ID: 1001311702

View in Genome Browser
Species Human (GRCh38)
Location 5:170615643-170615665
Sequence CTGTTACCATGGCAAGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001311702 Original CRISPR CTGTTACCATGGCAAGTGGA GGG (reversed) Intronic
900710423 1:4109792-4109814 CTGTCACCAGGGCGAGCGGATGG - Intergenic
902125230 1:14203900-14203922 CTGTCACCGTGGGAAATGGATGG + Intergenic
903561842 1:24233901-24233923 CAGTCATGATGGCAAGTGGAGGG + Intergenic
905111471 1:35597740-35597762 CTTTGACCATGGGAAGTTGAGGG + Intergenic
907804024 1:57800547-57800569 GTGTTACCATCGCATGGGGAAGG - Intronic
913488444 1:119355701-119355723 CTGTTAAACTGGCAAGTGGCTGG - Intergenic
914089654 1:144485191-144485213 CTGTTGCCATAGCAATTGGGTGG + Intergenic
914308959 1:146449025-146449047 CTGTTGCCATAGCAATTGGGTGG - Intergenic
914593154 1:149124106-149124128 CTGTTGCCATAGCAATTGGGTGG + Intergenic
915195137 1:154183404-154183426 GTGTTACCATGGTAACTGGGCGG + Intronic
915896416 1:159814594-159814616 CTGTTACCATGATAAGTGCAGGG + Intronic
918764367 1:188459543-188459565 CTGTTACCATATCAAGGGCAAGG - Intergenic
924227562 1:241934344-241934366 GTGCTGCCATGGCAACTGGAGGG + Intergenic
1063524835 10:6775351-6775373 CTTTTACCAGGGCATGTGGTGGG - Intergenic
1063866064 10:10366918-10366940 CTGTCCCCATGGCCAGGGGATGG + Intergenic
1064541083 10:16405923-16405945 CTGTTCCCAGGGCAGGGGGAGGG + Intergenic
1065571211 10:27072487-27072509 ATGCTACCATGGCAGGTGGAGGG - Intronic
1067164849 10:43857140-43857162 CAGTTACCATTGCTAGTGGGAGG + Intergenic
1067718255 10:48705993-48706015 CTGTTACCATGGCTTGGGGCTGG + Intronic
1068901665 10:62276667-62276689 CTCTGCCAATGGCAAGTGGAAGG - Intergenic
1069275617 10:66587475-66587497 GTGCTACCAGGGCAGGTGGAGGG + Intronic
1069398672 10:68018239-68018261 CTGTTAACATGGCATATTGATGG - Intronic
1069782775 10:70967313-70967335 TTATTACCATGGCAAGTGGAGGG + Intergenic
1073730452 10:106281373-106281395 CTGTTGCCATGGAAGGAGGACGG + Intergenic
1074833994 10:117271844-117271866 CTGTTATCATGGCAACAGAATGG - Intronic
1075185479 10:120252253-120252275 CAATTACCATGGCAAGTAGCTGG - Intergenic
1076320275 10:129574939-129574961 CTGATACCAGGGAAAGTGAAAGG + Intronic
1078791746 11:14549868-14549890 CTGCTCCAATGGCAAGAGGATGG + Intronic
1083131874 11:60632491-60632513 CTGCTACCAAAGCGAGTGGAAGG - Intergenic
1083271113 11:61573084-61573106 CTGTCTCCATGGCAACTAGACGG - Intronic
1084689709 11:70718014-70718036 CTGGTACAGTGGGAAGTGGAAGG - Intronic
1091955989 12:4643633-4643655 ATTTTCCCATGGCAAGTAGAAGG + Intronic
1092238575 12:6824231-6824253 CTCCTACCATCGCATGTGGATGG + Exonic
1093693250 12:22131174-22131196 CTGCTACCATGGAACCTGGAAGG + Intronic
1095554314 12:43482680-43482702 ATGCTACCAGGGCAGGTGGAGGG - Intronic
1095687525 12:45051675-45051697 CTGTTATCAGGGTCAGTGGAAGG + Intergenic
1096243278 12:49970763-49970785 CTGCTACCATGACAAGTTCATGG - Intronic
1096975184 12:55695693-55695715 CTGTCACCATGGCATATGGTGGG + Intronic
1097291294 12:57917840-57917862 CTGTTTTCATGGCTAGAGGAGGG + Intergenic
1098166790 12:67706620-67706642 CTATTCCTATGGCAACTGGATGG - Intergenic
1099375457 12:81892574-81892596 CTGTTACCATGGTAAAAGGCGGG - Intergenic
1100891104 12:99126867-99126889 ATGTTAACAGGGCTAGTGGATGG + Intronic
1105655409 13:22432141-22432163 CTGTTTCCTTGGCTAGTAGATGG + Intergenic
1106843862 13:33716429-33716451 CTGTTACCATGGAAATTCAAAGG + Intergenic
1107974727 13:45678420-45678442 CTGATACCATTTCAAGTTGAGGG + Intergenic
1108139429 13:47403448-47403470 CTCTAACCATGGGATGTGGAAGG + Intergenic
1109844215 13:67963400-67963422 AAGTTATCATGGCATGTGGAAGG - Intergenic
1112422028 13:99261102-99261124 CTGTTAGCATAGCAAGTGTGAGG + Intronic
1114353680 14:21883361-21883383 CTGTTTTCATGGAATGTGGAAGG + Intergenic
1115880936 14:37918130-37918152 CTGTCACCATGGCAATTAAATGG - Intronic
1118077524 14:62316827-62316849 GTGTTACCATGACATATGGAAGG + Intergenic
1119788484 14:77329503-77329525 CTGTCACCGTGGCCAGTGGCAGG + Intronic
1121110718 14:91311051-91311073 CGGTTGCCATGGCAGGTGAAAGG - Intronic
1122302434 14:100738779-100738801 CACTTCCCATGGCAGGTGGACGG + Intergenic
1202841602 14_GL000009v2_random:126137-126159 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1202910989 14_GL000194v1_random:116369-116391 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1202881629 14_KI270722v1_random:66291-66313 CTGTTTCCATGGCAAGGGGTGGG + Intergenic
1124099575 15:26680946-26680968 CTGCTACAATTGCAAGAGGAAGG - Intronic
1129107295 15:73318979-73319001 CTGTTTCCATGGCAACTGGCCGG - Intergenic
1131310502 15:91286188-91286210 CTGTGACATTGGCAAGTGCATGG + Intronic
1133707227 16:8366330-8366352 TTGTTAACATGGCAATTGGAGGG + Intergenic
1135833167 16:25796851-25796873 CTTTTGCCATGGCAAGGGGTGGG + Intronic
1137019241 16:35407167-35407189 CTGTTACCATGGAGGCTGGAAGG - Intergenic
1143155290 17:4832875-4832897 CTGTTGCCATAGCAATTGGGTGG + Intergenic
1143252285 17:5532682-5532704 CTGTTGTCTTGGCAAGAGGAGGG + Intronic
1143637806 17:8176405-8176427 CGGTTACCAAGGCAACTGGGCGG - Intergenic
1144082113 17:11772921-11772943 CTGTGAACAAGGCAAGAGGAAGG - Intronic
1144637255 17:16918212-16918234 CTGAGAACATTGCAAGTGGATGG + Intergenic
1146253589 17:31374042-31374064 CTGTTACAGTGGCCAGTGGTAGG - Exonic
1146892513 17:36515080-36515102 CTGTTGCCCTGGCTAGTGGGAGG - Intronic
1148876576 17:50690805-50690827 CTGTGACCCCGGCAAGGGGAAGG + Intronic
1150386259 17:64763825-64763847 CTGTCACCATGGCTAGCTGAAGG + Intergenic
1151220131 17:72606000-72606022 CTCTTCCCATGGCCAGTGGGGGG - Intergenic
1154323722 18:13374978-13375000 CTGTTTCCATGGGAACAGGAAGG - Intronic
1154323738 18:13375057-13375079 CTGTTTCCATGGGAACTAGAAGG + Intronic
1155483229 18:26312414-26312436 CTGTAACCATGGTAACTAGAGGG + Intronic
1157423129 18:47562753-47562775 CTGGTACCATGGCAAATGGAGGG - Intergenic
1157773422 18:50371169-50371191 CTGTGAACTTGGAAAGTGGATGG - Intergenic
1160729358 19:633728-633750 CTGTTGCCGTGGCAACTGGGAGG + Intergenic
1161990092 19:7679844-7679866 CTGTTACTGGGGCAAGGGGAGGG + Intronic
1162758646 19:12875047-12875069 TGGTTACCATGGAGAGTGGAGGG + Intergenic
1163451366 19:17379274-17379296 CTGTTACCCTGGCTAATGGGGGG - Intergenic
1202657237 1_KI270708v1_random:35388-35410 CTGTTTCCATGGCAAGGGGTGGG + Intergenic
926370118 2:12170915-12170937 CTGTTTCCATGCCAACTGGGTGG + Intergenic
927629947 2:24764470-24764492 CAGTTACCAAGGCAAAGGGAAGG + Intronic
929538154 2:42798033-42798055 ATGGTACCATGGCCAGTGAAAGG - Intergenic
931906982 2:66853191-66853213 CTGTGACAATGGGAAGCGGAAGG - Intergenic
932452841 2:71826571-71826593 CTGTTCCCCTGGAAAGTGGCAGG - Intergenic
932583070 2:73005120-73005142 CTGGTACCAAGGAAAGTGGAAGG + Intronic
932612208 2:73208263-73208285 CTGTTACCTGGCCAAGGGGAAGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935573382 2:104686232-104686254 CTGTTACCAAGGCATCAGGAGGG - Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937635579 2:124152052-124152074 CTGAAACTATGGGAAGTGGATGG + Intronic
940498655 2:154466413-154466435 CAGTTTCCATGGCATGAGGAGGG + Intergenic
940716771 2:157235064-157235086 CTGGTACCATGGCAAATGCTGGG - Intergenic
942754844 2:179328518-179328540 TTGTTTCCATGGCAAGTTGAAGG - Intergenic
1169415085 20:5409280-5409302 CTGTTGGCATTGGAAGTGGAAGG - Intergenic
1176597110 21:8757728-8757750 CTGTTTCCATGGCAAGGGGTGGG + Intergenic
1176630343 21:9131066-9131088 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1176642927 21:9323673-9323695 CTGTTTCCATGGCAAGGGGTGGG + Intergenic
1179185920 21:39085192-39085214 CTGTGACCAGGACAAGTGCATGG - Intergenic
1179923418 21:44519942-44519964 CTGTTACCAAGGCCAATGGCTGG + Intronic
1180351951 22:11813076-11813098 CTGTTTCCATGGCAAGGGGTGGG + Intergenic
1180370008 22:11975526-11975548 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1180376244 22:12096595-12096617 CTGTTTCCATGGCAAGGGTTGGG + Intergenic
1180386259 22:12178994-12179016 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1180421329 22:12817104-12817126 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1181557760 22:23681576-23681598 CTGTGCCCATGGCAAGAGGTGGG + Intergenic
952645185 3:35648638-35648660 CTGTGAACATGGCCAGAGGAGGG + Intronic
954330881 3:49889714-49889736 CTGTTACCATGGCAACTGTGAGG + Intronic
955594580 3:60574783-60574805 TTCTTACCCTGGCAAGCGGAAGG - Intronic
957097153 3:75786895-75786917 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
961550314 3:127667179-127667201 TTGTTACCATGGCAAATGCCAGG - Intronic
964082891 3:152782122-152782144 CTGTTGGCTTGGCAAGTGGCTGG + Intergenic
965737232 3:171833890-171833912 CTGTTACCATGGGGAGAGAAAGG + Intergenic
967093966 3:186161631-186161653 CTGCTGCCAATGCAAGTGGATGG - Exonic
967365553 3:188682547-188682569 TGGTTACCTTGGCAAGTGAATGG + Intronic
1202743958 3_GL000221v1_random:81340-81362 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
969707518 4:8820042-8820064 CTGTTTCCATGGCCAGCAGAGGG + Intergenic
970554877 4:17220985-17221007 CTGCTGACAGGGCAAGTGGAGGG - Intergenic
973360412 4:49159950-49159972 CTGTTTCCATGGCAAGGGGTGGG + Intergenic
973399676 4:49627959-49627981 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
977367758 4:96093281-96093303 CTGTTCCTATTGCACGTGGATGG - Intergenic
982749461 4:159142388-159142410 CTAGTACATTGGCAAGTGGATGG + Intronic
983768466 4:171517880-171517902 CTGGTCCCCAGGCAAGTGGATGG - Intergenic
1202757843 4_GL000008v2_random:82035-82057 CTGTTTCCATGGCAAGGGTTGGG + Intergenic
985745924 5:1647712-1647734 CCATTACCTTGGAAAGTGGAAGG - Intergenic
990629724 5:57654883-57654905 CTGTTACCAGGGCAACTGCATGG + Intergenic
991084079 5:62632509-62632531 TTCTTACCATATCAAGTGGAAGG + Intergenic
995174153 5:109155028-109155050 CTCTTGCCATGGCAAATGTAGGG - Intronic
999128488 5:149264659-149264681 CTGTCTCCATGGCTTGTGGATGG - Intergenic
999891885 5:155986872-155986894 CTGCTACCATGCCTAGTGCAGGG - Intronic
1000491071 5:161914283-161914305 ATGTTACCAAGACAAGTGAAGGG + Intergenic
1001311702 5:170615643-170615665 CTGTTACCATGGCAAGTGGAGGG - Intronic
1004677297 6:17855694-17855716 ATGTTACCATGGCCAGTATATGG - Intronic
1004774017 6:18822020-18822042 CTGTAGCCATGGTAGGTGGAAGG - Intergenic
1010329223 6:74602654-74602676 CTGTTTCAATGTCAAGTTGAAGG - Intergenic
1013206215 6:107948196-107948218 GTGTTAAAATGGCTAGTGGAAGG - Intronic
1014408269 6:121079977-121079999 TATTTACCATGGCAAGTGGTAGG - Intronic
1015186301 6:130420421-130420443 TGGTCACCATGGCAAGGGGAAGG + Intronic
1017557728 6:155590170-155590192 CTGTTAGAATGGAAAATGGATGG - Intergenic
1019327410 7:445274-445296 CTCTGACCATGGCATGTGCAGGG - Intergenic
1020830704 7:13091263-13091285 CTGTTGGAATGGGAAGTGGAAGG + Intergenic
1023911463 7:44559785-44559807 CTGCTATCATGGCCAGAGGAGGG - Intergenic
1027503072 7:78979558-78979580 CTATTCCCATGGGAAGTAGAAGG + Intronic
1027541443 7:79471849-79471871 CTGTTTCCATGGGAACTGGCTGG + Intergenic
1028653915 7:93180899-93180921 ATGTTACCATGGCAACTGCCAGG - Intergenic
1029247146 7:99210383-99210405 CTGTTACCATGGGGAGTAGGAGG - Intergenic
1030133149 7:106220124-106220146 CTGCTGCCATGGCAACTGGTGGG - Intergenic
1031876522 7:127147968-127147990 CTGGTTCAATGGCAAGGGGATGG - Intronic
1032635263 7:133700103-133700125 CTGGAATCATGGCCAGTGGAGGG + Intronic
1032670132 7:134074698-134074720 CTGTTAGACTGCCAAGTGGAGGG + Intergenic
1032954408 7:136953939-136953961 CTCTCACCATGGTAAGAGGATGG - Intronic
1033234763 7:139629556-139629578 ATGTGACCATGGCAAGTGCCTGG - Intronic
1033502585 7:141966539-141966561 CTGTTGCCAAGGCATGGGGAGGG + Intronic
1033527295 7:142228878-142228900 CTGTTACCATGGCAATGCCATGG + Intergenic
1033931926 7:146533740-146533762 CTGTTATGATTCCAAGTGGATGG + Intronic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1035450282 7:158973514-158973536 CGGTTACCATGGCAAGGCGATGG - Intergenic
1036275958 8:7352137-7352159 CTGAGACCATGGCAAGATGAGGG - Intergenic
1043427586 8:80163442-80163464 CTGTTACCAGGGGTAGGGGATGG + Intronic
1046459438 8:114514222-114514244 CTGATACCATGGAAATTGAAAGG + Intergenic
1047549180 8:125851055-125851077 ATGTTACCATGGCAACTCCAAGG + Intergenic
1049372975 8:142276463-142276485 CTGTTACCACTGCAGGTGTAAGG - Intronic
1051004771 9:12329843-12329865 CTGTTACCTTGGCACCTGGGTGG + Intergenic
1055023252 9:71692456-71692478 CTGTTAGCATGGTAACTGGTGGG - Intronic
1060659727 9:125397764-125397786 CTCTTGCCCTGGTAAGTGGAGGG + Intergenic
1062210330 9:135360198-135360220 CTGACACCATGGGAGGTGGATGG - Intergenic
1203689447 Un_GL000214v1:29043-29065 CTGTTTCCATGGCAAGGGGTGGG + Intergenic
1203753176 Un_GL000218v1:98751-98773 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1203712590 Un_KI270742v1:111306-111328 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1203538632 Un_KI270743v1:66899-66921 CTGTTTCCATGGCAAGGGTTGGG + Intergenic
1203556184 Un_KI270743v1:209625-209647 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1203646828 Un_KI270751v1:75010-75032 CTGTTTCCATGGCAAGGGGTGGG - Intergenic
1186675013 X:11807110-11807132 CTGTTTCCATGGCATGTTTATGG + Intergenic
1187565330 X:20443957-20443979 CTGTAACCATGGCAAGGAGAGGG + Intergenic
1188520265 X:31030582-31030604 TTGTTACCATGGCTGGTGGAGGG + Intergenic
1189138610 X:38577348-38577370 CTGTGACCATGGCAGATGGTGGG - Intronic
1189561477 X:42195510-42195532 CAGTTACCATGGCAGGTGACTGG + Intergenic
1191008728 X:55738840-55738862 ATGCTACCAGGGCAGGTGGAGGG + Intronic
1194364702 X:93000589-93000611 ATGTTACCATTGTAAGTGTATGG + Intergenic
1197511297 X:127372137-127372159 CTGCTACTAAGGCAGGTGGAGGG - Intergenic
1199241607 X:145554047-145554069 ATGCTACCAGGGCAGGTGGAGGG - Intergenic
1200672932 Y:6116850-6116872 ATGTTACCATTGTAAGTGTATGG + Intergenic
1201166820 Y:11216320-11216342 CTGTTTCCATGGCAAGGGGTGGG - Intergenic