATGGGCACTGGG + Intronic
1044601957 8:94014240-94014262 CTATGGGTGTCCTGGTCACATGG - Intergenic
1044861293 8:96526181-96526203 CTATGTTTGTTATGGGCATAAGG + Intronic
1045054335 8:98356324-98356346 CCAGGGGTGTGCTGGACACATGG + Intergenic
1048036359 8:130681062-130681084 GTTTGGGTGCGATGGGCACAGGG + Intergenic
1049301194 8:141871733-141871755 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1049301240 8:141871907-141871929 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1049301272 8:141872023-141872045 GTGAGGGTGTGATGGGCATAGGG + Intergenic
1049301288 8:141872082-141872104 GTGAGGGTGTGATGGGCATAGGG + Intergenic
1049301323 8:141872228-141872250 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1049301368 8:141872405-141872427 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1049301398 8:141872518-141872540 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1049301410 8:141872571-141872593 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1049301449 8:141872741-141872763 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1049301516 8:141872966-141872988 GTGAGGGTGTGATGGGCACAGGG + Intergenic
1057112810 9:92490122-92490144 CTGTGGAGGTGCTGGGCACAGGG - Intronic
1059519563 9:114927742-114927764 CTCTGTATGTGATGGGAACAGGG - Intronic
1059783229 9:117551853-117551875 CTTTGGGGGTGATGGGTAAAGGG + Intergenic
1059930649 9:119257292-119257314 CTGTGAGTTTGATGGGCTCAAGG + Intronic
1060041280 9:120303809-120303831 CCATGGGAGTGATGGGCCCAAGG + Intergenic
1062396471 9:136354849-136354871 CACAGGGTGTGGTGGGCACAGGG + Intronic
1185617687 X:1433283-1433305 CTTTGGTTGTCATGGGAACAGGG + Intronic
1195688599 X:107605977-107605999 CCCTCTGTGTGATGGGCACATGG + Intergenic
1197861849 X:130979551-130979573 CTCTGGGTGAGGTGGGCAAAAGG - Intergenic
1198674385 X:139116821-139116843 CTATGGCGGAGATGGGAACATGG - Intronic
1200101860 X:153692322-153692344 CAGTGGGGGTGATGGGCACAGGG - Intronic
1202016655 Y:20414056-20414078 CTATTGCTGTGATGGTTACATGG + Intergenic