ID: 1001308960

View in Genome Browser
Species Human (GRCh38)
Location 5:170597043-170597065
Sequence AAGCTCATGCAGCTGCTAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 1, 2: 3, 3: 29, 4: 288}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001308959_1001308960 6 Left 1001308959 5:170597014-170597036 CCAAGGCACAGAATTTAAGTAAC 0: 1
1: 0
2: 3
3: 27
4: 204
Right 1001308960 5:170597043-170597065 AAGCTCATGCAGCTGCTAACAGG 0: 1
1: 1
2: 3
3: 29
4: 288
1001308958_1001308960 16 Left 1001308958 5:170597004-170597026 CCTTGGGAAACCAAGGCACAGAA 0: 1
1: 0
2: 5
3: 34
4: 322
Right 1001308960 5:170597043-170597065 AAGCTCATGCAGCTGCTAACAGG 0: 1
1: 1
2: 3
3: 29
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001308960 Original CRISPR AAGCTCATGCAGCTGCTAAC AGG Intronic
900785038 1:4644104-4644126 AAGATCATGCAGCTGGTAGGTGG + Intergenic
901761719 1:11476290-11476312 AAGGTCACGCAGCTGGTAAGGGG + Intergenic
901872501 1:12146214-12146236 AAGCTCATGCAACTGATAAATGG - Intergenic
902182066 1:14696905-14696927 AAGTAAATGCAGCTGCCAACAGG + Intronic
902663082 1:17918933-17918955 AAGGTCATGCAGCTAGTAAGTGG - Intergenic
902756217 1:18550875-18550897 AAGGTCATGCAGCTTGTAAATGG + Intergenic
904873060 1:33633835-33633857 TAGCTGCTGCAGCTGCTATCTGG - Intronic
905293840 1:36941799-36941821 AAGATCATGCAGCTTTTAAAGGG + Intronic
905369452 1:37475226-37475248 AAGGTCATCCAGCTGTTAGCTGG - Intronic
905435379 1:37951955-37951977 AAGGTCATGCAGCAGTTAAGTGG + Intergenic
906963951 1:50438301-50438323 AAGGTCACGCAGCTACTAAGTGG + Intergenic
907321840 1:53607586-53607608 AAGGTCATGCAGCTGTGAAATGG + Intronic
907491125 1:54809589-54809611 AAGGTCATGAAGCTACCAACTGG + Intronic
907814426 1:57904188-57904210 AAGCTGATGCTGCTGGTATCAGG + Intronic
908742921 1:67347112-67347134 AAGGTCATACAGCTGCTATGTGG + Intronic
908879953 1:68720178-68720200 AAGATCATACAGCTGGTAAGTGG + Intergenic
909069754 1:70980358-70980380 AAGGTCACGCAGCTAATAACTGG - Intronic
916938368 1:169655031-169655053 AAGATCATACAGCTGATAAGTGG - Intergenic
917262215 1:173182480-173182502 AAACGCATGCAGCTACTAAGTGG - Intergenic
917720489 1:177782230-177782252 AAGGTCATGCAGATGATAAGGGG - Intergenic
919982069 1:202648004-202648026 AAGGTCACACAGCTGCTAAGTGG - Intronic
920535133 1:206732245-206732267 AAGGTCACGCAGCTGGTGACTGG + Intronic
921793121 1:219312467-219312489 ATCCTCATGCAGCTGCTCATTGG - Intergenic
923027605 1:230218384-230218406 AAGATCGTGCAGCTGCTAAAGGG - Intronic
923674349 1:236066661-236066683 AAGGTCATGCAGCTGGGAGCCGG + Intergenic
924944012 1:248832927-248832949 AAGGTCATACTGCTGCTAAGTGG + Intergenic
1063504630 10:6584990-6585012 AAGCTCATTCAGCTAATAAACGG + Intergenic
1063581906 10:7315754-7315776 AAGGTCATACAGCTCTTAACTGG - Intronic
1065530480 10:26665024-26665046 CAGCTCATGCTGCTTCTTACTGG + Intergenic
1065567583 10:27029903-27029925 AAGGTCACACAGCTGGTAACTGG - Intronic
1066710033 10:38223473-38223495 AAGCTCTTTCAGCTGCTAAGAGG - Intergenic
1066979978 10:42403981-42404003 AAGCTCTTTCAGCTGCTAAGAGG + Intergenic
1067816867 10:49485264-49485286 CAGGTCACGCAGCTGCTAAGTGG + Intronic
1067907111 10:50304141-50304163 AAGGGCATGCAACTGGTAACTGG - Intergenic
1071027036 10:81126887-81126909 AAGCCCACGCAGCTTCTACCTGG - Intergenic
1071149909 10:82621742-82621764 AAGGTCAGGCAGCTACTAACTGG + Intronic
1072631092 10:97146980-97147002 AGGCTCAAGCAACTGCTAAAAGG + Intronic
1073681208 10:105705470-105705492 AATGTCACACAGCTGCTAACAGG - Intergenic
1074241772 10:111646698-111646720 AAAGTCATGCACCGGCTAACTGG - Intergenic
1074277785 10:112021320-112021342 GAACTCATGCAGCTCCTAATAGG - Intergenic
1074846103 10:117399460-117399482 ACGGTCATACAGCTGCTAAGTGG + Intergenic
1075034533 10:119053284-119053306 GGGTTAATGCAGCTGCTAACTGG - Intronic
1077124970 11:929351-929373 CCACTCATGCAGCTGCTAAGAGG - Intronic
1077918938 11:6629107-6629129 AAGCTCATGCAGCTTGGAAGTGG - Intronic
1079145972 11:17852212-17852234 AAGGTCATTCAGCTACTAAGTGG + Intronic
1079335030 11:19563765-19563787 AAGTTCATACATCTGGTAACTGG - Intronic
1080443437 11:32315775-32315797 AAGGTCACACAGCTGGTAACTGG - Intergenic
1080750928 11:35149415-35149437 AAGCTCACGCTGCTGTTAAGTGG - Intronic
1082983635 11:59146471-59146493 AAGGTCATGCAGCTAGTAAGTGG + Intronic
1083233049 11:61335228-61335250 AAGGTCATGCAGCTGGTCAGTGG - Intronic
1084574393 11:69979414-69979436 AAGTCCATGCAGCTGGTAAGCGG - Intergenic
1085955835 11:81393579-81393601 AAGCTCATGGATCTTCTAAAGGG + Intergenic
1086752127 11:90509902-90509924 AAGCTTAGGCAGCTAATAACTGG + Intergenic
1086945229 11:92838132-92838154 AAGATCATGCAGCTGGTAAGTGG + Intronic
1087735189 11:101824640-101824662 AAGCTCATGCAACTCCCAAGTGG - Intronic
1088688354 11:112304123-112304145 AAGGTCATACAGCTGATAAGTGG + Intergenic
1088804484 11:113339595-113339617 ACGCTAATGTAGCTGCTAAAAGG + Intronic
1089828584 11:121303097-121303119 AAGGTCATCAAGCTGCTAAGTGG - Intronic
1092985335 12:13839622-13839644 AAGGTCATGCAGCTGGCAAGAGG + Intronic
1093556398 12:20480083-20480105 AAGCTCTTGCTGCTGCTACCTGG + Intronic
1095757720 12:45788365-45788387 AAGATCATGTAGCTGATAAATGG + Intronic
1095812380 12:46383972-46383994 AAGCGCCGGCAGCTGCCAACAGG - Intergenic
1096259811 12:50083408-50083430 AGGCCAATGCAGCTGCTCACAGG - Exonic
1098084795 12:66830752-66830774 AAGGTCACACAGCTGCTAAATGG + Intergenic
1099651110 12:85429301-85429323 AAGCACATACAGCGGCTACCTGG - Intergenic
1101078930 12:101161755-101161777 AAGTTCATGCAGCCCCTAAAGGG + Intronic
1101090375 12:101279413-101279435 AAGGTTGTGCAGCTGGTAACTGG - Intergenic
1101631212 12:106496758-106496780 AAGCTCATTGAGCTGCTGGCTGG + Exonic
1101650149 12:106669941-106669963 GAGCTCACACAGCTGCTAAGTGG - Intronic
1102088605 12:110166025-110166047 AAGGTCATCCAGCTGGTAAACGG - Intronic
1102496490 12:113323027-113323049 AAGCTCATGGTGGTGGTAACTGG - Intronic
1102538733 12:113602382-113602404 AAGGTCATGCAACTGGTAAGTGG + Intergenic
1102772924 12:115494228-115494250 AAGGTCATGCAGCTAGTAAGTGG + Intergenic
1102774073 12:115503727-115503749 AAGACCATACAGCTGCTAAGTGG + Intergenic
1103187960 12:118977909-118977931 AAGCTCATACAGCTACAAAGTGG + Intergenic
1104849403 12:131864152-131864174 AAAGGCATGCAGGTGCTAACAGG - Intergenic
1105615989 13:22012903-22012925 AATTTCAGGCTGCTGCTAACAGG + Intergenic
1107305712 13:39016373-39016395 AAGATCATGCAGCTACTACATGG + Intronic
1107446763 13:40476411-40476433 AAGATCATACAGCTGGTAAGTGG + Intergenic
1109231361 13:59761914-59761936 AAGCTCAGACAGCTGCTAGATGG + Intronic
1109321183 13:60811804-60811826 AAGGTCATGAAGTTGCTAAGTGG - Intergenic
1110636121 13:77768542-77768564 AACCGCATCCCGCTGCTAACAGG + Intergenic
1112144179 13:96679609-96679631 AAGCCCCTGCAGCTGCTTTCTGG + Intronic
1114169687 14:20259860-20259882 AAGGTCATACAGCTGGTAAGTGG - Intronic
1114648356 14:24268126-24268148 CAGCTCCTGCAGCTCCTTACAGG + Exonic
1115149378 14:30266721-30266743 TAGCTCATGCAGCTCGTAAGTGG + Intergenic
1116276017 14:42832675-42832697 AATCTAATGCCACTGCTAACTGG + Intergenic
1117434711 14:55704891-55704913 AAGATCATACAGCTACTAAGTGG + Intergenic
1117886118 14:60364851-60364873 AAGATTATGCAGCTACTAAATGG - Intergenic
1118039475 14:61901437-61901459 AAGCTCAAACAGCTGGTAAGTGG + Intergenic
1119390284 14:74287005-74287027 GATTTCATGCAGCTGCTCACAGG - Intronic
1119543879 14:75457890-75457912 AAGGCCATGCAGATGCAAACGGG + Intronic
1119836047 14:77749776-77749798 AAGCACATTCAAATGCTAACAGG + Intronic
1119960819 14:78854651-78854673 AAGGTCATACAGCTACTAAGTGG + Intronic
1121404306 14:93709807-93709829 AAGGTCATGCAGCTAGTAAGAGG + Intergenic
1121521256 14:94587567-94587589 AGGCTCATGGAGATGCTCACAGG - Exonic
1122086459 14:99310283-99310305 AAACTCATTCAGCTGATAAATGG + Intergenic
1127071606 15:55292341-55292363 AAGATCATGCAGCTAATAAGTGG + Intronic
1127270385 15:57395812-57395834 AAGACCATGCAGCTGGTAAGTGG + Intronic
1128314419 15:66651411-66651433 AAGATCACACAGCTGCTAAGTGG + Intronic
1128336056 15:66786422-66786444 AAGGTCACACAGCTGCTAAGTGG - Intergenic
1128620354 15:69143942-69143964 AAGGTCATACAGCTGGTAAGTGG + Intergenic
1130048902 15:80467291-80467313 AAGCTCTTGCAGCTGTTTCCTGG - Intronic
1131581621 15:93648723-93648745 AAGCTGAGGCAGCTGATCACGGG + Intergenic
1134006363 16:10821139-10821161 AAGCTGATGCTGCTGCTCCCTGG + Intergenic
1134379663 16:13712216-13712238 AAGGTCATGCAGCTGATAAAAGG + Intergenic
1134811258 16:17168800-17168822 AAGATCCTGCAGCTGCTTCCTGG - Intronic
1135685451 16:24494976-24494998 AAGGTCATGCAGCTGGTAAGTGG - Intergenic
1136858698 16:33681661-33681683 AACCTCACTCAGCTGCTGACAGG + Intergenic
1138099174 16:54238137-54238159 TAGGTCCTGCAGCTCCTAACTGG + Intergenic
1140454879 16:75099178-75099200 AAGCTCATGCAGCTGCTAAGTGG - Intronic
1141220407 16:82064160-82064182 AGGCTCATGAAGCTGCTCAAAGG + Intronic
1141350412 16:83289682-83289704 AAGCCCAAGCAGCTGATAAATGG - Intronic
1142270645 16:89087614-89087636 AGTATCATGCAGCTACTAACTGG + Intergenic
1144150201 17:12435834-12435856 AAGTTTATACAGCAGCTAACTGG + Intergenic
1144552209 17:16250803-16250825 AAGGTCATCCAGCTAATAACTGG + Intronic
1146394101 17:32448799-32448821 AAGCTCATTCAACTAATAACTGG + Intronic
1146808242 17:35882550-35882572 AAGATCACGCAGCTGATAAGTGG + Intergenic
1146976614 17:37118676-37118698 AAGCTCATTCAGCTACAAAATGG - Intronic
1148153507 17:45410160-45410182 CAGCTCACCCAGCTCCTAACAGG + Intronic
1148453679 17:47798573-47798595 AAGCTGAACCAGCTCCTAACTGG + Intergenic
1149665591 17:58362933-58362955 AACCTCATCCAGCGGCTCACTGG - Intronic
1150197458 17:63315311-63315333 AACCTCATTGAGCTGGTAACAGG - Intronic
1150980989 17:70141396-70141418 AAGTTCATACAGCTGCCAAGGGG - Intergenic
1151328059 17:73390987-73391009 AAGTTCACGCAGCTGCCGACCGG + Intronic
1151350052 17:73526349-73526371 AAGGTCATGCAGGTCCTAATTGG - Intronic
1152251906 17:79216817-79216839 AGGGTCATGCAGCTGCCAAGTGG + Intronic
1153521497 18:5958612-5958634 AAGCTCATGCAGCTTCTAAGGGG + Intronic
1153692010 18:7603433-7603455 AAGCCCAGGTAGCTGTTAACAGG - Intronic
1156362091 18:36392104-36392126 AAGGTCATGCAGCCTCTAAGTGG - Intronic
1156830469 18:41485248-41485270 AAGGTCATGCAGCTGGTAAATGG + Intergenic
1157601137 18:48893895-48893917 ACGCTCATGCAGCTGGGACCTGG + Intergenic
1157666953 18:49495329-49495351 AAGCTCCTGCAGTTGCTCCCTGG + Intergenic
1158649286 18:59272451-59272473 CAGCTCATGCAGCTGGTACGTGG + Exonic
1159986894 18:74853308-74853330 AAGCTCCTCCATCTGTTAACTGG - Intronic
1160175373 18:76589815-76589837 AAGCTAATGCATCAGCTAAAAGG - Intergenic
1160192382 18:76724624-76724646 AAGAGCATGCAGCTGTTAAGTGG - Intergenic
1162403323 19:10459084-10459106 AAGATCATGCAGCTCATAAGTGG - Intronic
1163469458 19:17487976-17487998 AACCTCCTGTAGCTGCTGACAGG - Intronic
1165693192 19:37879816-37879838 AAGGTCATTCAGCTGCTTATTGG + Intergenic
1165727130 19:38120965-38120987 AAGGTCATGCAGCTGGTAAGTGG - Intronic
1166343887 19:42153556-42153578 AAGCACACGCAGCTGCCCACAGG - Intronic
1167252030 19:48404442-48404464 AAGATCATGCCGCTGCTCACCGG + Intronic
1167730513 19:51250915-51250937 AAGCTCATGCAGCCTCTGATTGG + Intronic
1167730525 19:51251045-51251067 AAGCCCATGCAGCCGCTGATTGG + Intronic
925083987 2:1093444-1093466 AAACTTCTGCAGCTTCTAACTGG - Intronic
925580554 2:5406147-5406169 AAGCTTTTGCAGTTGCTAAGGGG - Intergenic
925633021 2:5914808-5914830 AAGCTCAGGCAGATGGTAAATGG + Intergenic
926142418 2:10375626-10375648 CAGGTCACACAGCTGCTAACAGG - Intronic
926266148 2:11323273-11323295 AAAGTCATGCAGCTGCTAAGTGG - Intronic
927056877 2:19373550-19373572 GAGCCCATGCAGCAGCTCACAGG + Intergenic
928034687 2:27811086-27811108 CAGCTCATGAAGCAGCTAAAGGG - Intronic
929753451 2:44741526-44741548 AAACTCATACAGCTACTAAGGGG + Intronic
932345036 2:70989714-70989736 CAGCACATTCAGCTGTTAACAGG - Intronic
932355713 2:71067126-71067148 AAGCTCATCCAGCTAGTAAATGG + Intronic
932746308 2:74336649-74336671 AAGTTCACACAGCTGATAACTGG + Intronic
935180225 2:100682615-100682637 AAGGTCAATCAGCTGCTAAGTGG + Intergenic
935246588 2:101224198-101224220 CAGTTCACGCAGCTGGTAACTGG + Intronic
936790804 2:116149286-116149308 AAACTCATGCTGATGCTAAATGG + Intergenic
936952058 2:117987555-117987577 AAGGTCATGCAGCTGATTAGTGG - Intronic
937124515 2:119464908-119464930 AAGGTCATATAGCTGCTAAGTGG - Intronic
937971289 2:127551355-127551377 AAGATCACACAGCTGTTAACTGG + Intronic
939278079 2:140027580-140027602 AATCTAATGCCGCTGCTGACTGG - Intergenic
940297879 2:152147630-152147652 AAGGTCATGCAGCTGGTAACTGG - Intronic
941931371 2:170943569-170943591 AAGCTCACACAGCTAATAACTGG + Intronic
942128840 2:172857226-172857248 AAGGTCATACAGCTGGTAAGTGG + Intronic
944302912 2:198144944-198144966 AAAGTCATACAGCTGCTAAGTGG - Intronic
947909921 2:233794182-233794204 AAGGTCATGTGGCTGCTAAGTGG + Intronic
948596911 2:239085455-239085477 GAGCTCCTGCAGCGGCTCACGGG + Intronic
1170883420 20:20317614-20317636 ATGCCCCTGCAGCTGCTAATAGG + Intronic
1171213925 20:23338029-23338051 AAGATCATGCAGCTGGTAAGTGG + Intergenic
1172217413 20:33246063-33246085 AGGCTCATTCAGCTGCTTGCTGG - Intergenic
1172610028 20:36243829-36243851 AAGGTCACACAGCTGCTAAGTGG + Intronic
1173686162 20:44924733-44924755 AAGCTCATAGAGCTGCTGATGGG - Intronic
1173711752 20:45163544-45163566 AAGGTCATTCAGCTACTCACTGG + Intergenic
1173900902 20:46588226-46588248 AGGCTCAGGCAGCTGCCCACTGG + Intronic
1174421073 20:50399516-50399538 GAGCTCATGGAGCTGCACACAGG + Intergenic
1174739882 20:53002238-53002260 AAGCTTCTGCAGCTGCTTAGAGG + Intronic
1174917234 20:54666307-54666329 AAACTTATGCAGCTGATAAGTGG - Intergenic
1175112953 20:56661735-56661757 AAGCTCATCCAGCTGGTATAGGG + Intergenic
1178002838 21:28182761-28182783 CAGCTCCTGCAGCTGCTTTCTGG - Intergenic
1178360915 21:31948099-31948121 AAGGTCATAGAGCTGCTAAGTGG + Intronic
1180572079 22:16734497-16734519 AAGACCATGCAGCTTCCAACTGG - Intergenic
1181971509 22:26693869-26693891 AAGCTCATATAGCTGGTAAATGG - Intergenic
1183028239 22:35082557-35082579 CAGCTCATGCAGCTGCTCAGTGG - Exonic
1183350540 22:37332330-37332352 AAGGTCGTGCAGCTGGTAAATGG + Intergenic
1184806455 22:46797581-46797603 AAGTTCAAGCAGCTGCTTGCCGG + Exonic
950047166 3:9955686-9955708 AAGGTCATGCAGCAACTAAGGGG + Intergenic
950085366 3:10253848-10253870 AAGGCCATGCAGCTGGTAAATGG + Intronic
950639438 3:14339354-14339376 AAGGTCATGCAGCTGGTCAGTGG - Intergenic
950796878 3:15517311-15517333 AAGGTCATGCAGCTGTTATGTGG - Intronic
950821356 3:15762922-15762944 AAGATCATGGAGGTGCTAAGAGG + Intronic
951549171 3:23859615-23859637 AAGGCCATTCAGCTGCTAACTGG - Intronic
951678505 3:25269443-25269465 AAGGTCATGCAGCTAGTAAGTGG - Intronic
951927709 3:27926587-27926609 AAGCTCATACAGCTGATGAGTGG + Intergenic
952246712 3:31601912-31601934 AAGATCATGTAGCTAATAACGGG + Intronic
957106112 3:75889910-75889932 AAGGCCATGCAGCTTCCAACTGG + Intergenic
960120135 3:113940790-113940812 AATCTTATGCAGCTGTTAAGGGG - Intronic
960203416 3:114866075-114866097 AAGGTCATGTAGCTAGTAACTGG - Intronic
960385316 3:117015709-117015731 GAGATGATGTAGCTGCTAACAGG - Intronic
960535763 3:118812994-118813016 AAGGTCATGCAGCTAATAAATGG + Intergenic
961026863 3:123565971-123565993 CAGCTCATACAGCTGGTAAATGG - Intronic
962254437 3:133860760-133860782 GAGCTCATCCAGCTGCTCTCAGG - Intronic
962340285 3:134576576-134576598 AAGGGCATACAGCTGCTAAGTGG - Intergenic
962375539 3:134855960-134855982 AAGGTCATGTAGCTACTAAAGGG + Intronic
962537271 3:136341234-136341256 AAGGCCATGCAGCTGCCAAGTGG + Intronic
962631968 3:137286191-137286213 AAGATCACGCAGCTGGTAAATGG - Intergenic
964710113 3:159662751-159662773 AAGATCATGCAGCTTATAAGAGG + Intronic
966188621 3:177250379-177250401 AAGATCATCCAGCTGCAAAGTGG + Intergenic
966650878 3:182299644-182299666 AAGCTCATACAGCTGGTAAGTGG - Intergenic
967049216 3:185766839-185766861 AAGGTCATGCAGCAGTTAAGAGG + Intronic
968279612 3:197466393-197466415 AAGCTCACACAGCTGGTAAGAGG - Intergenic
968431422 4:561303-561325 AAGCTCCTGCAGCTGCTCTGAGG + Intergenic
970219546 4:13796743-13796765 AAGATCATGTAGCTACTAAGTGG + Intergenic
970439807 4:16071012-16071034 AAGATCATTCAGCAGTTAACAGG + Intronic
971267650 4:25109189-25109211 AAGCTCATGCAGTTTCCAGCTGG + Intergenic
972165754 4:36281973-36281995 CAGCACATGCAGCTGCTGGCAGG - Intronic
973564815 4:52173861-52173883 AGGGTCATGCAGCTGCTTAGTGG + Intergenic
973999832 4:56500663-56500685 AAGCTCCTGCAGTTGCTCCCTGG - Exonic
977522927 4:98108701-98108723 AAGATCATGCAGCTATTAAATGG - Intronic
979296285 4:119035918-119035940 AAGGTCATTCGGCTGCTAAGAGG + Intronic
981620235 4:146688414-146688436 AAGCTCATACAGCTAGTAAATGG - Intergenic
981714362 4:147738181-147738203 AAGCTCAACCACCTGCTAACAGG + Intronic
983872772 4:172841410-172841432 AAGTTCATGCAGCTACTATTTGG + Intronic
985294415 4:188419756-188419778 AAGTTCAAGCAGCCGATAACTGG - Intergenic
985506437 5:284186-284208 AAGGTCTTGCAGCTGCAGACCGG + Intronic
986775794 5:11012661-11012683 AAGGTCATGCTGCTGGTAAGTGG + Intronic
987536275 5:19192351-19192373 AAGATCCTGCATCTGATAACAGG - Intergenic
988879602 5:35486741-35486763 AAACTCATGCAGCTGCTAGGAGG + Intergenic
990738076 5:58886009-58886031 CAGGTCAGGCAGCTGCTAAAAGG + Intergenic
992719048 5:79541500-79541522 AAGCTTATGCTACTTCTAACTGG - Intergenic
992981909 5:82184164-82184186 AAGATCATGCAGCTAGTAAGTGG - Intronic
995235994 5:109831108-109831130 AAGGTCAAACAGCTGCTAAGTGG - Intronic
996331647 5:122336364-122336386 AAGATCATACAGCTGGTTACTGG + Intronic
996663328 5:126028951-126028973 AATCTCATGAAGCAGCTTACTGG - Intergenic
997614759 5:135238790-135238812 AAGGTCACCCAGCTGCTAAGCGG - Intronic
998183511 5:139961757-139961779 AAGCAAAAGCAGCTGCTATCAGG + Intronic
999246664 5:150158578-150158600 AAGCTCATGTAGCTTGAAACTGG - Intergenic
999594900 5:153192154-153192176 AAGGTCATGCAGCTGGTCAATGG - Intergenic
999665316 5:153906684-153906706 AAGGTCATGCAGCTACTAACTGG + Intergenic
1000173146 5:158723673-158723695 AAGCTTATGCAGCTAGTAAGTGG - Intronic
1001308960 5:170597043-170597065 AAGCTCATGCAGCTGCTAACAGG + Intronic
1001408886 5:171496332-171496354 AAGTTCACACAGCTGCCAACTGG + Intergenic
1002208538 5:177581328-177581350 AAGGTCATTCAGCTGATAAGTGG + Intergenic
1006816262 6:36852443-36852465 AAGTTCATGCTGCTGCTAAGTGG + Intergenic
1007218484 6:40260043-40260065 AAGGTCATGCAGCTGGCAAGTGG + Intergenic
1007455429 6:41973620-41973642 AAGGTCATGCAGCTGGTAGGTGG - Intronic
1007769282 6:44180220-44180242 AAGCTCAGGGAGCTGCTGTCGGG + Intronic
1008628519 6:53341960-53341982 AAGCCCACGCAGCTGTTAAGTGG + Intronic
1010360435 6:74987071-74987093 CAGCTCCTGCAGTTGCTAAAGGG + Intergenic
1010480638 6:76348610-76348632 AAGGTCAAGCAGCTTCTAAATGG + Intergenic
1011214858 6:84994668-84994690 AAAATCATACAGCTGGTAACTGG + Intergenic
1013283005 6:108656321-108656343 AAGCACATGCAGCTGGTGTCTGG + Intronic
1013409507 6:109871628-109871650 AAGGTCATGCAGCTTCCATCTGG + Intergenic
1013548271 6:111181893-111181915 AAACTGATGCAGCTGCTACTAGG - Intronic
1013618693 6:111868735-111868757 AAGATCATACAGCTACTAAGTGG - Intronic
1014594571 6:123318426-123318448 AACCTCATTCAGCTGCTAAGTGG + Intronic
1015321435 6:131880199-131880221 AAAGTCATGCAGCTGCTCAGTGG - Intronic
1017495658 6:154980949-154980971 AAACTCATACAACTCCTAACTGG + Intronic
1017732066 6:157325482-157325504 AAGCTCACACAGCTGTTAAGTGG + Intergenic
1017843027 6:158237524-158237546 AAGCTCCTGCAGTTGCTCCCTGG + Intronic
1019054659 6:169214322-169214344 ACGCTGATGCTGCTGCTCACAGG - Intergenic
1020438355 7:8189803-8189825 AGGCTCCTGCAGCTGCTGCCTGG - Intronic
1020534431 7:9377347-9377369 AAACTCATGGTGCTGCAAACAGG - Intergenic
1021497562 7:21292910-21292932 AAGGTCAGGCACCTGCTAAGTGG + Intergenic
1021936431 7:25636594-25636616 AAGGTCCTGCAGCTCCTAAGCGG + Intergenic
1024152939 7:46591104-46591126 GAGCTCCTGCAGCTGCTAGTTGG - Intergenic
1024232236 7:47371401-47371423 AAGGTCAGGCAGCTGCTAGGAGG + Intronic
1025237409 7:57244184-57244206 GAGCGAATGCAGCTGCAAACAGG + Intergenic
1025249755 7:57343951-57343973 GAGCTCATGGAGCTGCACACGGG - Intergenic
1026248384 7:68644786-68644808 AAGAACATGCAGATGCCAACAGG + Intergenic
1026312659 7:69200923-69200945 AGGGCCATGCAGCTGCTAAGAGG + Intergenic
1031143871 7:117976298-117976320 GAATTCATGCAGCTTCTAACTGG + Intergenic
1032233709 7:130101072-130101094 AAGGTCATACAGTTGCTAAATGG - Intronic
1034213451 7:149384791-149384813 AAGCTCATAAAGCTTATAACAGG + Intergenic
1037256060 8:16955552-16955574 AAGATCATGCAGCTAATAAGTGG + Intergenic
1038126041 8:24673826-24673848 AAGCTCAAGAAGCTTCAAACAGG + Intergenic
1038129093 8:24708933-24708955 AAGGTCATATAGCTGCTAAGTGG - Intergenic
1038469718 8:27804600-27804622 AAAATCATTCAACTGCTAACTGG + Exonic
1038885417 8:31657809-31657831 AAGGTCATGCAGCTGCTGGGAGG + Intronic
1039729168 8:40255951-40255973 ATGGCCATGCAGCTGTTAACTGG - Intergenic
1040806133 8:51398295-51398317 AAGCTGAAGCAGCTGGGAACAGG + Intronic
1042106086 8:65327581-65327603 AAGATCACACAGCTACTAACTGG + Intergenic
1042154018 8:65821961-65821983 AAGCTGATCCAGTTCCTAACAGG + Intronic
1043443954 8:80301158-80301180 GAGATCATCCAGCTGCTCACAGG + Intergenic
1044916153 8:97114354-97114376 AAGTTCATACAGCTGCTCAACGG - Intronic
1045296747 8:100878055-100878077 CACCTCATGGAGCTGCTGACCGG - Intergenic
1045415320 8:101960578-101960600 AAGGTCATCCAGCTGTTAAGTGG - Intronic
1045770204 8:105728421-105728443 AAGCTCATGAAACTGCTATCTGG + Intronic
1045875774 8:106979158-106979180 AAGGTTATGCTGCTGCTAACTGG - Intergenic
1046105525 8:109661378-109661400 AACCTCATTTAGCTTCTAACTGG + Intronic
1046859423 8:119073168-119073190 TAGGTCATGCAGCTGCTAATAGG + Intronic
1047314193 8:123717174-123717196 AAGTTCACACAGCTGCTAAGAGG - Intronic
1049040544 8:140109518-140109540 AAGGTCATGCAGCTAGTAAATGG - Intronic
1049320565 8:141994064-141994086 AAGATTTTGCAGCTGCTAAGTGG + Intergenic
1049652506 8:143778467-143778489 ATGTTCATGCAGCTACTAACAGG + Intergenic
1050081470 9:1920268-1920290 AAGCTCATGTAGCTAGTAAGTGG + Intergenic
1050583378 9:7084614-7084636 AAGATCATGCAGCTCCTAAATGG - Intergenic
1052458707 9:28734554-28734576 AAGGTCATACAGCTGCTAAATGG + Intergenic
1056316633 9:85396646-85396668 AAGCTCACACAGGTGCTAAGTGG + Intergenic
1058948129 9:109877752-109877774 AAGCTCACTCAGCTGGTAAATGG + Intronic
1059421526 9:114195449-114195471 GAGGTCATGCAGCTGATAAGTGG + Intronic
1060543050 9:124444421-124444443 AAGTTCATGTAGCTACTAAGAGG + Intergenic
1060758972 9:126233027-126233049 AAGATCATGCAGCTTGTAAGTGG + Intergenic
1061438861 9:130585457-130585479 AAGGTCATGCATCGGCTTACAGG - Intronic
1061604450 9:131698357-131698379 AAGATCATGCAGCTAGTAAGTGG - Intronic
1187103095 X:16215074-16215096 AAGGTCATACAGCTACTAGCTGG + Intergenic
1187193850 X:17062181-17062203 AAGGTCATACAGCTGATAAATGG - Intronic
1187212064 X:17241555-17241577 AAGCTCATTCAGTTGGTAAGTGG + Intergenic
1187617661 X:21015234-21015256 AAGCCAATGCAGCTTCTATCTGG - Intergenic
1187870930 X:23764831-23764853 AAACTCACACAGCTGGTAACTGG + Intronic
1189956888 X:46284901-46284923 AAGGTCTTGCAGCTTCTAAGTGG - Intergenic
1192181213 X:68916892-68916914 AAGGTCATGCAGCTGGTAAGTGG + Intergenic
1193763967 X:85502984-85503006 AAGGTCATGCAGCTACTAAGTGG - Intergenic
1194473713 X:94332928-94332950 AAACTAATACAGCTGCTAAGAGG - Intergenic
1195111444 X:101654554-101654576 AACCTCATGCAGGTCCTGACAGG - Intergenic
1195402395 X:104475371-104475393 AAAGTCATGCAGCTGAGAACTGG - Intergenic
1195852650 X:109299762-109299784 AAAGTCATGCAGCTGGTAAGTGG - Intergenic
1195906964 X:109853600-109853622 AAGATCATCCACCTGCTTACAGG + Intergenic
1196736367 X:118984202-118984224 AAGGTCATGCAGCTGGTGATTGG + Intronic
1198069286 X:133131996-133132018 AAGCTCATGTAGTTGTTGACAGG - Intergenic
1198892358 X:141412078-141412100 AAGATCATGCAACTACTAAGTGG + Intergenic