ID: 1001308983

View in Genome Browser
Species Human (GRCh38)
Location 5:170597173-170597195
Sequence GAACATTTAGGCCCGCACGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 63
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001308976_1001308983 20 Left 1001308976 5:170597130-170597152 CCTGCCTCTGTTAGGACTTGGTC 0: 1
1: 1
2: 0
3: 6
4: 90
Right 1001308983 5:170597173-170597195 GAACATTTAGGCCCGCACGGTGG 0: 1
1: 0
2: 0
3: 7
4: 55
1001308977_1001308983 16 Left 1001308977 5:170597134-170597156 CCTCTGTTAGGACTTGGTCCAAT No data
Right 1001308983 5:170597173-170597195 GAACATTTAGGCCCGCACGGTGG 0: 1
1: 0
2: 0
3: 7
4: 55
1001308979_1001308983 -2 Left 1001308979 5:170597152-170597174 CCAATGTCATCATCCTAGAAGGA 0: 1
1: 0
2: 2
3: 12
4: 160
Right 1001308983 5:170597173-170597195 GAACATTTAGGCCCGCACGGTGG 0: 1
1: 0
2: 0
3: 7
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001308983 Original CRISPR GAACATTTAGGCCCGCACGG TGG Intronic