ID: 1001310033

View in Genome Browser
Species Human (GRCh38)
Location 5:170603932-170603954
Sequence AGGGAGAAACAGGAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1368
Summary {0: 1, 1: 0, 2: 12, 3: 141, 4: 1214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001310025_1001310033 7 Left 1001310025 5:170603902-170603924 CCACTGTCTTCACTGTTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 109
Right 1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG 0: 1
1: 0
2: 12
3: 141
4: 1214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001310033 Original CRISPR AGGGAGAAACAGGAGGTGGA GGG Intronic
900031197 1:374121-374143 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
900051751 1:602321-602343 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
900179139 1:1303717-1303739 AGGGGGCAACAGGCCGTGGAGGG - Intronic
900204456 1:1426143-1426165 AGGGAGACGGAGGAGGAGGAGGG + Exonic
900304127 1:1994900-1994922 AAAGAGAAGCGGGAGGTGGAGGG + Intronic
900757944 1:4450397-4450419 AGGGAGAAACAGGAAGACAAAGG - Intergenic
900800001 1:4731600-4731622 AGGGAGAAGCAGGTGGTTTAGGG + Intronic
900851217 1:5144596-5144618 AGGGAGGAACAGGAGGAGCCCGG - Intergenic
900867505 1:5278718-5278740 AGGAAGCCACAGGAGGTGGGAGG - Intergenic
900921828 1:5677438-5677460 AAGGTGGAACAGGAGGTGAAAGG + Intergenic
900940904 1:5798096-5798118 ATGGGGAGAGAGGAGGTGGAGGG + Intergenic
900977150 1:6025073-6025095 AGAGACAAACAGGAGGGAGAAGG - Intronic
900983273 1:6058733-6058755 AGGAAGGAACAGGAGGAGGGAGG + Intronic
901089539 1:6632250-6632272 AGGGAGAAGCTGGCTGTGGAGGG + Intronic
901105124 1:6749445-6749467 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
901266828 1:7917248-7917270 AAGTAGAAAAAGAAGGTGGAGGG + Exonic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
901644077 1:10707213-10707235 GGGGAGAGAAAGGTGGTGGAAGG - Intronic
902517637 1:16997881-16997903 AGGGGGAAGGAGGAGGGGGAGGG + Intronic
902654826 1:17859961-17859983 AGGGAGGAGCAGGTGGAGGAAGG + Intergenic
902726698 1:18340953-18340975 AAGGAGAAGAAGGAGGGGGAGGG - Intronic
902737295 1:18409533-18409555 AGGAAGAAACAGGATCTGAAGGG - Intergenic
902823427 1:18956829-18956851 CGGGAGAACCCGGAGGTGGGCGG - Intergenic
902876320 1:19342955-19342977 AGGGAGACCCACGAGGCGGAAGG + Intronic
903217734 1:21852472-21852494 AGAGAGGAAGAGGAGGTGGGAGG + Intronic
903480869 1:23652407-23652429 AGGGAGAGGGAGGAGGGGGAAGG + Intergenic
903659925 1:24970711-24970733 AGGGAGACACGGGGAGTGGAGGG - Intergenic
903676539 1:25068050-25068072 AGGAAGAACCAGGAGGAGGGTGG - Intergenic
904087077 1:27916760-27916782 AGGAGGAAAGAGGAGGAGGAAGG - Intergenic
904293924 1:29505609-29505631 AGGGAGAAGCGGGAGGAGGTCGG + Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904440255 1:30525332-30525354 AAGAAGAAAGAGGAGGAGGAGGG + Intergenic
904472352 1:30743758-30743780 AGGGGGAAACAGATGGTGGGTGG - Intronic
904963437 1:34352669-34352691 AGGGAGAAAACCAAGGTGGAAGG + Intergenic
905074890 1:35261733-35261755 AAGGAGAAAAAGGAGGAAGAAGG - Intergenic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905808212 1:40892348-40892370 AGGGAGAAACAGAAAGTGACAGG - Intergenic
906105761 1:43291191-43291213 ATAGAGAAACAGGAGGTGGTGGG + Intergenic
906287025 1:44594293-44594315 AGGGAGTGAAAGGAGGAGGAGGG - Intronic
906348767 1:45038985-45039007 AGTGAGAAACAGGCAGTCGATGG + Exonic
906375344 1:45292240-45292262 AGGGAGAGAGAGGAGGTGAGTGG - Intronic
906584080 1:46961261-46961283 AGGGAGGTACAGGAGTGGGAGGG + Intergenic
906628775 1:47347111-47347133 AAGGAGGAACAGAAGGAGGAAGG - Intronic
906668103 1:47635858-47635880 AGGAAGGAACAGGAGGTGGAGGG - Intergenic
906672724 1:47668461-47668483 TGAGAGAAGGAGGAGGTGGAGGG + Intergenic
906721181 1:48005930-48005952 AGGGAGGAGCAGGGGTTGGAGGG + Intergenic
906728015 1:48058147-48058169 AGGGAGAAACAGGCAGGAGAGGG + Intergenic
907009203 1:50947195-50947217 AGGGAAAAAGAGGATGGGGAGGG + Intronic
907053243 1:51343967-51343989 AGGGAGAGACAGGAGGAGCTGGG + Intronic
907489156 1:54798008-54798030 ATGGAGAGAGAGGAGGTGGGTGG - Intronic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907871040 1:58443115-58443137 AAGGAGGAACAGGAAGTGGCAGG - Intronic
908180719 1:61602510-61602532 AAAGAGAAACAGGCGGTGGGGGG + Intergenic
908220685 1:62002738-62002760 AGAGAGAAACTGGAGTTGGAAGG + Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908418886 1:63939958-63939980 AGGAAGAAACATGAGTGGGAAGG + Intronic
908438839 1:64133164-64133186 AAGGAGAACGAGGGGGTGGAGGG + Intronic
908611716 1:65868597-65868619 AGGCAGATTCAGCAGGTGGATGG + Intronic
908676995 1:66615759-66615781 AGGGAGGGACTGGAGATGGAAGG + Intronic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
908981771 1:69967415-69967437 GGGGAGAAACAGGTGGTGGGTGG - Intronic
909561834 1:77016181-77016203 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561842 1:77016205-77016227 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561850 1:77016229-77016251 GAGGAGATACAGGAGGAGGAGGG - Intronic
909561858 1:77016253-77016275 GAGGAGATACAGGAGGAGGAGGG - Intronic
909929069 1:81474025-81474047 AGGGAGAACAAGGAGATAGAAGG + Intronic
910032490 1:82745732-82745754 AGGGAGAGAAAGGAAGAGGAGGG - Intergenic
910087322 1:83419021-83419043 AGGGAGACACAGGATGAGAAAGG + Intergenic
910332969 1:86097444-86097466 AGGGAGGAAGAGGAGGGGGGAGG - Intronic
910760713 1:90728792-90728814 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
911470963 1:98317630-98317652 TGGGAAAAAGAGGGGGTGGAGGG - Intergenic
911601274 1:99850316-99850338 GGGGAGAAACAGAAGGGGAAGGG - Intronic
911912728 1:103655304-103655326 AGGGAGAAACAGAATATGGAAGG + Intronic
911915727 1:103696644-103696666 AGGGAGAAACAGAATACGGAAGG - Intronic
911920140 1:103749442-103749464 AGGGAGAAACAGAATATGGAAGG + Intronic
912065523 1:105736389-105736411 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
912155946 1:106920072-106920094 GTGGAAAAACAGGTGGTGGAAGG + Intergenic
912209971 1:107546597-107546619 AGGTAAACACAGAAGGTGGATGG - Intergenic
912499973 1:110115167-110115189 AGGGAGGAACAGGGGCAGGAGGG - Intergenic
912632055 1:111254613-111254635 AGGAAGGAAAAGGAGGTGAAGGG - Intergenic
912913154 1:113783697-113783719 AAAGAGAAAAAGGAAGTGGAGGG - Intronic
913041966 1:115035868-115035890 AGGCAGAAACGGCAGGTAGAAGG - Intergenic
913139110 1:115922817-115922839 AGGGAGAAAGGGGAGGAGGTGGG - Intergenic
913141378 1:115944644-115944666 AAGGAAAAACAGGAAGAGGAGGG + Intergenic
913305394 1:117425086-117425108 AGGGAAGAAAAGGAGGGGGAAGG + Intronic
913332361 1:117678096-117678118 AGGAAGAAAGAGGAGGAGGAAGG + Intergenic
913432378 1:118809311-118809333 AGGAAGTAGGAGGAGGTGGAGGG + Intergenic
913552316 1:119927610-119927632 AGGGGGAAGCAGGAGAAGGAAGG - Intronic
913565044 1:120065023-120065045 AGTGAGAGGCAGGGGGTGGATGG + Intronic
913633082 1:120728534-120728556 AGTGAGAGGCAGGGGGTGGATGG - Intergenic
914833312 1:151186919-151186941 AGGGAAAATAAGGAGATGGAGGG - Intronic
914932050 1:151943678-151943700 AGGGACAATGAGGAGGTTGATGG + Intergenic
914956322 1:152165886-152165908 AAACAGAAACAGGAAGTGGAGGG - Intergenic
915016493 1:152738753-152738775 AGAGAGCAGCAGGAGGTGGGAGG + Intronic
915080435 1:153348396-153348418 AGGGAGATATAGGAGTAGGAGGG + Intronic
915364356 1:155306015-155306037 AGGGATTAGCAGGAGGTGGGGGG + Intergenic
915463274 1:156082035-156082057 AGAGAGAGAGAGGTGGTGGAAGG + Intergenic
915541744 1:156571856-156571878 AGAGAGAGACTGGAGCTGGAAGG - Intronic
915662697 1:157417059-157417081 AGGGATAAAAAGGATGTGGAGGG - Intergenic
915732015 1:158060554-158060576 AGGGAGTTAAAGGAGGAGGAAGG - Intronic
916332159 1:163628692-163628714 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
916589073 1:166172907-166172929 AGGGAGAAACAGGAGAAGGAAGG - Intergenic
916666503 1:166972691-166972713 AAAGAGAAACAGGAGGAGAAGGG + Intronic
916743022 1:167662723-167662745 AGGAAGGAAGAGGAGGAGGAGGG + Intronic
916792226 1:168135511-168135533 GGGCAGAAAGAGGAGGTGGGAGG - Intronic
917469430 1:175314011-175314033 AGGGAAAAAAAAGAGGTGGGAGG - Intergenic
917836016 1:178942119-178942141 CGGGGGAAACAGGATGGGGAAGG - Intergenic
918002934 1:180514589-180514611 GGGGAGGAAGAGGAGGAGGAGGG + Intergenic
918109470 1:181442744-181442766 AGAAAGAGACAGGATGTGGAAGG - Intronic
918621907 1:186614909-186614931 AAAAAGAAACAGGAGGTGGAAGG + Intergenic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919412653 1:197265431-197265453 AGAGAGAAAGAGGAGGAGGGAGG - Intergenic
919434826 1:197544954-197544976 AGGGAGAAGGAGAAGGAGGAAGG + Intronic
919449341 1:197751886-197751908 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
919453772 1:197800460-197800482 AGGGAGGCACAGAAGGTGGTGGG + Intergenic
919467322 1:197938067-197938089 AGGGAGAAGCAGCAGGTGCGTGG - Intergenic
919595850 1:199561547-199561569 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
919870587 1:201817989-201818011 AGGCTGAGACAGGAGGAGGATGG + Intronic
919905084 1:202072862-202072884 AGGGAGATACAGGAGGTGCCTGG + Intergenic
920045436 1:203129348-203129370 CCAGAGAAACAGGAGGGGGATGG + Intronic
920068031 1:203282909-203282931 TGGGAGAAACAGAGGGTGGCAGG - Intergenic
920257588 1:204666011-204666033 AGGAAGAAGCAGGAGTTGGAAGG + Intronic
920351749 1:205342578-205342600 AGGGAGGAAGAGGAGACGGAGGG + Intronic
920517533 1:206597372-206597394 TAGGAAAAGCAGGAGGTGGAAGG + Intronic
920555127 1:206899039-206899061 ATGGAGAAGGAGGAGGTGCAGGG + Intronic
920646496 1:207807749-207807771 AGTGAGTAGCAGGAGGAGGAAGG + Intergenic
921009362 1:211125688-211125710 GGGAAGAAAAAGGAGATGGAAGG + Intronic
921353370 1:214261003-214261025 AAGGAGAAGGAGGAGGAGGAAGG - Intergenic
921743300 1:218710354-218710376 AGCAAGAAACTGGAGGTGAATGG + Intergenic
921892265 1:220365481-220365503 AGGGAGGAACGGGGGGTGGAGGG - Intergenic
922051462 1:221994454-221994476 AGGGACAAACTGGAAGTTGATGG + Intergenic
922721125 1:227900778-227900800 GTGGAGAGACAGGACGTGGAGGG - Intergenic
922902619 1:229148404-229148426 AGGGAGCAGCTGGAGGTGGGAGG - Intergenic
922929297 1:229376407-229376429 AGAGAGAAAGAGGAGGTGCCAGG + Intergenic
923019289 1:230150462-230150484 GGGCAGAAAGAGGAAGTGGAAGG - Intronic
923339831 1:232997827-232997849 AGTGAGAAGCAGGAGAGGGAAGG + Intronic
923475302 1:234326086-234326108 AGGAAGGAGCAGGAGGAGGATGG + Intergenic
923543862 1:234909689-234909711 AGGGAGAAAGAGGAGGCTGGAGG - Intergenic
923937868 1:238784351-238784373 AGAGGGAAACAGAAGTTGGAAGG + Intergenic
924062030 1:240185029-240185051 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062045 1:240185086-240185108 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062053 1:240185115-240185137 AGGGAGAAAGAGAAGGGGGAAGG - Intronic
924062068 1:240185172-240185194 AGGGAGAAAGAGAAGGGGAAAGG - Intronic
924159107 1:241211470-241211492 AGTGAGCAACACGAGGTGGTGGG + Intronic
924521236 1:244808057-244808079 AGTGAGGAACAGGAAGTAGATGG + Intergenic
924637311 1:245800249-245800271 AGGTAGAAACAGGAGGTGATGGG - Intronic
924683043 1:246257869-246257891 AGGCAGAAGCAGGAGAGGGAAGG - Intronic
1062936557 10:1394899-1394921 AGGAAGAAGAAGGAGGAGGAGGG - Intronic
1062962172 10:1580743-1580765 AGGGAGGAACAGAAGGAGCATGG - Intronic
1063062823 10:2575930-2575952 AGAGAGAGTCAGGAGGAGGAAGG + Intergenic
1063114432 10:3063972-3063994 AGGCAGAAACAGCAGGGGAAGGG + Intergenic
1063159454 10:3408756-3408778 AGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1063159507 10:3408952-3408974 AGGAAGAAAGAGGAGGAGGAGGG + Intergenic
1063179412 10:3584330-3584352 AGGGACAGGCAGGAGGTGGCAGG - Intergenic
1063614693 10:7591586-7591608 AGGAAAAAACAGCAGGTGCAAGG - Intronic
1063616399 10:7604047-7604069 AGGGAGAACCTGGAGGTGCCTGG - Intronic
1063790970 10:9447478-9447500 AGGAAGAGAGAGGAGGAGGAAGG - Intergenic
1063790982 10:9447528-9447550 AGGGAGAGAGAGGAAGGGGAAGG - Intergenic
1063876449 10:10484118-10484140 AGGGAGAGAGAGGAGGGGGGAGG - Intergenic
1064245089 10:13661765-13661787 AGGCAGACATGGGAGGTGGAGGG + Intronic
1064357683 10:14634645-14634667 AGGCAGAAACTGGAGCAGGAAGG + Intronic
1064362770 10:14680724-14680746 AGGGAGTAAAAAAAGGTGGAAGG + Intronic
1064977980 10:21137979-21138001 AGGAAGGAACTGGAAGTGGATGG + Intronic
1065188249 10:23189613-23189635 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1065557268 10:26929356-26929378 AGTGAGATACTGGAGGTGGGGGG - Intergenic
1065669685 10:28102839-28102861 AGGGAGAAACAGCAGAAGCAGGG - Intronic
1065694836 10:28370217-28370239 AGGGAGAAAGAGAGGATGGAAGG + Intergenic
1065701564 10:28430869-28430891 GGGGAGAACCAGGAGTGGGATGG - Intergenic
1065917051 10:30361449-30361471 AGAAAGAAACAGGTGGGGGAGGG - Intronic
1066108489 10:32176431-32176453 AGGGAGAAACTGGAGCTGGGTGG + Intergenic
1066214399 10:33272497-33272519 GAGGAGAAAGAGGAGGAGGAGGG + Intronic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067324659 10:45255981-45256003 TGGCAGACACAGGAGGAGGATGG + Intergenic
1067530901 10:47072041-47072063 AGGGAGAAAGGGGAAGTTGAGGG - Intergenic
1067556612 10:47277601-47277623 AGGGAGAGGCAGGAGGTGGCAGG - Intergenic
1067729616 10:48800627-48800649 AGGGAGGAACAGGAAGTTGTGGG + Intronic
1068122809 10:52801191-52801213 AGGGAGGATCAGGTGGTGGATGG + Intergenic
1068203904 10:53822460-53822482 GAGGAGAAATAGGAGGAGGAGGG + Exonic
1068396800 10:56472570-56472592 AGGCAGAAACTGGAGGGAGATGG + Intergenic
1070223512 10:74475806-74475828 AGAGAGAAAAAGGAGGGAGAGGG + Intronic
1070314507 10:75296992-75297014 AGAGAGAAACTGGGGGTAGATGG - Intergenic
1070408293 10:76115841-76115863 AGGGAGAAAATGGAGGGGGCAGG + Intronic
1070464951 10:76711945-76711967 AGGGAGGATCAGGTGGTGGGTGG - Intergenic
1070813423 10:79309663-79309685 TAGGAGAAACAGGAAGAGGAAGG + Intronic
1070869384 10:79736793-79736815 AGTGAGAAACATGAGGTGCTTGG + Intergenic
1071020166 10:81044623-81044645 AGGGACTACCAGAAGGTGGAGGG - Intergenic
1071195819 10:83158004-83158026 GTGGAGGAACAGGAGGTGAATGG + Intergenic
1071636303 10:87258999-87259021 AGTGAGAAACATGAGGTGCTTGG + Intergenic
1071658938 10:87478952-87478974 AGTGAGAAACATGAGGTGCTTGG - Intergenic
1071695032 10:87862334-87862356 AGGGTTCAAAAGGAGGTGGAAGG - Exonic
1071971901 10:90916067-90916089 GGGGAGAAGGAGGAGGGGGAGGG + Intronic
1072085638 10:92076794-92076816 AAGGAGAAAGAGGAGGAGGAGGG + Intronic
1072101243 10:92231479-92231501 AGGGAAAAGGAGGAGGTGGGAGG - Intronic
1072857119 10:98959879-98959901 AAGGAGAAAGAAGAGGAGGAGGG - Intronic
1072918144 10:99553062-99553084 AGGGAGAAATAGGAGTGGGAAGG - Intergenic
1073439448 10:103544027-103544049 CGGGAGCCACAGGAGGTAGAGGG + Intronic
1073597710 10:104817381-104817403 AGGGGGAAGGAGGAGGAGGAGGG - Intronic
1073597763 10:104817532-104817554 AGGGGGAAAGAAGAGGAGGAGGG - Intronic
1073597804 10:104817635-104817657 GGAGAGAAGGAGGAGGTGGAGGG - Intronic
1073690613 10:105804777-105804799 AAGGAGAAAATGGGGGTGGATGG - Intergenic
1074453032 10:113574872-113574894 AGGGAGAAAGAAAAAGTGGAAGG - Intronic
1074773772 10:116751071-116751093 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1074827712 10:117226734-117226756 GAGGAGAGACAAGAGGTGGATGG + Intergenic
1074945862 10:118280010-118280032 AAGGAGAATAAGGAGGTGGAAGG - Intergenic
1075073549 10:119335190-119335212 AGAAAGAAAGAGGAGGTGGGGGG - Intronic
1075118719 10:119648861-119648883 GGGGAGTGACAGGAGGTGGCTGG + Intergenic
1075316415 10:121457275-121457297 AGAGAGAATCAGGAGGTGCCAGG + Intergenic
1075398731 10:122146245-122146267 GGGGAGAAACAGCATGTGCATGG + Intronic
1075410326 10:122223026-122223048 AGAGAGAGAGAGGAGGAGGAAGG - Intronic
1075859526 10:125662495-125662517 AGGGAAAAAGAGGGGGTAGAAGG + Intronic
1075999337 10:126903285-126903307 GGCCAGAAACAGGAGGAGGATGG + Intergenic
1076488104 10:130837138-130837160 AGGGAGAAACAGAAGCTCCATGG - Intergenic
1076714155 10:132354795-132354817 TGGGAGAAACAAGAGGAGGCCGG + Intronic
1076732848 10:132446971-132446993 TGGGAGAAGCGGGAGGAGGAGGG + Intronic
1076782116 10:132730200-132730222 AGGGAAGACCAGGAGGTGGTGGG - Intronic
1077015127 11:395958-395980 AGGGACAGGCAGGAGGAGGATGG - Intronic
1077327827 11:1971329-1971351 AGGCAGTGTCAGGAGGTGGATGG - Intronic
1077502492 11:2915775-2915797 AGGGAGAGACAGGAGGAAGTTGG - Intronic
1077838732 11:5948825-5948847 AGGGAGAGAGAGGAGGTGAGGGG - Intergenic
1078130177 11:8607706-8607728 AGGGAAAAAAGGGAGATGGAGGG - Intergenic
1078409808 11:11105134-11105156 AGGGAGGAACAGTGGGTGAAGGG + Intergenic
1078542674 11:12224322-12224344 AGGGAGAAACAGGGGGCTGTGGG - Intronic
1078591659 11:12646345-12646367 AGAGCCTAACAGGAGGTGGATGG + Intergenic
1079400757 11:20104587-20104609 AGGGGGAAAGAGGAGGACGATGG - Intronic
1079445555 11:20553592-20553614 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1080266476 11:30407065-30407087 AGGGAGAAACGGAAGCTGGGAGG - Intronic
1080478368 11:32619863-32619885 AAGGAGAAGGAGGAGGGGGAGGG + Intronic
1080582687 11:33656950-33656972 ATAGAGAAACAGGGGCTGGAGGG - Intronic
1080665571 11:34332873-34332895 AGGGAGTCACAGGACATGGAAGG + Intronic
1080979959 11:37390313-37390335 AGTGAGAAAAGGGAGGAGGAGGG + Intergenic
1081521915 11:43889996-43890018 CAGGAGAAACAGCAGGTGGAAGG + Intronic
1081540547 11:44031574-44031596 AGGGAGCAGGAGGAGGTGGGAGG + Intergenic
1081733737 11:45389365-45389387 GGGTGTAAACAGGAGGTGGAGGG + Intergenic
1081753586 11:45529264-45529286 AGGGAGAGAAGGGAAGTGGAAGG + Intergenic
1083187555 11:61026477-61026499 AGGGAGACAAAGGAGGGGGGCGG + Intergenic
1083334105 11:61912892-61912914 TGGGAGGAACAGGGGCTGGATGG + Intronic
1083431112 11:62613890-62613912 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1084006491 11:66326190-66326212 AGGGAGACACCGGTGGTGGAGGG - Intergenic
1084359874 11:68662218-68662240 CGTAAGAAACAGAAGGTGGAGGG + Intergenic
1084445135 11:69199242-69199264 ATGGAGAGATAGGAGATGGATGG - Intergenic
1084571659 11:69963411-69963433 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
1084644203 11:70445198-70445220 AGGGGGGCACAGGAGGAGGAAGG + Intergenic
1084644421 11:70446556-70446578 AGGGAGAAAAAAGAGGAAGAAGG - Intergenic
1084887502 11:72220799-72220821 GGGGAGAGACACGAGGTGGCAGG + Intronic
1085031514 11:73273758-73273780 ATGGAAAAACAGGTGGTGGATGG - Intronic
1085917179 11:80903604-80903626 GGGGAGGAACAGGAGGTGGGTGG - Intergenic
1086404380 11:86487522-86487544 AGGAAGAACCAGAAGGTGGGAGG + Intronic
1087070735 11:94077784-94077806 AGAGAGGAACAGAATGTGGATGG - Intronic
1087139577 11:94752270-94752292 AGGGAGCAAGAGGAGGTGAGTGG - Intronic
1087535016 11:99431907-99431929 AAGCAGAAACAGGGGCTGGAGGG + Intronic
1088031923 11:105261983-105262005 AGGGAGGAAGAGACGGTGGAAGG + Intergenic
1088158489 11:106839351-106839373 AGGGAACAACAGGTGCTGGAGGG + Intronic
1088190068 11:107218717-107218739 GGTGAGCAACAGGAGGTGCAGGG - Intergenic
1088325372 11:108595391-108595413 AGGAAGAAATAGGGGGTGGTGGG + Intergenic
1088842529 11:113638929-113638951 GGAGAGAAACTGGAGGTGGAAGG + Intergenic
1088970059 11:114766022-114766044 AGGGAGAAACATGAAGTGTTTGG - Intergenic
1089100090 11:115955714-115955736 AGGGAGAAGGAGGAGGGGAAGGG - Intergenic
1089175362 11:116545122-116545144 AGTTAGGACCAGGAGGTGGAGGG + Intergenic
1089182108 11:116590276-116590298 AGGCAGAAAGAGGTGGTGAAAGG - Intergenic
1089458710 11:118640607-118640629 AGCTAGAAACAGGTGGGGGAAGG - Intronic
1089681601 11:120121846-120121868 AGGGAGAGACAGGAGGGACAGGG + Intronic
1089837294 11:121382287-121382309 AGGGAGTAAGAGGTGGAGGAGGG + Intergenic
1090444039 11:126748246-126748268 AGGGAGTAAAAGGAAGTGGCTGG - Intronic
1090502971 11:127279729-127279751 AAGGAGAAGAAGGAGGAGGAGGG - Intergenic
1090825588 11:130383235-130383257 AGAAAGCAACAGGAGGTGGGTGG + Intergenic
1090833845 11:130439398-130439420 AGGGAGAAAAAGGAGAGGGAGGG + Intergenic
1090834364 11:130443351-130443373 AAGGAGAAAAACGGGGTGGAGGG - Intergenic
1090933881 11:131324478-131324500 AAGGAGAGACATGAAGTGGAAGG - Intergenic
1202810807 11_KI270721v1_random:26509-26531 AGGCAGTGTCAGGAGGTGGATGG - Intergenic
1091790925 12:3271752-3271774 AGGGAGAGGCAGGAGGGGCAGGG - Intronic
1091820893 12:3474457-3474479 AGGAAGAGACAGGTGGGGGATGG - Intronic
1091884179 12:4003906-4003928 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1092042345 12:5395771-5395793 AGGAAGAAACATGAGGAAGAAGG - Intergenic
1092100990 12:5883614-5883636 ATGGAGAAGCAGGGTGTGGAGGG + Intronic
1092238051 12:6821989-6822011 GGGCAGAAACAGCAGGTGGCTGG - Intronic
1092555944 12:9561616-9561638 AGGGAAAAAAAGGAGGGGAAAGG - Intergenic
1092749368 12:11704289-11704311 AAGGAGAAGAAGGAAGTGGAGGG + Intronic
1092910939 12:13144480-13144502 AGGGAGGAGGAGGAGGAGGAAGG + Intergenic
1093118978 12:15244937-15244959 AGGGAGGAAAAGGGGGTAGAGGG + Intronic
1093396214 12:18685804-18685826 AGAGAGATACAGGAGGAGGATGG - Intronic
1093887435 12:24478693-24478715 AGAGTGCAACAGGATGTGGAAGG - Intergenic
1094268838 12:28588937-28588959 AGGGAGAGCCAGGAGGTGGGTGG + Intergenic
1094583230 12:31753825-31753847 AGAGAGAAAAAGGAGGTGGAAGG + Intergenic
1094628262 12:32146926-32146948 AGGAAGAAGAAGGAGGAGGAAGG - Intronic
1095396347 12:41766475-41766497 AGGAAGACACAGGAAGGGGAAGG - Intergenic
1095412070 12:41935116-41935138 AGAGAGAGAGAGGAGGCGGAAGG - Intergenic
1095922903 12:47548644-47548666 AGGGAGAAACAGCTGGTTTATGG + Intergenic
1096267448 12:50135092-50135114 AGGGAGAGAGAGGAGAGGGAGGG + Intronic
1096267455 12:50135115-50135137 AGGGAGAGAGAGGAGAGGGAGGG + Intronic
1096793914 12:54062067-54062089 AGGGAGAAAGAGGAGGGTGTTGG - Intergenic
1096849449 12:54426398-54426420 GGGGAGAAAAAGGAGGGAGAAGG + Intergenic
1096956880 12:55534965-55534987 AGAGAGAAACTGGTGGTGGGCGG - Intergenic
1097264841 12:57738792-57738814 ATGGAGATACAGGAGGCGGCGGG + Intronic
1097677108 12:62614781-62614803 AGGGAAGAAAAGGAGGAGGAAGG - Intergenic
1097958094 12:65506685-65506707 AGGGAGAACTAGGAGGAAGATGG + Intergenic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1098106035 12:67069517-67069539 AGGAAGAAGGAGGAGGAGGAGGG - Intergenic
1098135519 12:67397672-67397694 AGGCAGAAAAAGTGGGTGGAGGG + Intergenic
1099064943 12:77964020-77964042 AAGGAGAAAAAGGAGGAGGAGGG - Intronic
1099305415 12:80948586-80948608 AAGGAGAAACAAGAGGTAGAAGG + Intronic
1099541983 12:83922789-83922811 AGGGAGAAACAGGAATAGTAAGG - Intergenic
1099616725 12:84944673-84944695 AGGGAAAAACAGGAAGTGAGAGG + Intergenic
1100079637 12:90832546-90832568 AGGGAGAGACAAAAGGTGGCAGG + Intergenic
1100588879 12:96005591-96005613 AGGTAGAAATTGAAGGTGGAGGG - Intronic
1100665723 12:96750395-96750417 AGGGAGGAACAGAAGGGAGATGG - Intronic
1100677657 12:96885852-96885874 GGGGAGAAGGAGGAGGAGGAAGG - Intergenic
1101627045 12:106454826-106454848 ATATAGAAACAGGAGGTGGTTGG + Intronic
1101721920 12:107357971-107357993 AGGGAAAGAAAGGAGGAGGAAGG - Intronic
1102394519 12:112575030-112575052 AGGGAGGAAGAGGAGGGAGAGGG + Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102503151 12:113366786-113366808 AGGGAGGGAGAGGAGGAGGAGGG - Intronic
1102598747 12:114012894-114012916 AGGGAGAAGGAGGAGGGAGAGGG + Intergenic
1102764792 12:115423205-115423227 AGGGAGGAAAAAGAGGAGGAGGG + Intergenic
1102887670 12:116534065-116534087 GGGGAGAAGGAGGAGGAGGAGGG - Intergenic
1103205778 12:119127764-119127786 AGGGAGAAGGAGAAGGTAGAAGG + Intronic
1103235377 12:119368177-119368199 GAGGAGAAAAAGGAGGGGGAAGG + Intronic
1103290615 12:119843197-119843219 AGAGAGAAACAGTAAGTGGCTGG + Intronic
1103358785 12:120341838-120341860 AGGGACACACAGAAGGGGGATGG + Exonic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104497188 12:129251898-129251920 AGGCAGAAACACAAGGTGGAAGG + Intronic
1104661292 12:130613015-130613037 AGGGAGAAACAGCTGGTGAATGG - Intronic
1105446980 13:20465963-20465985 AGGGAGAAAAGGGAGGTGATGGG - Intronic
1106167345 13:27260075-27260097 AGGCAGTAACAGGAAGTGAAAGG - Intergenic
1106241646 13:27918027-27918049 GGGGAGGAAAAGGAGGGGGAGGG + Intergenic
1106353816 13:28959642-28959664 AGGGAGAAAGAGGAGGTGCCAGG + Intronic
1108192751 13:47959415-47959437 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1108213128 13:48158319-48158341 AGGGAGGATCAGAAGGTAGAGGG - Intergenic
1108469762 13:50756242-50756264 GGAGAGAAACAGGTGGTGGGCGG + Intronic
1108470832 13:50765431-50765453 AAGGAGAAAGAAGAGGAGGAAGG + Intronic
1108698983 13:52927598-52927620 AGGGAGAAGAAGGAGAAGGAGGG + Intergenic
1109115073 13:58371715-58371737 AGTGAGAAGCTGGAGGTGGCTGG + Intergenic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1110469446 13:75842287-75842309 AGGAAGAAACAGGAGGCCAATGG - Intronic
1110529289 13:76577746-76577768 AGAGAGAAGGAGGAGGTGCAAGG - Intergenic
1110778183 13:79433744-79433766 AAGGAGACAGAGGAGGAGGAAGG + Intergenic
1110799435 13:79678004-79678026 AGGGAGAAAGGAGAGGTAGAAGG + Intergenic
1111795229 13:92910714-92910736 AGGGAGAAAGGGGAGGCAGAGGG + Intergenic
1112049890 13:95634988-95635010 AAGGAAAAAAAAGAGGTGGAGGG - Intronic
1112323282 13:98426527-98426549 AGGGAGAGACAAGAGGAGGATGG + Intronic
1112347330 13:98601229-98601251 TGGGAGGAACAGGAGTTGGAGGG - Intergenic
1112539497 13:100294128-100294150 AGGAAGACACAGGGAGTGGATGG - Intronic
1113142908 13:107174754-107174776 AGGGAGAAGCAGGATGTGGCTGG + Intronic
1113159617 13:107365027-107365049 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
1113241273 13:108340322-108340344 AAGCAAAAGCAGGAGGTGGAAGG + Intergenic
1113534934 13:111058606-111058628 AGGGAGGATCAGGTGGTGGGTGG + Intergenic
1113600281 13:111563465-111563487 AGAGGGAAACAGGAGGTGAGGGG - Intergenic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1113778406 13:112961924-112961946 AGGCAGAAACTGGAGGAGGTGGG - Intronic
1114083583 14:19220853-19220875 TGGCAGATACAGGAGGAGGATGG + Intergenic
1114217931 14:20671284-20671306 AGGAAAAATCAGGAGGGGGATGG - Intergenic
1114346441 14:21800299-21800321 AAAGAGAAAGAGGAGGAGGAGGG + Intergenic
1115467492 14:33731574-33731596 AGGCAGAAAGAGGAGGTGTCTGG - Intronic
1116674367 14:47886815-47886837 AGGGAGACAAAGGAAGAGGAAGG + Intergenic
1116810280 14:49533507-49533529 AGGAAGAGGTAGGAGGTGGAGGG - Intergenic
1117182260 14:53202791-53202813 AGGGAGGATCAGGAGGTGGGTGG - Intergenic
1117224079 14:53637246-53637268 AGTGTGAAACAGGAGGGTGAGGG + Intergenic
1117372761 14:55093967-55093989 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1117555241 14:56877035-56877057 TGGGAGATGCAGGGGGTGGAAGG + Intergenic
1117982512 14:61356129-61356151 AGGGTGAAAGAGGAAGTGGAGGG + Intronic
1118171696 14:63395443-63395465 AGAGAGAAGGAGGAGGAGGAGGG + Intronic
1118459564 14:65976066-65976088 AGGGGGAAGGAGGAGGAGGAGGG + Intronic
1119140836 14:72265839-72265861 AGGAAGAAACCGGAGGCTGAGGG - Intronic
1119662095 14:76459410-76459432 CTGGAGAAACAGAGGGTGGAGGG + Intronic
1119662732 14:76463171-76463193 AGGGAGAGAAAGGAGAGGGAAGG - Intronic
1119757574 14:77129749-77129771 TGGGAGAAACTGGAGGTTGAGGG - Intronic
1119781395 14:77278684-77278706 TGGGAGACAGAGCAGGTGGAGGG - Intronic
1119922230 14:78457045-78457067 GAGGAGAAAGAGGAGGTGGCGGG - Intronic
1119970455 14:78964454-78964476 AAAGAGAAACAGGAGGTGTTAGG + Intronic
1119996831 14:79262438-79262460 GAGGAGAAAGAGGAGGAGGAAGG + Intronic
1120016053 14:79474823-79474845 AGAGGGAAAGAGGAGGAGGAAGG + Intronic
1120186205 14:81396094-81396116 GGGGAGAACCATGTGGTGGATGG - Exonic
1120355138 14:83423441-83423463 AGAGAGAAAAAGGATGTGGATGG - Intergenic
1120654865 14:87177474-87177496 AGAGAGAGAGAGGAGGTGGGAGG - Intergenic
1120778629 14:88464990-88465012 AGCCAGAAACAGGAGGAGGAGGG - Intronic
1121447450 14:93987972-93987994 AGGGAGAAACAGTAGGGAGGTGG + Intergenic
1121562722 14:94886886-94886908 AGGGAAAGCCAGGAGGTGGGTGG - Intergenic
1121832763 14:97066124-97066146 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1121892209 14:97604836-97604858 ACTGAGAAACAGGAGGTAGCAGG + Intergenic
1122011671 14:98754345-98754367 AAGTAGAAACAGAGGGTGGAAGG + Intergenic
1122088331 14:99322184-99322206 AGACAGAAACAGGAGGTGATAGG - Intergenic
1122322264 14:100862170-100862192 AGGGAGAAAGAGGAGGAGGAGGG - Intergenic
1122375792 14:101256218-101256240 AGTGAGAAGCAGGAGCTCGATGG - Intergenic
1122794015 14:104196742-104196764 AGGCAGAAATGGGGGGTGGATGG - Intergenic
1202895194 14_GL000194v1_random:2622-2644 TGGCAGATACAGGAGGAGGATGG + Intergenic
1123770031 15:23519770-23519792 AGGGAGACAGTGGAGGTGCAAGG + Intergenic
1123773031 15:23548288-23548310 AGGGACAAGCAGGAGGCAGAGGG - Intergenic
1124796622 15:32787428-32787450 TGGGAGGCACAGGAGGTGGTCGG - Intronic
1124910585 15:33916139-33916161 AGGGAGGATCAGGTGGTGGGTGG - Intronic
1125104062 15:35950050-35950072 TGGGAAAAAAAGGAGGTGGATGG + Intergenic
1125548387 15:40525703-40525725 AGGGAGAAACAAGGGGTGTCAGG - Intergenic
1125751359 15:42031523-42031545 TGGGAGAAAGAGGAGGATGAAGG - Intronic
1126356903 15:47805688-47805710 AGGGAGACAGAGGAGATGGCAGG + Intergenic
1126406211 15:48325311-48325333 AGGGGAAAAGAGTAGGTGGAGGG - Intergenic
1126584024 15:50265653-50265675 ATGGACACGCAGGAGGTGGAAGG + Exonic
1127194499 15:56569007-56569029 AGAGAGGAACAGGTGGTGGATGG - Intergenic
1127757339 15:62105346-62105368 AGGGAGAAGGAGCAGGTGGCAGG + Intergenic
1127821234 15:62658123-62658145 AAGGAAAAAAAGGGGGTGGAGGG - Intronic
1127961651 15:63894964-63894986 AGGGAGAGAGGGGAGGTGGGGGG - Intergenic
1128063547 15:64750137-64750159 AGGGAGGACCAGGAGCTGGCTGG + Intronic
1128177671 15:65570525-65570547 CTGAAGAAACAGGAGGTTGAAGG + Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128656197 15:69463701-69463723 AAAGAGAAAGAGGAGGAGGAGGG - Intergenic
1128716809 15:69914521-69914543 AGAGAGAGACAGAAGGAGGAGGG - Intergenic
1129853758 15:78810552-78810574 AGGGAGAGGCAGGAAGTGCAAGG + Intronic
1130424965 15:83787820-83787842 AAGGAGAAAGAGGAGGGGGAGGG - Intronic
1130738551 15:86574342-86574364 AGCCAGAAACTTGAGGTGGAAGG + Intronic
1131364547 15:91827344-91827366 AGGAACAAACAGGACGTGGCAGG - Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131514479 15:93067930-93067952 AGGCAGGACCAGGAGGAGGAAGG + Intronic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1131901108 15:97088671-97088693 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1131901118 15:97088709-97088731 AAGGAGGAAGAGGAGGAGGAAGG - Intergenic
1132283390 15:100640594-100640616 GGGTAGAAATTGGAGGTGGAGGG - Intronic
1132299599 15:100767794-100767816 AGAGAGAAAGAGGAGGTGGGAGG - Intergenic
1132389039 15:101425331-101425353 AGGGAGAACCAGGAGGAAGCGGG - Intronic
1132412831 15:101597556-101597578 AGGGAGGATCAGGAGGTGGGTGG + Intergenic
1132420235 15:101659582-101659604 AGAGGGAGACAGGAGGTGGTTGG - Intronic
1132996963 16:2828521-2828543 AGGCAGAAACAGGAGGTGGTTGG + Intergenic
1133255777 16:4514763-4514785 AGGGAGAAGCCGGATGTGGAAGG - Exonic
1133656753 16:7872217-7872239 AGGGAGAAAGAAGAGAGGGAGGG - Intergenic
1134091848 16:11395765-11395787 AGGGAGACAGAGGAGGTGGATGG + Intronic
1134113495 16:11530996-11531018 TGGGAGGAAGAGGAGGTGGGAGG - Intergenic
1134171917 16:11976109-11976131 AAGGAGATTGAGGAGGTGGAGGG - Intronic
1134398659 16:13889072-13889094 AAGGAGAAAGGGGAGGGGGAGGG - Intergenic
1134649599 16:15898200-15898222 AGGGAGAAGAAAGAGGAGGAGGG - Intergenic
1134692059 16:16197594-16197616 AGAGAGGAAGAGGAGGAGGAGGG + Intronic
1134907521 16:17993383-17993405 AGAGAGAACCAGGTGGTGAATGG - Intergenic
1135163704 16:20120176-20120198 AGAGAGAAAGAGGTGGAGGAGGG - Intergenic
1135694710 16:24575799-24575821 AGGGAGAGGGAGGAGGGGGAGGG + Intergenic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1135988180 16:27199831-27199853 TGGGAATGACAGGAGGTGGAGGG + Intergenic
1136143037 16:28299360-28299382 ATGGAAAAACTGGAGGTGTATGG + Intronic
1136345409 16:29672284-29672306 AGGGAGCAACAGGAATTTGATGG - Intronic
1136360959 16:29779478-29779500 AGGGGCAAGCAGGAGTTGGAGGG - Intronic
1136654711 16:31702958-31702980 AGGGAGGCACAGGATGTGAAAGG + Intergenic
1137534252 16:49305705-49305727 GGGGAGAAACAGGGAGAGGAAGG - Intergenic
1137840629 16:51637480-51637502 AGGGAGAAGAAGGAGGGGGGAGG + Intergenic
1137968358 16:52959108-52959130 AAGAAGAAAAAGGAGGAGGAGGG - Intergenic
1138059453 16:53874800-53874822 AGGAAGAAAGAGGTGCTGGATGG - Intronic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138301916 16:55937578-55937600 AGTGACAAACAGGTGGCGGATGG + Intronic
1138358564 16:56406059-56406081 GGGGAGAGAGAGGAGGGGGAGGG + Intronic
1138438041 16:57017207-57017229 AGGGGAAAAGAGGAGGTGAAGGG - Intronic
1138492753 16:57385929-57385951 CAGGAGATCCAGGAGGTGGAGGG - Intergenic
1138711098 16:58971376-58971398 AGGGGGAAATAAGAGGTGGGAGG - Intergenic
1139016579 16:62696675-62696697 AGGGAGAGAAAGGAGGTCAATGG + Intergenic
1139055099 16:63173843-63173865 AGTGAGAAGCAGGAGGAGGGAGG - Intergenic
1139189951 16:64850862-64850884 AGGGGGAAATAGGAAGAGGATGG + Intergenic
1139270385 16:65676976-65676998 AGGGAAGAACAGAAGTTGGAAGG + Intergenic
1139660789 16:68419390-68419412 CGGGAGAAACAGGTGATGGCTGG + Intronic
1139946289 16:70644755-70644777 AGGGAGGAAAAGGAGGAGGGAGG + Intronic
1139946297 16:70644778-70644800 AGGGAGGAAAAGGAGGAGGGAGG + Intronic
1139946330 16:70644909-70644931 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
1139946339 16:70644944-70644966 AAGGAGGAAGAGGAGGAGGAAGG + Intronic
1140088281 16:71815807-71815829 AGAGAGAAACAAAAGGAGGAGGG + Intergenic
1140145172 16:72300067-72300089 AGGTAGAAAGAGAAGGGGGATGG - Intergenic
1140267481 16:73433256-73433278 TGGGAGAACAAGGGGGTGGAGGG - Intergenic
1140474813 16:75234573-75234595 GGGGAGCAGCAGGAGGTGGTGGG - Intronic
1140561179 16:75983653-75983675 AGGGTGAAATAAGAAGTGGAGGG - Intergenic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140951454 16:79822386-79822408 AGGGAGAATGATGGGGTGGAGGG + Intergenic
1140965727 16:79964259-79964281 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1141056851 16:80824811-80824833 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1141263070 16:82471327-82471349 AAGGAGAAACAGAAGGGGAAGGG - Intergenic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141635119 16:85310516-85310538 GGGGAGAAGGAGGAGGTGGGAGG - Intergenic
1141660430 16:85438358-85438380 GGGGAGGGACAGGAGGCGGAGGG + Intergenic
1141775724 16:86121618-86121640 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1141775773 16:86121797-86121819 AGGGACAAGCAGGAGGAGGAAGG - Intergenic
1141845112 16:86603358-86603380 AGGGGGAAGGAGGAGGAGGAAGG - Intergenic
1141845116 16:86603371-86603393 AGGAAGAAGGAGGAGGGGGAAGG - Intergenic
1141852855 16:86659169-86659191 AGTGAGAAACTGGAGCTCGAGGG + Intergenic
1142066503 16:88065918-88065940 AGGGACAGGAAGGAGGTGGAAGG - Intronic
1142259031 16:89033792-89033814 AGGGGGACTCAGGAGGTAGAAGG + Intergenic
1142958160 17:3535190-3535212 AGGGAGAAGGAGGAGGGAGAGGG - Intronic
1143150157 17:4802555-4802577 ATGGAGAAGCAGGAGGTGGTTGG + Intergenic
1143178279 17:4968784-4968806 AAGCAGAACCAGGAGCTGGAAGG - Exonic
1143391506 17:6561578-6561600 AGGGAGAAGGAGGAAGAGGAGGG - Intergenic
1143403561 17:6661075-6661097 AGGGAGAGGCAGGAGTGGGATGG + Intergenic
1143794718 17:9327364-9327386 AGGGAGAAGGAGGAGAAGGAGGG + Intronic
1143887534 17:10076198-10076220 AGGGAGAAGTGGGAGGGGGAGGG + Intronic
1143965797 17:10755837-10755859 AGGGAGAGAGAGGAGGAGGAAGG - Intergenic
1144166030 17:12611455-12611477 AAGGAGAAACTGGACTTGGATGG + Intergenic
1144495134 17:15741159-15741181 TGGCAGACACAGGAGGAGGATGG - Exonic
1144646149 17:16974929-16974951 AAGGAGAAAGAGGAGAAGGAAGG + Intergenic
1144858129 17:18282029-18282051 ACGGGGAAAGACGAGGTGGAGGG - Intronic
1145145584 17:20476890-20476912 AGGGAGAAACAGGAAGCCGCAGG + Intergenic
1145271719 17:21408388-21408410 AGGGCCCCACAGGAGGTGGAAGG - Intronic
1145970891 17:28955853-28955875 TGGTATATACAGGAGGTGGAGGG + Exonic
1146096092 17:29931271-29931293 AGTGACAAACAGGAGGGGGTGGG - Intronic
1146230982 17:31108866-31108888 AGAGAGTAACACGTGGTGGAGGG + Intronic
1146315356 17:31802678-31802700 AGGGAGAAACAGGCTGTGGCTGG - Intergenic
1146846920 17:36187965-36187987 AGAGAGAAGCAGGACTTGGAGGG - Intronic
1146953161 17:36920616-36920638 AGGGAGGAACTGGAGAAGGAAGG - Intergenic
1147034553 17:37670579-37670601 CGGGAGAAGCAGGAGGAGGGAGG + Intergenic
1147321100 17:39646689-39646711 CAGGACAAACAGGAGGTGGCTGG - Intronic
1147363470 17:39945485-39945507 AGGAAGAAGCTGGTGGTGGACGG - Intergenic
1147403452 17:40194492-40194514 AGGGAGTAGCAGCAGGTGGGAGG + Exonic
1147498792 17:40942407-40942429 AAGAAGAAAGAGGAGGAGGAGGG - Intergenic
1147498849 17:40942749-40942771 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1147575185 17:41594866-41594888 AGGGATGAACAGGAGGTGGGTGG + Intergenic
1147987648 17:44315560-44315582 CGCGAGAAACGGGAGCTGGAAGG + Exonic
1147995622 17:44358839-44358861 AGGGGGAGACATCAGGTGGAGGG - Intronic
1148050827 17:44769291-44769313 AGGGACAAACAGGAAATGGGAGG - Intronic
1148352392 17:46950382-46950404 AGGGAAAAGAAGGAGATGGAGGG + Intronic
1148680198 17:49469479-49469501 AGGGAGTCAAAGAAGGTGGAGGG - Intronic
1148758967 17:49989594-49989616 AGGGACAGACAGGAGGGTGAGGG + Intergenic
1148783890 17:50135859-50135881 AGGGAGGCACAGAAGTTGGAGGG - Intronic
1148784775 17:50140713-50140735 GGAGAGAAACAGGATGTGGGTGG - Intronic
1148804295 17:50256555-50256577 AAGAAGAAAAAGGAGGAGGAGGG + Intergenic
1149310251 17:55386322-55386344 AGGGAGGAAGAGGCGGGGGAAGG - Intergenic
1149524727 17:57346008-57346030 ACGGAGAAAGAGAAGGTGAAAGG + Intronic
1149754015 17:59172818-59172840 AGGGAGACTCAGGTGGTGCAGGG - Intronic
1149992589 17:61391210-61391232 AGGGAGGCAGAGGAGGAGGAGGG + Intronic
1150395537 17:64819001-64819023 ATGGAGAAACTGGAGGGGCAAGG - Intergenic
1150432765 17:65131661-65131683 GGGAGGAAACAGGAGATGGAGGG + Intergenic
1150481836 17:65516863-65516885 AGGGAGAAAATGGGGGAGGAGGG + Intergenic
1150653828 17:67026890-67026912 AGAGAGAGAAAGGAGGTGGGGGG - Intronic
1150808943 17:68341387-68341409 AGGGAGAAACAGTATGTGGAGGG - Intronic
1150994202 17:70297516-70297538 AGGGAGTAAAAGGAGGGGAAAGG + Intergenic
1151569537 17:74919406-74919428 ATGGAGGAGCAGGAGTTGGAAGG - Intronic
1152135006 17:78498623-78498645 AGGGAGGAAGAGGAGGAGGGAGG - Intronic
1152136169 17:78505051-78505073 AGGGAGAAAGGGGAGGGGAAAGG - Intronic
1152784362 17:82240309-82240331 AGGGAGAAAGACGAGGAGGCAGG + Intronic
1152948456 17:83211592-83211614 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1153185255 18:2478918-2478940 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1153396732 18:4630513-4630535 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1153525713 18:5992705-5992727 AGGGAGAGAGTGGGGGTGGAGGG - Intronic
1153680653 18:7497389-7497411 AGGGAGGAAGAGGAGGAAGAGGG + Intergenic
1154316798 18:13310614-13310636 AGGGAGGAAGAGGAGGTGAAGGG - Intronic
1154500262 18:14992515-14992537 TGGCAGATACAGGAGGAGGATGG + Intergenic
1154991112 18:21599699-21599721 AGGGAGGAAGAGGAGGAGGAAGG - Intronic
1155071479 18:22320715-22320737 AGGGAGAGAGAGGAGGAGGGTGG + Intergenic
1155271436 18:24145121-24145143 AGGTAGAAAAAGGAGTTGAAAGG - Intronic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1156294631 18:35778386-35778408 AGGGGGAAAAAAGAGTTGGAAGG - Intergenic
1156338386 18:36188803-36188825 AGGGAGAGTCAGGAGGGAGACGG + Intronic
1156598846 18:38579821-38579843 AAGGAGAAGGAGGAGGTAGAAGG + Intergenic
1156768543 18:40689609-40689631 AAGGAGAAAAAGAAGGAGGAGGG - Intergenic
1156895143 18:42237371-42237393 AGAAAGAGACATGAGGTGGAGGG + Intergenic
1157151112 18:45219490-45219512 AGAGAGTAAGAGGAGGTGAAAGG + Intronic
1157499021 18:48177224-48177246 AGGGTGAAGCAGGAGGGCGAGGG - Intronic
1157528627 18:48404379-48404401 AGAAACAAAAAGGAGGTGGAAGG + Intronic
1157621155 18:49018169-49018191 AGGAAGACACAGGAGAAGGAAGG + Intergenic
1157804842 18:50650362-50650384 AGGGACAAACAGGAGGAGCTAGG - Intronic
1157977162 18:52340403-52340425 AGGGACCAAGAGGAGATGGAAGG - Exonic
1158227333 18:55214854-55214876 AAGGAGAAATGGGAGGAGGAGGG - Intergenic
1158275190 18:55759216-55759238 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1158596750 18:58823294-58823316 AGGGTGAAAAAGGAGGTGGGAGG + Intergenic
1159200450 18:65176952-65176974 GAGGAGAAAAGGGAGGTGGAGGG + Intergenic
1159238753 18:65713097-65713119 AGAAAGAAACAGAAGGAGGAAGG - Intergenic
1159313104 18:66736041-66736063 AGAGAGAGAAAGGAGGAGGAAGG - Intergenic
1160219733 18:76965911-76965933 AGGGAGGAACAGGTGGTGGGCGG + Intronic
1160267566 18:77353581-77353603 AGGGAGGATCAGGTGGTGGGTGG + Intergenic
1160350522 18:78174517-78174539 ACGGAGAGACACGAGGTGGCCGG + Intergenic
1160470630 18:79129502-79129524 AGAGAGAAAAAGGAGGGGCAGGG - Intronic
1160496591 18:79379645-79379667 AGGTAGAGACTGGAGGAGGAAGG + Intergenic
1160555739 18:79723801-79723823 AGGGAGGGACAGCAGGTGGAGGG - Intronic
1160726725 19:620829-620851 AGGGAGAAGCAGGACGGGCAGGG + Intronic
1160839753 19:1140805-1140827 TGAGAGAAACAGGAAATGGATGG + Intronic
1160873754 19:1288003-1288025 CCGGAGCAACAGGAGGTGGCTGG - Intronic
1161112678 19:2478937-2478959 TGGGAGAAGTAGGAGGTGGCTGG - Intergenic
1161279360 19:3436969-3436991 TGGGAGCTACAGGAGGAGGAAGG + Intronic
1161513769 19:4685370-4685392 AGGGAGAGTCAGCAGGCGGAGGG + Intronic
1161684841 19:5697589-5697611 AGGGAGAGAGAGGAGGGGGTGGG + Intronic
1161801626 19:6419470-6419492 AGGGAAAAGGATGAGGTGGAGGG + Intronic
1161957941 19:7506664-7506686 AGGGAGGAGCTGGAGGAGGACGG - Intronic
1161963306 19:7534634-7534656 TGGGAAAACCAGGAGGTGGGTGG - Intronic
1161994230 19:7702646-7702668 AGGGAGAAGGAGGAGTAGGAGGG + Intergenic
1162219935 19:9167792-9167814 ATGAAATAACAGGAGGTGGAGGG - Intergenic
1162380797 19:10330551-10330573 AGGGAGTTACTGGAGATGGAAGG + Intronic
1162444816 19:10716343-10716365 ATGGAGAAAGAGGAGGAGGGTGG - Intergenic
1162494789 19:11017661-11017683 AGGGAGAAGCCGGAGGTGTGCGG - Intronic
1162930026 19:13952938-13952960 AGGGAGAATCAGGAGGAAGGGGG + Intronic
1163061288 19:14763975-14763997 AGGAAGAAAAAGGAGGAAGAGGG - Intronic
1163105781 19:15122435-15122457 AGGGAAAAGGAGGAGGAGGAGGG + Intronic
1163195624 19:15717613-15717635 GGGCTGAAACAGGAGCTGGAAGG + Intergenic
1163357163 19:16821338-16821360 AGGGTGAGGTAGGAGGTGGACGG + Intergenic
1163453993 19:17395241-17395263 AAGGAGAAACAGGAAGAGGAGGG - Intergenic
1163520474 19:17788599-17788621 GGGGAGGAAGAGAAGGTGGATGG + Intergenic
1164145490 19:22510196-22510218 AGGGTGGGGCAGGAGGTGGAGGG + Intronic
1164157309 19:22604434-22604456 ACGGAGTAAGTGGAGGTGGAGGG + Intergenic
1164166194 19:22677687-22677709 AGGAAAAAACAGGTGCTGGAGGG + Intergenic
1164441704 19:28284492-28284514 AAGGGGAAAGAGGAGGTGGAGGG + Intergenic
1164558861 19:29274755-29274777 GTGGAGGGACAGGAGGTGGAAGG + Intergenic
1164572616 19:29385276-29385298 AGGGGGTGGCAGGAGGTGGATGG + Intergenic
1164676431 19:30104666-30104688 TGGGAGAAACAGAAGGTGAGAGG - Intergenic
1164771934 19:30816223-30816245 AGGGAGGAAAAGAAGGAGGAAGG - Intergenic
1164868643 19:31625649-31625671 AAAGAGAAACATGAGGGGGAGGG - Intergenic
1164941677 19:32255921-32255943 AGGAAGGCACAGGAGGTGGGAGG + Intergenic
1165287337 19:34852969-34852991 AGGGAGAAAAAGGAGGATGGTGG + Intergenic
1165361939 19:35342091-35342113 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1165773201 19:38389971-38389993 AGGGATAAGCAGGAGGGGGAGGG + Intronic
1165917423 19:39269293-39269315 AGGGAGAAAGAGACGGTGAAGGG - Intronic
1165982720 19:39738188-39738210 AGGGAGGTACTGGAGGAGGAAGG + Intergenic
1166211076 19:41306811-41306833 TAGGAAGAACAGGAGGTGGAAGG - Exonic
1166234635 19:41446599-41446621 GGGGAGGCACAGGAGGCGGAGGG + Intergenic
1166309003 19:41951972-41951994 AGAGAGATTCAGGAGGTTGAAGG - Intergenic
1166570196 19:43790897-43790919 AGGGAGACCAGGGAGGTGGATGG - Intergenic
1166674922 19:44734582-44734604 AGGGAGGAAGAGGAAGAGGAAGG - Intergenic
1166979601 19:46624766-46624788 GGAAAGAAACAGGAGGTGGTGGG - Intronic
1167602586 19:50463119-50463141 TGAGAGAAACAGGTGGTGGGTGG - Intronic
1167608486 19:50494359-50494381 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
1167622036 19:50566072-50566094 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1167648769 19:50718945-50718967 AAGGAGAAGCGGGAGCTGGAGGG + Intronic
1168189725 19:54729317-54729339 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168194006 19:54760255-54760277 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168196052 19:54774990-54775012 AGAGAGACAGAGAAGGTGGAAGG + Intronic
1168205441 19:54847241-54847263 AAGGAGAAAGAAGAGGAGGATGG - Intronic
1168509259 19:56961521-56961543 AGGGGGAAAGAGGAGGGGGGAGG - Intergenic
924992818 2:328576-328598 AGGGAAGATCAGGTGGTGGATGG + Intergenic
925034238 2:673732-673754 AGGGAGGAGGAGGAGGAGGAGGG + Intronic
925148612 2:1599801-1599823 AGGGAGCAGCAGGAAGAGGAGGG - Intergenic
925156426 2:1651768-1651790 AGAGAGAAACAGCAGGCGGGAGG - Intronic
925342878 2:3149003-3149025 AGGGAGCAGCCGGAGATGGATGG + Intergenic
925617117 2:5754213-5754235 AACGAGACACTGGAGGTGGAGGG + Intergenic
925755330 2:7127974-7127996 AGGGAGGAAGGGGAGGGGGAGGG - Intergenic
925755513 2:7128306-7128328 AGGGAGAAAGGGGAGGGGGAAGG - Intergenic
925871446 2:8274986-8275008 AGGGAGAGAGATGAGGTGGCCGG + Intergenic
925881709 2:8358120-8358142 AGGGAGAGACAGGAGATGGAGGG + Intergenic
925957051 2:8977040-8977062 AGGGAGAGGCAGGAGGGAGACGG + Intronic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926444458 2:12926329-12926351 AGAGAGAGACAGAAAGTGGAGGG + Intergenic
926458871 2:13102614-13102636 AGCGAGAAAGATGAGGTGGGAGG + Intergenic
926544135 2:14217954-14217976 AAGGAGGTAGAGGAGGTGGAAGG + Intergenic
926544891 2:14227178-14227200 AGGGAGGAAGAGGGGGTGGAAGG + Intergenic
926558306 2:14386564-14386586 GAGGAGAAGCAGGAGGGGGAGGG + Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
926983848 2:18599588-18599610 AGAGAGAAACAGGATGTGACAGG - Intergenic
927393281 2:22620511-22620533 AGGGAGAAACTAGATGAGGATGG + Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
928105825 2:28470055-28470077 GGGGAGAAAGAGGAGGAGGAAGG + Intronic
928291535 2:30042000-30042022 AGGGAGAAACATGGGGAGAAGGG + Intergenic
928366572 2:30707578-30707600 GGGGAGGCACAGGATGTGGAGGG - Intergenic
928415136 2:31085615-31085637 AGGGAGATACCGGAGGAGAAGGG - Intronic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
928924968 2:36568163-36568185 AGGGAGAGACAGAAGGGGTAGGG + Intronic
929307303 2:40378207-40378229 AGGGGGAAACAGTATATGGAAGG + Intronic
929379273 2:41331175-41331197 AGGGAAAAAGGGGAGGTGGTAGG - Intergenic
929488683 2:42377227-42377249 AGGGAGGATAAGGGGGTGGAAGG - Intronic
929757292 2:44778416-44778438 AAGGGAAAACAGGAGTTGGAGGG + Intergenic
929778265 2:44941960-44941982 AGGGGGGAGCAGGAGGAGGAGGG - Exonic
929935357 2:46290933-46290955 AGGGAGAAAAAGAAGGAGGGAGG - Intergenic
930095432 2:47562764-47562786 GGTGAGGAACAGGGGGTGGAGGG - Intronic
930209319 2:48617961-48617983 AGGGGGAAACAAAAGGTGCAGGG - Intronic
930301277 2:49618968-49618990 TGGGGGAAACAGGAGGTTGGGGG + Intergenic
930881883 2:56279424-56279446 GGGGAGAAATAGGTGGTGGGAGG - Intronic
931101887 2:59011233-59011255 TGGGAAAAACAGGAGGTGGGTGG + Intergenic
931183475 2:59927054-59927076 AGTGAGAAGCAGGAGGGGGTAGG + Intergenic
931249271 2:60515700-60515722 AGGGAGAAAGTGGTGGTGGGTGG + Intronic
932224632 2:70029916-70029938 AGGGAGAGACCAGAGGAGGAGGG - Intergenic
932312288 2:70753404-70753426 AGGGAGAAATGGGAGGAGGGGGG + Intronic
932384872 2:71323199-71323221 GGGGAGGAACAGGTGGTGGGAGG + Intronic
932541700 2:72662067-72662089 AGGGAGGAAAGGGAGGGGGAGGG + Intronic
932820509 2:74895689-74895711 TGGGAGAAACAGGGGGTTGAGGG - Intergenic
932993136 2:76812797-76812819 AGGAAGAATAAGGAGGAGGAGGG - Intronic
933627163 2:84614053-84614075 TGGGGGAAACAGGTGGTGTATGG + Intronic
933938754 2:87228102-87228124 AGAGAGAAGCAGGAGGCGGCTGG - Intergenic
934128564 2:88922830-88922852 ATGAAGAAAAAGGAGGAGGACGG + Intergenic
934535325 2:95128610-95128632 AGAAAGAAAAAGGAGGAGGAGGG + Intronic
934652386 2:96099921-96099943 AAGGACAAAGAGGAGGGGGAGGG + Intergenic
934653267 2:96104233-96104255 AGGGAGAGGAAGGAGGAGGAGGG - Intergenic
934711319 2:96516167-96516189 AGTGAGAAACTGGACATGGACGG + Intergenic
935143607 2:100378026-100378048 AGGGAGAAACAGAAAGAGGTAGG - Intergenic
935375121 2:102387810-102387832 AGAGAGATACATGAGATGGAGGG + Intronic
936022464 2:109005366-109005388 AGGGAGATCCAGGCTGTGGAAGG - Intergenic
936354382 2:111737673-111737695 AGAGAGAAGCAGGAGGCGGCTGG + Intergenic
936430650 2:112459491-112459513 GGGGAGAAACAGGAGAGGGCAGG - Intergenic
936597006 2:113857747-113857769 AGGGAGTAAAAGGAGTTTGAAGG + Intergenic
936710149 2:115122262-115122284 AGGGAAAAACAGGGGTGGGAGGG - Intronic
936854834 2:116944779-116944801 AGAGAAAAAGAGGAGGTGGGAGG + Intergenic
936896596 2:117434659-117434681 AGGGGGAAATGGGAGGGGGAAGG + Intergenic
937217302 2:120321079-120321101 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217306 2:120321092-120321114 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217315 2:120321121-120321143 AGGGAGAAGGAGGAGGGAGAAGG - Intergenic
937217377 2:120321294-120321316 AGGGAGAAGGAGGAGGAGGGAGG - Intergenic
937217392 2:120321339-120321361 AGGGAGAAGAAGGAGGGAGAAGG - Intergenic
937689725 2:124741814-124741836 AGAGAGAATAAGGAGGAGGAGGG - Intronic
937713142 2:125001134-125001156 AGGGACAACAAGGAGGTGGTTGG + Intergenic
938098178 2:128476646-128476668 AGGGACAAACAGGAGGCTGGTGG + Intergenic
938493005 2:131775780-131775802 TGGCAGATACAGGAGGAGGATGG - Intergenic
938935233 2:136121738-136121760 AGCGAGCAACAGGAGGTGGCAGG - Intergenic
939010379 2:136839276-136839298 AGGGAGAAACATGAGTTAGAAGG - Intronic
939031881 2:137086440-137086462 AGACAGAAGCAGGAGTTGGAGGG - Intronic
939618350 2:144386516-144386538 AGGGGGTAACAGGAGGGGCAAGG + Intergenic
939967414 2:148624049-148624071 AGGGAGAGACAGGAGGAGAGAGG - Intergenic
940011534 2:149060019-149060041 AGGGAGAAGGAGGAGGAGGAGGG + Intronic
940019877 2:149145606-149145628 AGAGAGAAAGAGGGGGTGGATGG + Intronic
940463887 2:154003810-154003832 AAGGAGGAAGAGGAGGGGGAAGG - Intronic
940488799 2:154330240-154330262 AGGGAGCAGCAAGTGGTGGAGGG + Intronic
941357916 2:164515174-164515196 AAGGAGGATCAGGTGGTGGATGG - Intronic
941702138 2:168614836-168614858 AGGGAGCATCAGGCAGTGGATGG - Intronic
941779306 2:169427001-169427023 CCGGAGAAAGTGGAGGTGGAGGG + Intergenic
942686955 2:178542836-178542858 AGGAAGCAGCAGGAGGTGGACGG + Exonic
943052182 2:182927896-182927918 AGGGAGAAACAGGTGAAGGTGGG - Intronic
943418795 2:187639908-187639930 AGAGACAAAGAGAAGGTGGAAGG + Intergenic
944212901 2:197225051-197225073 AGGGAGAAAAGGGAAGAGGAGGG + Intronic
944902783 2:204232599-204232621 ATGGAGAAACAGGAGAAGAAAGG + Intergenic
945771656 2:214050747-214050769 AGGGAGAAAAAGAAGATGGGAGG - Intronic
945987532 2:216367315-216367337 AGAGAGAAGGAGGAGGAGGAGGG - Intronic
946076920 2:217081953-217081975 TGGGAGCAACAGGAGATGGAAGG - Intergenic
946109407 2:217401192-217401214 AGGGAGCAACAGCAGGTGAGAGG - Intronic
946199762 2:218064827-218064849 GGGGAGGAACTGGAGGGGGAGGG - Intronic
946280584 2:218663061-218663083 TGGGAGGAACAGGAGGTCGAGGG + Intronic
946313614 2:218896261-218896283 AGGGAAAAGTAGGAGGAGGAAGG + Intronic
946459301 2:219854850-219854872 AGGGATAGACAGGACTTGGAGGG - Intergenic
946488541 2:220125297-220125319 AGTGAAAAAAAGGAGGAGGAGGG + Intergenic
946644254 2:221816313-221816335 AGAGAAAAAGAGGAGGGGGAAGG - Intergenic
946986867 2:225283121-225283143 TTGGAGAAACAGAAGGTGGTGGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947133370 2:226952813-226952835 AGGGAGGGAGAGGGGGTGGAGGG + Intronic
947610944 2:231524876-231524898 AGAGGGAAACAGCAGGAGGAGGG - Exonic
947745936 2:232507370-232507392 TGGAAGAAAAAGGAGGTGCAGGG - Intergenic
948091957 2:235302242-235302264 AGGGAGAAAGAGGAGGGAGGAGG - Intergenic
948254305 2:236554778-236554800 AGAGAGATACAGCAGGAGGAAGG - Intergenic
948458843 2:238119521-238119543 GGGGAGATGGAGGAGGTGGATGG + Intronic
949047315 2:241877891-241877913 AGGGGGAAAGAGGAAGGGGAGGG - Intergenic
1168974390 20:1953201-1953223 AGGGAGAGAGAGAAGGAGGAAGG + Intergenic
1169055268 20:2615657-2615679 AAGGAGAAAGAAGAGTTGGAAGG + Intronic
1169541213 20:6601514-6601536 AGGAAGAGAAAGGAGGTGGACGG - Intergenic
1169971292 20:11271741-11271763 ACGAGGAAACAGGAGGTGGTGGG - Intergenic
1169986697 20:11453014-11453036 AGAGAGAAACAGGAAGAGGTAGG + Intergenic
1170663811 20:18367509-18367531 GGGGAGAAAGTGGAGGTTGAGGG + Intergenic
1171038648 20:21739470-21739492 AGGGAGGATCAGGTGGTGGATGG + Intergenic
1171052609 20:21874018-21874040 AAGGAGAAATGGGAAGTGGATGG + Intergenic
1171148590 20:22807193-22807215 GGGGAGAAAGACGAGGTAGAGGG - Intergenic
1171158106 20:22895355-22895377 AGGGAGGCTCAGGAGATGGAGGG - Intergenic
1171336962 20:24393684-24393706 AGGGAAGAACAGGAGGGAGAAGG + Intergenic
1171366661 20:24629484-24629506 AGGGAGGCAGAGGAGGAGGAAGG + Intronic
1171378613 20:24714667-24714689 AGGGAGGATCCGGGGGTGGATGG + Intergenic
1171523213 20:25791472-25791494 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171530956 20:25853452-25853474 AGGAAGAAACTGCAGGTGGAGGG - Intronic
1171553613 20:26064411-26064433 AGGAAGAAACTGCAGGTGGAGGG + Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172044493 20:32070883-32070905 ACGAAGAAAGAGGAGGAGGAGGG + Intronic
1172230378 20:33332264-33332286 GGGGAGAGAAAGGAGGGGGAGGG - Intergenic
1172426557 20:34859926-34859948 TGGGAGAGACATGAGGTTGATGG - Intronic
1172679264 20:36699714-36699736 GGGTACACACAGGAGGTGGATGG + Intronic
1172877744 20:38176255-38176277 AGAAAAAAAAAGGAGGTGGAGGG - Intergenic
1173010341 20:39176355-39176377 AGGGGGAACCAGCAGGTGCAAGG - Intergenic
1173041114 20:39463835-39463857 AGGGGGGAACAGGAGGTACAGGG - Intergenic
1173253224 20:41375461-41375483 CCAGAGAAACAGGAGGAGGATGG - Intergenic
1173447648 20:43134484-43134506 AGGAAGAAACATGAGGGGTAAGG - Intronic
1173836234 20:46128088-46128110 AGGGAGAAACTGCAGGTGAGGGG + Intronic
1173876630 20:46376415-46376437 AGGGAGAGTCAGGAGGGAGAGGG - Intronic
1173918247 20:46725572-46725594 AGGGAGGAAGAGGAGGCTGAGGG - Exonic
1174146821 20:48458232-48458254 AGGGAGAGAAAGGGGGTGGGGGG - Intergenic
1174302542 20:49592942-49592964 AGAGAGAGAGAGGAGGTGGAGGG + Intergenic
1174397470 20:50256781-50256803 AGGGAGGGACAGGATGTGTAAGG + Intergenic
1174405099 20:50297688-50297710 GGGGAGAATCAGGGGGTGGGAGG - Intergenic
1174465748 20:50715996-50716018 AGGCAGAAACTTTAGGTGGAAGG - Intergenic
1174572370 20:51511188-51511210 AGGGAGCAACAGGGGGTGGTGGG - Intronic
1174641774 20:52050482-52050504 GAGGAGAAAGAGGAGGAGGAAGG - Intergenic
1174707047 20:52667671-52667693 AGGGGGAATGAGAAGGTGGAGGG - Intergenic
1174787353 20:53445111-53445133 AGGGAGAAACTTGAAGTGTAAGG + Intronic
1175486404 20:59349955-59349977 AGAGAGAAACTGGAGAGGGAAGG + Intergenic
1175774147 20:61642307-61642329 ATGGGGAACCAGCAGGTGGATGG + Intronic
1175813334 20:61870512-61870534 AGGGACATGCAGAAGGTGGAGGG - Intronic
1175977870 20:62721955-62721977 AGTGAGAAGCAGGAGGTGTCAGG - Intronic
1176614896 21:9018609-9018631 TGGCAGATACAGGAGGAGGATGG + Intergenic
1176710314 21:10145262-10145284 TGGCAGATACAGGAGGAGGATGG - Intergenic
1177140546 21:17353231-17353253 GGAGAGAAACAGGTGGTGGGTGG - Intergenic
1177176492 21:17705224-17705246 GGGGAGGAACAGGTGGTGGGGGG - Intergenic
1177604823 21:23364198-23364220 AGGGAAAAACAGGAGGAGCAGGG + Intergenic
1177926696 21:27225790-27225812 TGGTAGAAACAGAAGGAGGAGGG + Intergenic
1178038231 21:28609023-28609045 AGGAAGGAACAGGTGGTGGGTGG - Intergenic
1178170580 21:30035289-30035311 GGGGAGAGAAAGGAAGTGGAGGG - Intergenic
1178336189 21:31745585-31745607 ATGGAGAAAGAGGAAGTAGAAGG + Intergenic
1178719170 21:34992868-34992890 ATGGAGAAACTGGACTTGGATGG - Intronic
1179479929 21:41670532-41670554 CTGCAGCAACAGGAGGTGGAGGG + Intergenic
1179812987 21:43884264-43884286 AGGGGGAAGGAGGAGGGGGAAGG - Intronic
1180119925 21:45739397-45739419 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180119943 21:45739452-45739474 ATGGACAAACAGGAAGTGGTGGG - Intronic
1180294393 22:10872414-10872436 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180497199 22:15901828-15901850 TGGCAGATACAGGAGGAGGATGG - Intergenic
1180611360 22:17100323-17100345 AGGGAGGAAGGGAAGGTGGATGG - Intronic
1181081633 22:20419483-20419505 AGGGAGGAAGAGGAGTGGGAAGG - Intergenic
1181235254 22:21444656-21444678 AATGAGAAAATGGAGGTGGAGGG - Intronic
1181618518 22:24071554-24071576 AGGGAGAAACAAAGGCTGGAGGG - Intronic
1181860334 22:25813133-25813155 AGGAAGAAGGAGGAGGAGGAGGG - Intronic
1181883399 22:25999576-25999598 AAGGAGGAAGAGGAGGAGGAGGG - Intronic
1181928740 22:26381707-26381729 AGGTATAAAGAGAAGGTGGAGGG + Intronic
1181963787 22:26642503-26642525 AGGGAGAGAGAGGAGGTGGGGGG + Intergenic
1182006018 22:26960297-26960319 AGGGAGAGAAAGGAGGAGGAAGG + Intergenic
1182048988 22:27298942-27298964 AGGGAGAAAAGGAAGGAGGAAGG + Intergenic
1182296171 22:29312107-29312129 AGGCAGAGTCAGGAGCTGGAGGG - Intronic
1182340618 22:29617550-29617572 AGGGAGAAAGAGGAGATTGGAGG - Intronic
1182353373 22:29711116-29711138 AGGAAGCAACAGCAGATGGACGG - Intergenic
1182681019 22:32080182-32080204 AGGCAGAGCCAGGAGGTGGGAGG - Intronic
1182871436 22:33651038-33651060 AAGGAGTACCAGGAAGTGGAGGG + Intronic
1182876360 22:33694707-33694729 GTGGAGAGACAGGAGGGGGAAGG + Intronic
1182931479 22:34178311-34178333 AAGGAGAAGGAGGAGGAGGAGGG - Intergenic
1183336194 22:37248174-37248196 AGGGAGAAACAGGGAGAGGTGGG - Intergenic
1183401514 22:37607886-37607908 AGGGAGAAAAAGTAGGATGAAGG - Intergenic
1183411985 22:37660264-37660286 GTGGGGACACAGGAGGTGGAGGG - Intronic
1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG + Intergenic
1183780879 22:39998145-39998167 AGGGCGAAAGGGGAGGAGGAAGG - Intronic
1183961341 22:41413610-41413632 GAGGAGAAAAAGGAGGAGGAGGG + Intergenic
1184285227 22:43466862-43466884 AGGGACAATCAGGAGGTGGAGGG - Intronic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1184368975 22:44070600-44070622 GAGGAGAAACCAGAGGTGGAAGG + Intronic
1184449734 22:44575843-44575865 AGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184449764 22:44575977-44575999 GGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184525263 22:45019049-45019071 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
1184526672 22:45027990-45028012 GAGGAGAAGGAGGAGGTGGAAGG + Intergenic
1184638378 22:45854394-45854416 GGGGGGAAAAGGGAGGTGGAGGG + Intergenic
1184757687 22:46526161-46526183 ATGGAGGAGCAGGAGGCGGACGG - Intronic
1184899605 22:47436738-47436760 AGGGAGAGAGAGGAGGTGCCGGG - Intergenic
1185007251 22:48288200-48288222 AGGGAGAGAAAGGTGGAGGACGG + Intergenic
1185311810 22:50160224-50160246 AAAAAGAAACAGGAGGTGGGGGG - Intronic
949219015 3:1607191-1607213 AGGTAGGAAAAGGAGGAGGAGGG + Intergenic
949462995 3:4314043-4314065 AGGAAGAAAGAGGAGGTGAAGGG - Intronic
950531246 3:13553445-13553467 AGGCAGGACCTGGAGGTGGACGG - Intronic
950572469 3:13809987-13810009 AGGGAGAGACAGGAGCTGGTGGG + Intergenic
950575970 3:13832240-13832262 TGGGAGCAAGAGGAGGAGGAGGG - Intronic
950768349 3:15290914-15290936 AGGCAGAAACAGGAAGTGGCTGG + Intronic
951187877 3:19735345-19735367 AGGGAGAAAGAGGGGGAGGGAGG - Intergenic
951719186 3:25679747-25679769 AGGGGGAGAGAGGAGGGGGAAGG + Intergenic
952107560 3:30087630-30087652 GGGGAGGAGGAGGAGGTGGAGGG - Intergenic
952231697 3:31437633-31437655 ATTGTGAAAGAGGAGGTGGAGGG + Intergenic
952358877 3:32610214-32610236 GGGGAAAAACTGGAGGTGAAGGG - Intergenic
953042415 3:39267182-39267204 AGGGAGAACCATGAGCAGGAGGG + Intronic
953592211 3:44269348-44269370 AGGGAGGAGAAGGAGGAGGAGGG - Intronic
953916138 3:46922328-46922350 AGGGAGAAGCAGGAAGGTGAAGG + Intronic
953916381 3:46923444-46923466 TGGGAGAAAGAGGAGGAGGAAGG + Intronic
954411631 3:50373697-50373719 AGGGAGATAGAGGAGATGCAGGG + Intronic
954474027 3:50726358-50726380 AAGGAGATACAGGAGGTATAAGG + Intronic
954535818 3:51358557-51358579 AGGGAGAAAAGGGAGTTGGGAGG - Intronic
954699781 3:52445199-52445221 AAGGAGAAGCGGCAGGTGGACGG - Intergenic
954792765 3:53145313-53145335 AGGCAGAACCAGGAACTGGAGGG - Intergenic
954876509 3:53806143-53806165 AGGGAAAAGAAGGAGGAGGAGGG - Intronic
955307451 3:57848552-57848574 AGGAAGAAAAAGGAGAAGGAGGG - Intronic
955488618 3:59460392-59460414 AGGGAGAAACAGGAAAAGGAAGG - Intergenic
955621622 3:60870478-60870500 AAAGAGATGCAGGAGGTGGAAGG + Intronic
955864918 3:63372258-63372280 GGTGAGAAGCAGGGGGTGGAAGG - Intronic
955962485 3:64355146-64355168 AGGGAGAGAAAGGAGGCGGGGGG + Intronic
956182707 3:66532452-66532474 AGGGACAATCAGGAGGGAGAAGG - Intergenic
956399474 3:68861757-68861779 AGGGAGAAAAGGGAAGTAGAAGG + Intronic
956640582 3:71412058-71412080 AGGGAGAGACAGGTGCTGTAGGG - Intronic
956665412 3:71637534-71637556 AAGGAGAAAGAGGGGGAGGAGGG + Intergenic
956737619 3:72250195-72250217 GGGGAGAAGCAGGAGGAGGCTGG + Intergenic
956874146 3:73445334-73445356 TAGGAGAAGCAGGAGTTGGATGG + Intronic
957500146 3:81045321-81045343 AGAGAGGAAGAGGAGGAGGAAGG - Intergenic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
958182991 3:90083923-90083945 AGGGGGATACAAGAGGAGGATGG - Intergenic
958487165 3:94727559-94727581 AAGAAGAAACAGGACATGGATGG - Intergenic
958813438 3:98889967-98889989 AGTGAGAAAAAGGTGGTAGATGG - Intronic
959407431 3:105977373-105977395 TTGGAGAAGCAGGAGGTAGATGG - Intergenic
959940296 3:112074044-112074066 TGGGAGAAAGAAGAGGTGGTTGG + Intronic
959963832 3:112332291-112332313 AAGGAGGAAGAGGAGGAGGAGGG + Intergenic
960623710 3:119660344-119660366 AGGTGGAAGCAGGATGTGGAAGG - Exonic
960641334 3:119826559-119826581 AGGGAGATCCAGGGGGTGGGAGG - Intronic
960849113 3:122033918-122033940 AAGAAGAAAAATGAGGTGGAAGG - Intergenic
960881325 3:122348251-122348273 AGAGAGGAAGAGGAAGTGGAGGG + Intergenic
961374747 3:126456824-126456846 AGGGAAAAACAAGAAGTTGATGG + Intronic
961465699 3:127079826-127079848 ACGGAGAAACAGCAAGTGCAAGG - Intergenic
961917093 3:130387710-130387732 AGGGAGAAACTGTAAGAGGATGG + Intronic
962201323 3:133403321-133403343 GTGGAGAAACAGGAGGGGTAAGG - Intronic
962359572 3:134726544-134726566 AGGGAGAGAGAGAAGGAGGAAGG - Intronic
962829615 3:139128564-139128586 AGAGACAAATAGGAGGAGGAGGG + Intronic
962878610 3:139554846-139554868 AGGGAGAAAGGGGAAGAGGAGGG + Intergenic
963069505 3:141291445-141291467 AGGTACAAAAATGAGGTGGATGG - Intronic
963237788 3:142972569-142972591 AGAGAGAAACAGCAAGTGCAAGG - Intronic
963499485 3:146107743-146107765 AGGCTGAGGCAGGAGGTGGAAGG - Intronic
963832029 3:150018301-150018323 AGAGATAAAAAGGAGGTGGGAGG + Intronic
964237857 3:154555090-154555112 TCAGAGAAACAGGAGCTGGAGGG - Intergenic
964248608 3:154684252-154684274 AGGGAGGATCAGGTGGTGGGTGG + Intergenic
964265024 3:154886278-154886300 AGTGAGAAACAGGACCTGAAGGG + Intergenic
964271734 3:154964008-154964030 AGGGAGAGAAAGAAGATGGAGGG - Intergenic
964397737 3:156265329-156265351 AGGGAGAAGAAGTAGCTGGATGG - Intronic
964508177 3:157422006-157422028 AGGGAGAAAGGGCAGTTGGAGGG - Intronic
964661409 3:159124176-159124198 AGGAAGAAAGAAGAAGTGGAAGG - Intronic
964876290 3:161372082-161372104 GCGGATAAACAGGAGGTAGAAGG + Exonic
964894348 3:161577310-161577332 AGTGAGAAAGAGGAGATGGTAGG + Intergenic
965395660 3:168158047-168158069 AGAGAGAAAAAGGAAATGGAGGG - Intergenic
965430660 3:168583815-168583837 AGGGAGAAAGAGGAGAAGCAAGG + Intergenic
965674080 3:171176533-171176555 AGGGAGAAAAGGTAGGTGGAAGG + Intronic
966532387 3:180995335-180995357 AAGGAGAAACATGGGCTGGAGGG - Intergenic
966559164 3:181299961-181299983 AAGGAGAAGGAGGAGGAGGAGGG + Intergenic
966908496 3:184544545-184544567 GGGGAGAAGGAGGAGGAGGAGGG - Intronic
967391630 3:188961819-188961841 AGGGAGAAAAAAGAAATGGAAGG - Intronic
967483022 3:189996466-189996488 AGGGAGAGACAGGAAGAGGTTGG + Intronic
967584798 3:191199067-191199089 AGGGAGAAACTGAAGAAGGAAGG + Intergenic
967892927 3:194375778-194375800 AGGGAAAGACAGGAGTGGGAGGG - Intergenic
968236108 3:197030611-197030633 AAGGAGAAACAGGCGGAGAAGGG + Intergenic
968666637 4:1825959-1825981 CAGGAGAAACAGCAGGTGGCAGG - Intronic
969082417 4:4629143-4629165 AGCAAGAAAGAGGAGGTGGGAGG - Intergenic
969233889 4:5851694-5851716 AGGGAGGAGAAGGAGGAGGAAGG + Intronic
969717914 4:8877359-8877381 AGGAAGGAAGAGGGGGTGGAAGG + Intergenic
969727187 4:8927300-8927322 AAGGAGAAACAGGAGGGGTGCGG - Intergenic
969737512 4:9001250-9001272 TGGGAGAATCAGGAAGTCGAAGG - Intergenic
969838137 4:9860165-9860187 AGGGAGGAGAAGGAGGAGGAAGG - Intronic
969991076 4:11262852-11262874 AGGGAGAAAAAGAAGGAAGAGGG + Intergenic
970029374 4:11658188-11658210 AAGGAGGAACGGAAGGTGGAAGG + Intergenic
970228826 4:13887919-13887941 AGGGAGAAGGAGGAAATGGATGG - Intergenic
970397403 4:15682255-15682277 AGGGAAATGCAAGAGGTGGAAGG + Intronic
970435451 4:16029924-16029946 AGGGAAAGAAAGGAAGTGGAGGG - Intronic
970447228 4:16134393-16134415 AGGTAGAATCAGGAGGTCCATGG + Intergenic
970638677 4:18038752-18038774 AGGGAGAAATGGGAAATGGAAGG - Intergenic
971195013 4:24464834-24464856 CAGGAGAAACATGCGGTGGAGGG - Intergenic
971380787 4:26095654-26095676 AGGAAGAAGAAGGAGGAGGAAGG + Intergenic
971422801 4:26489489-26489511 AGAGAGAAACAGGAGCAAGACGG + Intronic
971478850 4:27096517-27096539 GGGGACAAATTGGAGGTGGAGGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971574540 4:28256593-28256615 AGGGAGGAGGAGGAGGAGGAGGG - Intergenic
971633851 4:29031456-29031478 AGGGAAAAGGAGGAGGAGGAGGG - Intergenic
972103136 4:35447461-35447483 AGGAAGGAAGAGGAGGAGGAAGG + Intergenic
972103212 4:35447764-35447786 AGGAAGGAAGAGGAGGAGGAAGG + Intergenic
972103225 4:35447811-35447833 AGGAAGGAAGAGGAGGAGGAAGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
973338826 4:48984290-48984312 AGTGAGAAACATGAGGTGTTTGG - Intergenic
973965077 4:56153516-56153538 TGGGAGAAACAGGAGGAAGGAGG - Intergenic
974074169 4:57153900-57153922 AGAGAGAAGGAGGAGGAGGAGGG + Intergenic
974615526 4:64274336-64274358 AAGTAGAAACTGGAGGTAGAAGG + Intergenic
974639279 4:64608237-64608259 ATGGAGAAATAGTAGGTGAAGGG + Intergenic
974686494 4:65238039-65238061 AGGGAGAGACAAGGGGTGGGTGG - Intergenic
974837192 4:67265297-67265319 AGGGAGACACAGAAGGTGGGTGG - Intergenic
974993799 4:69127972-69127994 AAGAAGAAATAAGAGGTGGATGG - Intronic
975319537 4:72994742-72994764 AGGGAGGAAGAGAAGGAGGAGGG - Intergenic
975504449 4:75122849-75122871 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
975725189 4:77284839-77284861 AGGGAGGAACATGAGGTGTGGGG - Intronic
975812789 4:78187081-78187103 TGGTAGAAACGAGAGGTGGAAGG + Intronic
976231209 4:82845212-82845234 AGGGAGAGGCTGCAGGTGGATGG + Intronic
976519972 4:86015418-86015440 AGTGAAAGACAGGAAGTGGATGG - Intronic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976634560 4:87274991-87275013 AGTGGGAAAGAGGAAGTGGAGGG - Intergenic
976703385 4:87995510-87995532 ATCAAGAAACAGGAGGAGGAGGG + Intergenic
976909271 4:90280383-90280405 AGAAAAAAACAGGAGATGGAAGG - Intronic
976995819 4:91432113-91432135 AGGCAGCAAGAGGGGGTGGATGG - Intronic
977218232 4:94308873-94308895 AGGGAGCAAAATGTGGTGGATGG - Intronic
977320823 4:95513674-95513696 AGAGAGAAACAGGTGAAGGAGGG + Intronic
978214576 4:106183386-106183408 AGAGAGAAACCTGAAGTGGATGG - Intronic
978268543 4:106859006-106859028 AAGGAGGAAGAGGAGGAGGAAGG + Intergenic
979672729 4:123377855-123377877 AGGGAGGAAAAGGAGAGGGAGGG - Intergenic
979908029 4:126322015-126322037 AGAGAGAAACAGGACGGAGATGG - Intergenic
979941298 4:126766499-126766521 AGGCAGAAACAGGAGTTGATGGG - Intergenic
980532374 4:134072164-134072186 AGGGAGAAAAAGGAAGCTGAAGG - Intergenic
980728668 4:136799100-136799122 AGAGAGAAAATGGAGGTGGCAGG + Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
980982769 4:139668604-139668626 AGAGAGAGAGAGGAGGGGGAGGG + Intronic
981616086 4:146646469-146646491 AGGGAGGAAGAGAAGGAGGAAGG - Intergenic
981732161 4:147910999-147911021 AGGGAGGAAGAGGAGGAGGGAGG - Intronic
982100106 4:151959214-151959236 AGGGAAAGCCAAGAGGTGGAAGG + Intergenic
982255452 4:153447057-153447079 AAGGAGAAGCAGGAGGTTGATGG - Intergenic
982349188 4:154396272-154396294 AGGGAAAAATGGGAGATGGAAGG + Intronic
984207687 4:176805833-176805855 AGCTAGCAAAAGGAGGTGGAGGG - Intergenic
984419111 4:179496850-179496872 AAGGAGAAAGAGGAGGAGGTGGG + Intergenic
985797655 5:1975178-1975200 AGAGAGAATCAGGAAGGGGAAGG + Intergenic
985832741 5:2247446-2247468 AAGAAGAAACAGGAGGAGAAGGG - Intergenic
986125630 5:4880472-4880494 AGTGAGAGACAGGAAGGGGAAGG + Intergenic
986271272 5:6233004-6233026 AGGGAGAAATAGCTGGAGGAGGG + Intergenic
986822834 5:11486579-11486601 AGGGAGAGACAGGGGAAGGAGGG + Intronic
987032876 5:13991569-13991591 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
987062367 5:14254644-14254666 GAGAAGAAACAGGAGGAGGAGGG - Intronic
987160193 5:15133612-15133634 AGGGAGGAAGAGGAGTTGGGAGG + Intergenic
987202381 5:15590503-15590525 AAAGAGAAAAAGGAGGTGGGAGG - Intronic
987249083 5:16080348-16080370 GTGGAGAAACAGGAAGGGGAGGG - Intronic
987521787 5:18994800-18994822 AGGAAGCAAAAGAAGGTGGAAGG - Intergenic
987955539 5:24735175-24735197 AGGGAGAATCCGGATGTGGTAGG + Intergenic
988089602 5:26519532-26519554 AGGGAGAAGAAGGAGGAGGAGGG + Intergenic
988705428 5:33721758-33721780 AGGAAGAAGCAGGTGGTGAAGGG - Intronic
988736639 5:34028633-34028655 AGGGAGAGAAAGAAGGAGGAAGG - Intronic
989102985 5:37837943-37837965 AGAGAGAAAAAGGAGGCGGTGGG + Intronic
989122859 5:38021601-38021623 AGGGAGAAACAAAGGGTGAATGG - Intergenic
990098498 5:52152197-52152219 TGAGAGAAACAGGTGGAGGATGG - Intergenic
990224518 5:53634599-53634621 AGGGAGAGGAAGGAGGGGGAAGG - Intronic
990510441 5:56484586-56484608 ATGGGGAAGCAGGAGGGGGATGG - Intergenic
990616713 5:57516203-57516225 AGGAGGAAGCAGGAGGCGGAAGG + Intergenic
990859341 5:60309216-60309238 AGGGAGAAACATGAGGGAGGAGG + Intronic
991040084 5:62166559-62166581 GGAAAGAAAGAGGAGGTGGACGG + Intergenic
991185398 5:63800796-63800818 AGGGAGTAGCTGGAGGTGCAGGG + Intergenic
991433562 5:66573280-66573302 AGAGAGAAAGAGGAAGAGGACGG + Intergenic
992027443 5:72684609-72684631 AGTGAGAAACAAAAGATGGAAGG - Intergenic
992132297 5:73705406-73705428 AGAGAAAGACAGTAGGTGGAAGG - Intronic
992269535 5:75051571-75051593 AGGGAGAGAGAGCAGGTAGAGGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
992898682 5:81270577-81270599 AGGGAGAACCAGGCAGTGGGCGG - Intergenic
993511880 5:88780832-88780854 AGGGAGAAAGAGAAGGGGGTAGG - Intronic
993644512 5:90445811-90445833 AGGAAGAAACTGGAAGAGGAGGG + Intergenic
993654296 5:90558751-90558773 GGGGAGAAAGGGGAGGAGGATGG + Intronic
993955575 5:94228475-94228497 ATGGAGGAACAGGAGGTGGGAGG - Intronic
994347251 5:98701120-98701142 AGGGAGAATCAGGTGGTGGGTGG - Intergenic
994864862 5:105255009-105255031 AGAGAGAAACAGAGGATGGAAGG + Intergenic
994954441 5:106510224-106510246 AGGGAGAAAGGGGAAGCGGAGGG - Intergenic
995069668 5:107904925-107904947 GGGGTGAAGCAGGAGGAGGAGGG + Intronic
995426162 5:112025859-112025881 ATGGAGAAACAGGTGGTTGGTGG - Intergenic
995694571 5:114865388-114865410 GGGGAGGAACAGGTGGTGGGTGG + Intergenic
995907438 5:117142498-117142520 AGGAAGAAGAAGGAGGGGGAGGG - Intergenic
996408929 5:123135593-123135615 AGGGAGTTGCAGGGGGTGGAGGG - Intronic
997113205 5:131097859-131097881 AGGGAGAAAGATGATGTGGTAGG - Intergenic
997951133 5:138243421-138243443 AGGGAAAAAGAAGAGGTGGTGGG - Intergenic
998071981 5:139205167-139205189 AGGGAAACAGAGGAGGGGGAGGG - Intronic
998092611 5:139380087-139380109 AGGCACAATCAGGAAGTGGATGG + Intronic
998429350 5:142057318-142057340 AGGGAGAGGCAGGAGGTTTATGG - Intergenic
999039453 5:148390882-148390904 AGGAAGAAAAAGGAGGAAGAAGG + Intronic
999051805 5:148531205-148531227 TGGGAGAAGCCAGAGGTGGAAGG + Intronic
999384114 5:151142181-151142203 ATGGAGAAACAAGAGGTGCCTGG + Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999452243 5:151687009-151687031 AGGAGGAGACAGGAGGAGGAGGG - Exonic
999625562 5:153517020-153517042 AGAGAGAGGCAGGAGGTGGGAGG + Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000963660 5:167629877-167629899 AAGGAGAAGGAGGAGGAGGAGGG + Intronic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001132907 5:169079549-169079571 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1001310033 5:170603932-170603954 AGGGAGAAACAGGAGGTGGAGGG + Intronic
1001745485 5:174089378-174089400 AGGGAAACCCATGAGGTGGAAGG + Intronic
1002076970 5:176714093-176714115 AGGGAGAAAGGGGTGTTGGAAGG + Intergenic
1002288981 5:178187076-178187098 AGGGAGGAGCATGAGGAGGAGGG - Intergenic
1002414131 5:179109955-179109977 AGGGAGAAGCAGGGGTAGGAAGG - Intergenic
1002453240 5:179331415-179331437 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453249 5:179331435-179331457 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453258 5:179331455-179331477 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453267 5:179331475-179331497 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453276 5:179331495-179331517 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453285 5:179331515-179331537 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453294 5:179331535-179331557 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453303 5:179331555-179331577 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453312 5:179331575-179331597 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002453321 5:179331595-179331617 AGGGAGGGAGAGGAGGGGGAAGG + Intronic
1002614474 5:180442215-180442237 AGGAAGGGACAGGATGTGGAGGG + Intergenic
1002742623 5:181444747-181444769 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1002795669 6:469425-469447 AGGGGGAGAGAGGAGGGGGACGG - Intergenic
1003105395 6:3211326-3211348 AGGGAGCAGGAGGAGGAGGATGG - Intergenic
1003930454 6:10919601-10919623 AGGGAGGAACAGGCGGTGGGTGG + Intronic
1004025202 6:11811460-11811482 ACGGCGAAACAGGAGGTACAAGG - Intergenic
1004278498 6:14258882-14258904 GAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1004423436 6:15491492-15491514 AGAGAGAAACAGTTGGTGGCTGG - Intronic
1004573825 6:16873544-16873566 AGTGAGAAACAGGAGGAGGATGG + Intergenic
1005025550 6:21459746-21459768 AGGGAGAAAAGGAAGGAGGATGG - Intergenic
1006188301 6:32192522-32192544 GGGGAGAAACTGGTGGGGGAGGG + Exonic
1006206327 6:32346413-32346435 AGGGAGTAAGGAGAGGTGGAAGG - Intronic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006501547 6:34462573-34462595 AGGGAGAGGGAGGAGGTGGGTGG - Intergenic
1006509781 6:34515626-34515648 AGGGAGAACGAGGAAGGGGAAGG - Intronic
1006512692 6:34530212-34530234 AGGGAGATGGGGGAGGTGGAGGG - Intronic
1007035127 6:38666192-38666214 TGGGAGGAACAGGAAATGGAGGG + Intergenic
1007071868 6:39043828-39043850 GAAGAGAAGCAGGAGGTGGAGGG + Intergenic
1007081347 6:39107231-39107253 AGGAAGAAAGAGGAAGTGGACGG - Intronic
1007150970 6:39690565-39690587 AGGGACAGACAGGAGGGAGAAGG + Intronic
1007181357 6:39931650-39931672 AGGGAGAATGAGGGGGAGGAGGG - Intronic
1007291049 6:40787045-40787067 AAGGAGAATGTGGAGGTGGAGGG - Intergenic
1007552744 6:42742743-42742765 AGGCTGAAACAGATGGTGGAGGG + Intergenic
1007619254 6:43201981-43202003 AGGTAGAAGAAGGAGGTGGAAGG + Intronic
1007630227 6:43269421-43269443 AGAGAGAAGGAGGAGGGGGAAGG + Intronic
1007687613 6:43676365-43676387 AGGGAATGGCAGGAGGTGGAGGG - Intronic
1007709789 6:43815217-43815239 AGGCAGCAGGAGGAGGTGGATGG + Intergenic
1007811016 6:44485692-44485714 AGGGAGAAAGACGAGGGGCAGGG + Intergenic
1007871263 6:45041682-45041704 AAGAAGAAAAAGAAGGTGGAAGG - Intronic
1007937027 6:45741578-45741600 GGGCAGAAACAGGAGGGAGAGGG - Intergenic
1008299674 6:49820138-49820160 AGGGAGACAAAGGAGGATGAAGG + Intergenic
1008369552 6:50716473-50716495 AGGGAGAAAAAGAAGAAGGAAGG + Intronic
1008420551 6:51294224-51294246 AGTGAAAATCAGCAGGTGGATGG - Intergenic
1008712936 6:54250703-54250725 AGGGAGAAAATTCAGGTGGATGG - Intronic
1008782427 6:55123700-55123722 AGGTAGAAAAAGGAGCTGGTAGG - Intronic
1008921742 6:56850124-56850146 AGTGAGAAAGGGGAGGTGGAGGG - Intronic
1009286265 6:61822095-61822117 AGGGATAAACACCAGGTGTATGG + Intronic
1009818767 6:68772313-68772335 AGGGAAATACAGAAGATGGATGG + Intronic
1010428276 6:75749553-75749575 TGGGAGAAGCAGGTGATGGATGG + Intronic
1010513980 6:76751393-76751415 AGGGAGAGAAAGCAGATGGAGGG + Intergenic
1010941562 6:81924802-81924824 GTGGAGAAGGAGGAGGTGGAAGG + Intergenic
1010966372 6:82213850-82213872 AGGGAGAGAGAGGAAGAGGAGGG + Intronic
1011260424 6:85464765-85464787 AGGCAGCAACAATAGGTGGATGG + Intronic
1011833760 6:91404657-91404679 GGGGAGAAACAGGCAGTGGGTGG - Intergenic
1012369245 6:98482602-98482624 AGGCAGAAAGAGGATGTGAAGGG + Intergenic
1012528435 6:100205159-100205181 AGAGAAAAAGAGGAGATGGAGGG + Intergenic
1012548453 6:100447419-100447441 ACGGAGAGACAGGAGGCAGATGG + Intronic
1012888187 6:104868719-104868741 AGAGAGAGACAGGAGAGGGATGG - Intergenic
1012992670 6:105941908-105941930 AGTGAGAAAAAGGAGAGGGAGGG + Intergenic
1013055207 6:106576238-106576260 GGGGTGAGACAGGAGGGGGATGG + Intronic
1013059184 6:106615196-106615218 GGGAAGAAACAGGTGGTGGTGGG + Intronic
1013227664 6:108132131-108132153 AGGGGGACAGAGGAGCTGGATGG + Intronic
1013325234 6:109039078-109039100 AGGGAGGAAAAGGAGAAGGAGGG + Intronic
1013420983 6:109966613-109966635 AGCCAGAAACAGGAAGGGGAAGG + Intergenic
1013841400 6:114399117-114399139 AGGGAGAAGAAGGAGGAAGAAGG - Intergenic
1013858789 6:114608586-114608608 AGTGTGAAATAGGAGGTAGAAGG + Intergenic
1014273851 6:119365021-119365043 AGGGAGAAAGTGGAAGTGGCTGG - Intergenic
1014313156 6:119830557-119830579 AGGGAGGATCAGGTGGTGGGTGG + Intergenic
1015561922 6:134525274-134525296 AAGGAGAAAGAGGAGGAGGAGGG + Intergenic
1015684947 6:135849344-135849366 AAGAAGAAACAGGAGAGGGAAGG - Intergenic
1015804238 6:137092365-137092387 GGAGAGAAACAGGAGGAGGAAGG - Intergenic
1015812878 6:137178921-137178943 ATGGAGACACAGTAGGTGCAGGG + Intergenic
1016277009 6:142365685-142365707 AGGGAGGAAGAGCAGGAGGAGGG + Intronic
1016828819 6:148413456-148413478 AGGGAGAAAGGGGAGGAGGAAGG + Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017462952 6:154668337-154668359 AGGAAGAAAAAGAAGGAGGAGGG + Intergenic
1017462963 6:154668398-154668420 AAGAAGAAAGAGGAGGAGGAAGG + Intergenic
1017572900 6:155766529-155766551 AGGGAGAGACCGAAGGAGGAAGG - Intergenic
1017593715 6:156006007-156006029 AGAGAGATAAAGGAGGAGGAGGG + Intergenic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018226031 6:161629590-161629612 AGGGCAAGACAGGAGGTGGGAGG - Intronic
1018365173 6:163112561-163112583 AAGGAGAAAAATGAGGGGGAAGG - Intronic
1018401367 6:163423973-163423995 AGTGACACCCAGGAGGTGGATGG + Intronic
1018434950 6:163751403-163751425 AGGGAGGAGGAGGAGGTGGGAGG - Intergenic
1019192591 6:170261851-170261873 ATGGAGAATCAGCAGGTGCACGG + Intergenic
1019247758 6:170720486-170720508 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1019351812 7:557558-557580 AGGGAGAAACAGGATGGACATGG + Intronic
1019419226 7:942940-942962 AGGAAGAGAGAGGAGGAGGAAGG + Intronic
1019419293 7:943215-943237 AGGAAGAGAGAGGAGGAGGAAGG + Intronic
1019520461 7:1458608-1458630 TGGGAGCAGCAGGAGGTGGCAGG - Intronic
1019919978 7:4157310-4157332 AAGGAGGGACGGGAGGTGGAAGG + Intronic
1019941857 7:4298206-4298228 AGGGAGAAAAGGGAGAAGGAAGG - Intergenic
1019963948 7:4483907-4483929 AGAGAGAAAGAGGAGAGGGAGGG + Intergenic
1020474416 7:8579089-8579111 AGGGAGAAACGTGAAGTGCAAGG + Intronic
1021467339 7:20959997-20960019 AGGAAGAAACAGAAGGAGGGAGG - Intergenic
1021562261 7:21980228-21980250 ATGGAGAAAGAGGTGGTGAATGG + Intergenic
1021622445 7:22562209-22562231 GGGGAGGAAGAGGAGGCGGAAGG - Intronic
1021642111 7:22748212-22748234 ATGGAGAAATAAAAGGTGGATGG + Intergenic
1022274967 7:28846240-28846262 AGGGAGGAAGGGGATGTGGAGGG + Intergenic
1023567813 7:41540940-41540962 AGGAAGAAACAGGAGGAGGCTGG + Intergenic
1023769084 7:43538248-43538270 AGGGAGAAACTGGATGAGGGAGG + Intronic
1024174788 7:46827875-46827897 AGGGAGAATCTGGTGGTGGGTGG - Intergenic
1024222198 7:47297649-47297671 GGGGAGAAACAGGCAGTGGGAGG + Intronic
1024471368 7:49771034-49771056 AGGGAGAAAGGGGAGAAGGAGGG + Intergenic
1024515061 7:50242386-50242408 AGAGAGAAAGAGGGGGAGGAAGG + Intergenic
1024978569 7:55136384-55136406 AGGGAGATAGAGGAGGAGGTGGG - Intronic
1025134497 7:56399249-56399271 GGAGGGAAAGAGGAGGTGGAGGG - Intergenic
1025199865 7:56955528-56955550 AGGGAGACTAAGGAGGTGGGAGG - Intergenic
1025672081 7:63621404-63621426 AGGGAGACTAAGGAGGTGGGAGG + Intergenic
1025807519 7:64849467-64849489 AGGGAGAATCAGGTGGTGAGTGG + Intergenic
1025898490 7:65725162-65725184 AGAGAGACACAGTCGGTGGATGG - Intergenic
1026139146 7:67690164-67690186 AGGCAAAAACAAGAAGTGGAAGG - Intergenic
1026638649 7:72105800-72105822 AGGGAGGAGGAGGAGGGGGAGGG + Intronic
1026864844 7:73817251-73817273 AGAGGGCAACTGGAGGTGGAGGG - Intronic
1026917452 7:74129504-74129526 AGGAAGAAGGAGGAGGAGGAGGG + Intergenic
1027304201 7:76875505-76875527 AGGGAGACACAGGATGAGAAAGG + Intergenic
1027440725 7:78216637-78216659 AAGGAGAAACAGGAGTTAGCTGG - Intronic
1027463513 7:78485516-78485538 AAGGAGAAACAGGACATGGATGG - Intronic
1027609709 7:80345459-80345481 ATGGAGACTCAGAAGGTGGAGGG + Intergenic
1027813045 7:82930298-82930320 AGGGAGAAACAGCATTAGGAGGG + Intronic
1028134263 7:87209949-87209971 AGAGAGACAGAGGAGGGGGAGGG + Intronic
1029372577 7:100158707-100158729 GGAGAGAAACAGGAAGCGGAAGG + Intronic
1029410096 7:100403967-100403989 TGGGAGAAACAGAATGGGGAGGG - Intronic
1029653973 7:101912244-101912266 ATGGAGATAGAGGAGGAGGAGGG - Intronic
1030148816 7:106382401-106382423 GAGGAGAAAGAGGAGGCGGAGGG + Intergenic
1030538449 7:110798645-110798667 AGGAAGAAAGCGGGGGTGGAGGG + Intronic
1030545655 7:110892079-110892101 GTTGAGAAACAGGAGGTGGAAGG - Intronic
1030767742 7:113432467-113432489 AGAGAGATGCAGAAGGTGGAGGG - Intergenic
1031106858 7:117554433-117554455 TGGGAGAAACAGGTTTTGGATGG + Intronic
1031589878 7:123577755-123577777 ATGAAGAAACATGAGCTGGATGG - Intronic
1031649840 7:124275281-124275303 AAGGAGAAACAGGAAGTTGATGG + Intergenic
1031898963 7:127389151-127389173 AGGGAGAGAGAGTAAGTGGAAGG + Intronic
1031927636 7:127652944-127652966 AGGTCGACACAAGAGGTGGAGGG - Intronic
1032473074 7:132192394-132192416 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1033595227 7:142854552-142854574 AAGGAAAAGCAGGGGGTGGAGGG - Intergenic
1033962109 7:146928033-146928055 AGGTAGAAACAGGAGGATGGAGG - Intronic
1034277269 7:149829401-149829423 AGGGGGACACAGGAGGAGGAGGG - Intergenic
1034277329 7:149829592-149829614 GGGAGGACACAGGAGGTGGAGGG - Intergenic
1034277631 7:149830602-149830624 GGGGAGGCACAGGAGGAGGAGGG - Intergenic
1034417352 7:150972069-150972091 AGGGAGAGACATGAGGTGCCTGG - Intronic
1034450543 7:151134924-151134946 ATGGAGATAGGGGAGGTGGAAGG + Intronic
1034545466 7:151786020-151786042 AGGGTGCAACACGAGGTGGAAGG + Intronic
1035029495 7:155848273-155848295 AGGGAAGAACAGGAGGTGCCTGG + Intergenic
1035111228 7:156483713-156483735 AGGGGGAGACAGGAGGGGGAGGG + Intergenic
1035356807 7:158280588-158280610 AGAGAGAACCAGGAGATGAAAGG + Intronic
1035375189 7:158402885-158402907 AGGGAGAATCATGGGGTGCAGGG + Intronic
1035500345 8:87328-87350 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
1035500378 8:87450-87472 AGGGAGAAAGGAGAGGGGGATGG - Intergenic
1035737421 8:1898647-1898669 AGGCAGTTACAGGAGGTGGAGGG + Intronic
1035823773 8:2622814-2622836 AGAAAGAAACTGGAGGTAGATGG - Intergenic
1036059615 8:5301375-5301397 TTGGAGAAAGAGGTGGTGGAGGG + Intergenic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036442393 8:8793025-8793047 AGGGAGAAACAGGAGCTGAGTGG - Intronic
1036768007 8:11561052-11561074 AGCGAGAACGAGGAGGGGGAGGG + Intronic
1036916640 8:12810716-12810738 AGGGAGAAGAAGGAAGGGGAGGG - Intergenic
1036916649 8:12810753-12810775 GGGGAGAAAGAGGAGGAGGTAGG - Intergenic
1037200322 8:16244595-16244617 AGGGAGAAACTGGAATGGGAGGG - Intronic
1037745711 8:21642567-21642589 AGAGAAAAGCAGGAGGTGAAAGG + Intergenic
1037766569 8:21775834-21775856 AGTGAATAACAGGAGATGGATGG + Intronic
1037788591 8:21918095-21918117 AGGGAGAAACACGGGGAGGTTGG + Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1037947527 8:22998948-22998970 AGGAGGCAACAGGAGGGGGATGG + Intronic
1038284965 8:26198493-26198515 AGGAAGAAGAAGGAGGAGGAGGG - Intergenic
1038428528 8:27481263-27481285 AGGGAGTGTCAGGAGGTGGAGGG + Intergenic
1038483665 8:27918890-27918912 GGGAAGAAAGAGGAGGAGGAAGG + Intronic
1038779211 8:30556504-30556526 CAGGAGACACAGGAGGGGGAGGG - Intronic
1038958063 8:32488745-32488767 ATGGAGAGACAGTGGGTGGAGGG + Intronic
1039000967 8:32979759-32979781 AGGGAGGATCAGGTGGTGGGTGG + Intergenic
1039030149 8:33299803-33299825 AGGGAGAATCAGGAAGTGGTTGG - Intergenic
1039048092 8:33468293-33468315 AGGGAGAGGGAGGAGGAGGAGGG - Intronic
1039122817 8:34167922-34167944 AGGGAGAAAGAGCAAGTGCAAGG - Intergenic
1039291082 8:36095126-36095148 AGGGGGACTCAGGAGGAGGAAGG + Intergenic
1039449375 8:37659467-37659489 GGGGAGGAAGAGGTGGTGGATGG - Intergenic
1039466620 8:37789241-37789263 GGGGAGGAACAGGAGGAGGAAGG + Intronic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1039950187 8:42164935-42164957 AGGGAGAGAGAGGAAGGGGAGGG + Intronic
1041098131 8:54369856-54369878 AGGGAGAAAAAAGAGAGGGAGGG - Intergenic
1041108383 8:54463306-54463328 AAAGAGGAACAGGAGGAGGAAGG - Intergenic
1041291170 8:56310133-56310155 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041291181 8:56310165-56310187 AGGGAGGAGGAGGAGGAGGAAGG + Intronic
1041573906 8:59370939-59370961 AGATAGAAAGATGAGGTGGAAGG - Intergenic
1041637132 8:60156634-60156656 AGGGAGGAACTGGTGGTGGGCGG - Intergenic
1041916757 8:63146271-63146293 AGGTGGAATCAGGAGGAGGAGGG + Intergenic
1042020548 8:64369304-64369326 AGGGAGAAAGGGGAGGGGGGAGG + Intergenic
1043161479 8:76852933-76852955 AGGGAGGAGGAGGAGGTGGCGGG - Exonic
1044191033 8:89317749-89317771 AGGGAGCAAGAGGAGATGAAGGG - Intergenic
1044889893 8:96823230-96823252 AGGGAGAAAATGGAAATGGAGGG + Intronic
1044907274 8:97017852-97017874 GGGGAGGAACAGGTGGTGGGTGG - Intronic
1045338736 8:101233011-101233033 GGGGAGAAAGTAGAGGTGGAGGG + Intergenic
1045366593 8:101482121-101482143 ATGGATAAAAAGGAAGTGGAGGG - Intergenic
1045377217 8:101586048-101586070 AAAAAGAAACATGAGGTGGAAGG - Intronic
1046057663 8:109097990-109098012 AGGGAGATACTGGATGTGGGAGG - Intronic
1046214205 8:111120616-111120638 AGGGAGAAAGAAGAGGAGAAAGG + Intergenic
1046451849 8:114402925-114402947 AGAGAGGAAGAGGAGGAGGAGGG - Intergenic
1046710250 8:117503293-117503315 AGGAAGAAGAAGGAGGAGGAGGG + Intergenic
1046782440 8:118230100-118230122 AGGGAGTAAAAGGAGTAGGAGGG + Intronic
1047800209 8:128301286-128301308 AGGGAAAAGGAGGAGGTGGAGGG + Intergenic
1048026211 8:130589319-130589341 ATGGAGAATGAGGAGATGGAGGG - Intergenic
1048165607 8:132059061-132059083 AGGGAGAAAGAGAGGGTAGAAGG - Intronic
1048179207 8:132179995-132180017 GAGGAGAAACAGGAAGTGGCGGG - Intronic
1048219048 8:132524788-132524810 AGGGATGAAGAGGAGGCGGAGGG - Intergenic
1048860451 8:138720772-138720794 AGGGAGAACCAGGAGAAAGAGGG - Exonic
1049059424 8:140264583-140264605 AGAGAGAGAGAGGAGGGGGAGGG + Intronic
1049311740 8:141937228-141937250 AAGGAGAAAGAGGACCTGGAAGG + Intergenic
1049361054 8:142212804-142212826 AGGGAGGGACAGGGGGGGGAAGG - Intronic
1049614179 8:143569070-143569092 AGGGAGAAACTGGAGGGGCGGGG + Intronic
1049614240 8:143569236-143569258 AGGGAGAAACAGGAGGGGCGGGG + Intronic
1049997850 9:1048229-1048251 GAGGAGAAACAGGAGGAGAAAGG - Intergenic
1050033985 9:1415618-1415640 TGGGAGCAGGAGGAGGTGGAAGG + Intergenic
1051011007 9:12414427-12414449 AGGGAGAAAGAGTTGGGGGAGGG - Intergenic
1051129271 9:13841345-13841367 AGGGAGAGAAAGGAGGAGGGAGG + Intergenic
1051190985 9:14512731-14512753 AGAGAGAAAAGGGAGGTGGAAGG - Intergenic
1051257748 9:15232350-15232372 AGGTGGAAACGGGAGGTGGGGGG + Intronic
1051355422 9:16235689-16235711 AGCTAGAAACAGGAAGAGGAAGG - Intronic
1051513629 9:17906519-17906541 GGGGAGGAGCAGGAGCTGGAGGG + Intergenic
1051560624 9:18436897-18436919 AGGCAGGAGCAGTAGGTGGAGGG + Intergenic
1051848912 9:21486320-21486342 AAGAAGAAGCAGGAGGTGGTAGG - Intergenic
1051922456 9:22283925-22283947 AGGGAGAAAGTGGAGATGGGAGG + Intergenic
1051953549 9:22662985-22663007 AGGGAGGAATGGAAGGTGGAAGG + Intergenic
1052983465 9:34466913-34466935 AGGGAGAACCAGCAGTTGGATGG - Intronic
1053647289 9:40130960-40130982 TGGCAGATACAGGAGGAGGATGG - Intergenic
1053758437 9:41332883-41332905 TGGCAGATACAGGAGGAGGATGG + Intergenic
1054328289 9:63728916-63728938 TGGCAGATACAGGAGGAGGATGG - Intergenic
1054537290 9:66245210-66245232 TGGCAGATACAGGAGGAGGATGG + Intergenic
1054916335 9:70498234-70498256 AGGAGGAAACTGGAGGGGGATGG + Intergenic
1054928618 9:70613664-70613686 AGGCAGAAACAGCAGGGAGAAGG - Intronic
1054991453 9:71331869-71331891 AGGAAGAAAGAGGAGGAAGAAGG + Intronic
1055565851 9:77568004-77568026 AGGGAGGAAGAGGAGGAGGAAGG + Intronic
1055716407 9:79122756-79122778 AAGGAGAAGAAGGAGGAGGAGGG + Intergenic
1055717820 9:79137717-79137739 AGGGAGGAAAAGGAGGTAGAGGG - Intergenic
1056146103 9:83730895-83730917 AAGGAGAAAGAGGAGGAGAAGGG + Intergenic
1056300889 9:85239661-85239683 AGGGATAAACAAGGGGTAGATGG + Intergenic
1056545054 9:87606478-87606500 AGGGAGAGACAGAGGGAGGAAGG - Intronic
1057031987 9:91783090-91783112 AGGGACAATGAGGAGATGGAAGG - Intronic
1057130598 9:92651662-92651684 AGGGAGGAGCTGGAGGTGGAGGG - Intronic
1057490081 9:95513790-95513812 GGGAGGAAACAGAAGGTGGAAGG - Intronic
1057953868 9:99391719-99391741 AGAGATTAACAGGAGGTGGCAGG - Intergenic
1058148468 9:101437542-101437564 ATGGAGGAACAAGAGGTGGATGG + Intergenic
1058553226 9:106138134-106138156 AGGCAGAAGGAGGAGGTGGAAGG - Intergenic
1058561449 9:106233207-106233229 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1058561462 9:106233272-106233294 AGGAAGAAAGAGGAGGAAGAAGG - Intergenic
1058901542 9:109446629-109446651 CTGGAGAAAGAGGAGGTGAATGG + Intronic
1059259398 9:112961500-112961522 TGGGAGAAGCAGGAGGTAGAGGG - Intergenic
1059431205 9:114251406-114251428 AGGGAGGAGGAGGAGGAGGAAGG - Intronic
1059585066 9:115597163-115597185 AAGGAGAAAGAGGAGGAGGAGGG - Intergenic
1060489435 9:124071712-124071734 AGGGAGGAAGAGGAGGAAGAGGG - Intergenic
1060548923 9:124476171-124476193 AGGGGCACACAGGAGGTGGCTGG - Intronic
1060636828 9:125205956-125205978 ACGGAGAGTCAGGAGGTGGCTGG + Intronic
1061026827 9:128055296-128055318 AGGGAGAGAGAGGAAGGGGAGGG + Intergenic
1061035711 9:128113320-128113342 GGGGAGAAAGAGAAGATGGATGG - Intergenic
1061134604 9:128726229-128726251 AGGGAGAATGAGGGAGTGGAGGG + Intergenic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061450334 9:130664047-130664069 AAGGAAAAACAGGAGGGGGGAGG + Intergenic
1061727718 9:132590482-132590504 ATGGAGACAGAGGAGGAGGAGGG - Intergenic
1061869911 9:133515119-133515141 AGGGAGAAAGTGGAGGAGGGAGG - Intronic
1062086028 9:134648952-134648974 ACGGAGGTCCAGGAGGTGGATGG + Intronic
1062089723 9:134669141-134669163 AGGAAGGAAGAGTAGGTGGAAGG - Intronic
1062165897 9:135107059-135107081 AGGGAGTGACATGAGGTTGATGG + Intronic
1062469707 9:136697013-136697035 AGGGGGAAGGAGGAGGAGGAGGG - Intergenic
1062469743 9:136697082-136697104 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062469753 9:136697101-136697123 AGGGGGAAGGAGGAGGGGGAGGG - Intergenic
1062480942 9:136751034-136751056 AGGGAGAAATGGGAGGGGAAGGG + Intergenic
1062564527 9:137158269-137158291 AGGGAGAAGGAGCAGGGGGAAGG + Intronic
1062564534 9:137158295-137158317 AGGGAGAAGCAGCAGGGGGAAGG + Intronic
1062638360 9:137503426-137503448 AAGGAGAATGAGGAGGGGGAAGG + Intronic
1062638367 9:137503445-137503467 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638374 9:137503464-137503486 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638381 9:137503483-137503505 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638386 9:137503502-137503524 AAGGAGAAGGAGGAGGAGGAAGG + Intronic
1062638393 9:137503521-137503543 AAGGAGAAGGAGGAGGGGGAAGG + Intronic
1062638418 9:137503617-137503639 AGGGAGAAGGAGGAGGGAGAAGG + Intronic
1202795078 9_KI270719v1_random:114257-114279 TGGCAGATACAGGAGGAGGATGG - Intergenic
1203774287 EBV:64052-64074 GGGAGGAAACAGGAGGAGGAGGG + Intergenic
1203608529 Un_KI270748v1:75966-75988 AGGGAGAAAGGAGAGGGGGATGG + Intergenic
1185459839 X:328886-328908 AGGGGGAGAGAGGAGGGGGAGGG - Intergenic
1185459862 X:328929-328951 AGGGGGAGAGAGGAGGAGGAGGG - Intergenic
1185499060 X:583999-584021 AGGGAGACAGAGGAGGAGGAGGG + Intergenic
1185499089 X:584120-584142 AGGGAGGAAGAGGAGGAGGCTGG + Intergenic
1185499114 X:584220-584242 AGGGAGGAAGAGGAGGAGGCTGG + Intergenic
1185499142 X:584320-584342 AGGGAGGAAGAGGAGGAGGCTGG + Intergenic
1185575491 X:1169031-1169053 AAAGAGAAGGAGGAGGTGGAGGG + Intergenic
1185662057 X:1735656-1735678 GGAGAGAAAGAGGAGGAGGAGGG - Intergenic
1185662081 X:1735760-1735782 AGGGAGAAAGAGGAGGAGGGAGG - Intergenic
1185701178 X:2231545-2231567 AGAGAGAAAAAGGAAGAGGAAGG - Intronic
1185747730 X:2585240-2585262 AGGGACAAACGTGGGGTGGAGGG - Intergenic
1185803289 X:3032598-3032620 AGGGAGAGACAGAAGAGGGAGGG + Intronic
1186137021 X:6532773-6532795 AGGGAGGAAGAGGAGGTGTGTGG - Intergenic
1186137161 X:6533172-6533194 AGGGAGGAAGAGGAGGTGTGTGG - Intergenic
1186137237 X:6533389-6533411 AGGGAGGAAGAGGAGGTGTGTGG - Intergenic
1186239999 X:7555444-7555466 AGGGAGGAAGAGAAGGAGGAAGG + Intergenic
1186267168 X:7844250-7844272 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186297735 X:8169155-8169177 AGGGAGGAAGAGGAGGTGTGTGG - Intergenic
1186324863 X:8466584-8466606 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186324873 X:8466613-8466635 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186324916 X:8466734-8466756 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186324926 X:8466763-8466785 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186324936 X:8466792-8466814 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186324958 X:8466854-8466876 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186325027 X:8467042-8467064 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186325039 X:8467075-8467097 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186325108 X:8467279-8467301 AGGGAGGAAGAGGAGGTGTGTGG + Intergenic
1186471161 X:9823081-9823103 AGGGAGAAGGAGGAGGAGAAGGG - Intronic
1187025747 X:15433932-15433954 AGGAAGAAGGAGGAGGAGGAAGG + Intronic
1187025821 X:15434334-15434356 AACGAGAAAAAGGAGGGGGAAGG + Intronic
1187245872 X:17552527-17552549 AGGGAGAAAGAAGATGAGGAAGG + Intronic
1187477018 X:19620283-19620305 GGGAAGGAACAGGAGGTGAAGGG + Intronic
1187579966 X:20596875-20596897 AGGGAGAGGCAAGAAGTGGAAGG + Intergenic
1189136649 X:38557431-38557453 AGGGGGTAACAGTAGGAGGAGGG + Intronic
1189915813 X:45854965-45854987 AGAGAGAAAGAGGGGGAGGAGGG + Intergenic
1190113215 X:47608625-47608647 AGGGAGCAACAGGAGGGAGGGGG + Intronic
1190170290 X:48107099-48107121 AGGCTGAGGCAGGAGGTGGAAGG - Intergenic
1190188202 X:48254463-48254485 AGGCTGAGGCAGGAGGTGGAAGG - Intronic
1190427250 X:50345255-50345277 AGGGAGGAAAAGCAGGAGGAAGG - Intronic
1190657096 X:52622227-52622249 AGGCTGAGGCAGGAGGTGGAAGG - Intergenic
1190718389 X:53124577-53124599 ATGGAGAAGCAGGAGTTAGAGGG - Intergenic
1191691687 X:63945790-63945812 TGGGAGAAACAAGAGGTGAAGGG + Intergenic
1191780213 X:64856521-64856543 GGTGAGAAAGAGTAGGTGGATGG - Intergenic
1191836619 X:65470205-65470227 GTGGAGAAAAAGGAGGTGGAGGG + Intronic
1192146423 X:68686001-68686023 GGGGGCAGACAGGAGGTGGAGGG + Intronic
1192550542 X:72049827-72049849 AGTGAGTGACACGAGGTGGATGG - Intergenic
1192624829 X:72715682-72715704 AGAGAGCAACAGGTGGGGGATGG - Intergenic
1193696525 X:84713378-84713400 AGGGAGATACAGGAGAGGGAAGG - Intergenic
1194365806 X:93012175-93012197 AGGAAGAAAGAGGAAGTGGGAGG - Intergenic
1195075905 X:101326840-101326862 GGGGAGGAACAGGTGGTGGGCGG - Intergenic
1195107656 X:101616499-101616521 AGTGAGAAGCTGGAGGAGGAGGG - Exonic
1196087857 X:111705885-111705907 AGGGAAAATCAGGAGAAGGAGGG - Intronic
1196619809 X:117808639-117808661 AGGGAGGATCAGGTGGTGGGTGG - Intergenic
1196776833 X:119345895-119345917 AGGCAGAAACAAGAGGATGAAGG + Intergenic
1196834516 X:119802066-119802088 AAAGAGAAAAAGGAGGAGGAAGG - Intergenic
1196887573 X:120262634-120262656 AGGGAGGGAGAGGAGGAGGAAGG - Intronic
1196948245 X:120850116-120850138 GGGGAGGAACAGGTGGTGGGCGG + Intergenic
1197243716 X:124146925-124146947 AGGTAGCCACAGGATGTGGATGG + Intronic
1197256969 X:124273912-124273934 AGAGAGAAACATGAGTTGAAGGG + Intronic
1197770649 X:130087039-130087061 GGGGAGGAAGAGGAGGGGGAGGG + Intronic
1197818740 X:130524729-130524751 AGAGAGAAAGAGGAAGAGGAGGG - Intergenic
1197821169 X:130542333-130542355 AGGGAGACACAGAAGGGAGATGG - Intergenic
1197980837 X:132217415-132217437 AGGAAGTTACAGGAGGGGGAGGG + Exonic
1198708721 X:139478047-139478069 AGGGAAAGAGAAGAGGTGGAAGG + Intergenic
1198761238 X:140034719-140034741 AGGGAAAAACAGAAGAGGGAAGG + Intergenic
1199452957 X:147993906-147993928 TGGGAGAATCTGGAGGAGGAGGG - Intronic
1199497720 X:148471719-148471741 AGCAAGAAAGAGGAGCTGGATGG + Intergenic
1199600947 X:149540683-149540705 AGGGAGGAAGAGTAAGTGGAAGG - Exonic
1200087444 X:153614660-153614682 AGAGAGAAGGAGGAGGTGGGTGG - Intergenic
1200155014 X:153970587-153970609 AGGGAGAGGGAGGAGATGGAGGG + Intronic
1200674028 Y:6128422-6128444 AGGAAGAAAGAGGAAGTGGGAGG - Intergenic
1201300192 Y:12498550-12498572 AGGGAGGAAGAGGAGGAAGAGGG - Intergenic
1201438471 Y:13985084-13985106 AGGGAGGAACAGAAGGTGGGTGG - Intergenic
1201438558 Y:13985375-13985397 AGGGAGGAAGAGGTGGTGGGTGG - Intergenic
1201438758 Y:13986105-13986127 AGGGAGAAGCAGTTCGTGGAGGG - Exonic
1201445815 Y:14056603-14056625 AGGGAGAAGCAGTTCGTGGAGGG + Exonic
1201446015 Y:14057333-14057355 AGGGAGGAAGAGGTGGTGGGTGG + Intergenic
1201446102 Y:14057624-14057646 AGGGAGGAACAGAAGGTGGGTGG + Intergenic
1201719259 Y:17078912-17078934 AGGGAGAAACAAGAAGTGTATGG + Intergenic
1201719279 Y:17079025-17079047 AGGGAGAAACAAGAAGTGTGTGG + Intergenic
1202186937 Y:22195572-22195594 AAGGATAATCAGGAGTTGGAAGG + Intergenic
1202204423 Y:22390824-22390846 AAGGATAATCAGGAGTTGGAAGG - Intronic