ID: 1001311973

View in Genome Browser
Species Human (GRCh38)
Location 5:170617575-170617597
Sequence GAATTGAGCAGAACCAGCTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001311973_1001311980 10 Left 1001311973 5:170617575-170617597 CCAAAGCTGGTTCTGCTCAATTC 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1001311980 5:170617608-170617630 CTCCTGCAATGGGGCCTCCAGGG 0: 1
1: 0
2: 1
3: 28
4: 201
1001311973_1001311975 -1 Left 1001311973 5:170617575-170617597 CCAAAGCTGGTTCTGCTCAATTC 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1001311975 5:170617597-170617619 CCCTAAAAGATCTCCTGCAATGG No data
1001311973_1001311977 0 Left 1001311973 5:170617575-170617597 CCAAAGCTGGTTCTGCTCAATTC 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1001311977 5:170617598-170617620 CCTAAAAGATCTCCTGCAATGGG 0: 1
1: 0
2: 2
3: 4
4: 109
1001311973_1001311978 1 Left 1001311973 5:170617575-170617597 CCAAAGCTGGTTCTGCTCAATTC 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1001311978 5:170617599-170617621 CTAAAAGATCTCCTGCAATGGGG 0: 1
1: 0
2: 1
3: 11
4: 109
1001311973_1001311979 9 Left 1001311973 5:170617575-170617597 CCAAAGCTGGTTCTGCTCAATTC 0: 1
1: 0
2: 0
3: 9
4: 155
Right 1001311979 5:170617607-170617629 TCTCCTGCAATGGGGCCTCCAGG 0: 1
1: 0
2: 1
3: 21
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001311973 Original CRISPR GAATTGAGCAGAACCAGCTT TGG (reversed) Intronic
906617404 1:47243187-47243209 GAATTCATTACAACCAGCTTGGG - Intergenic
906769146 1:48468666-48468688 GAATTGACCAAAACCAACTGAGG + Intronic
909220708 1:72957483-72957505 GATATTAGCAGAACCAGATTAGG + Intergenic
909272599 1:73643253-73643275 GAACTGAACAAAACCAGTTTGGG - Intergenic
911157468 1:94651578-94651600 GAAAAGGGCAGAACCAGCATTGG - Intergenic
913501326 1:119475266-119475288 GAATTGAGCGGAAGCAGGTGAGG + Intergenic
914323512 1:146588246-146588268 GAGCTCAGCAGAACCAGGTTGGG + Intergenic
916290771 1:163164051-163164073 GAAATGTGCAGAGCCCGCTTGGG + Intronic
924275045 1:242377377-242377399 GAAGTTAGAAGAACCAGTTTTGG - Intronic
924702165 1:246464986-246465008 TAATTGATCACAACCAGCTATGG + Intronic
924912093 1:248524400-248524422 GAACTGAGCAGAACATGCTGAGG + Intergenic
1062998502 10:1891647-1891669 GACTTGAGCAGGACCAGCCCTGG + Intergenic
1063751191 10:8949172-8949194 TAATTGAACTGAACCAGTTTGGG + Intergenic
1064037080 10:11923169-11923191 GAAGTGAGCACAACAAGCTCTGG - Intronic
1064691574 10:17923907-17923929 GAAGGAAGCAGAACCAGTTTGGG + Intergenic
1064991832 10:21263218-21263240 GCAGTGAGCAGTACAAGCTTTGG - Intergenic
1065158216 10:22893087-22893109 GAATTGAACAGTTCAAGCTTTGG + Intergenic
1071083115 10:81836636-81836658 GAATTGAACAAAACCATCTGAGG + Intergenic
1075155542 10:119973617-119973639 GAATTCAGCAGAATCGGCTGTGG + Intergenic
1076430693 10:130399812-130399834 CAAGTGAGCAGATCCAGGTTTGG - Intergenic
1078158475 11:8818666-8818688 GAATTAAGCTGAATGAGCTTTGG - Intronic
1078399933 11:11017199-11017221 GAAATGACCAGACCCAGATTAGG + Intergenic
1078457145 11:11484262-11484284 AAATTGCTCAGAACTAGCTTAGG - Intronic
1078689305 11:13562931-13562953 GAATTAAACAGAACCAGATGTGG - Intergenic
1078911533 11:15737105-15737127 GAATGGAGCAGGACCCACTTTGG - Intergenic
1079661315 11:23040362-23040384 AAATTGAGCAAAACCAGCAAAGG + Intergenic
1081096004 11:38936138-38936160 GAATTGAGCAGACACAGATGGGG + Intergenic
1082312000 11:50661962-50661984 GAATTTTGGAAAACCAGCTTTGG - Intergenic
1084954605 11:72684650-72684672 AAATTGAGAAGAAGCACCTTTGG - Intergenic
1088592449 11:111415286-111415308 GAATGAAGGAGAAGCAGCTTTGG - Intronic
1090494737 11:127199563-127199585 GAATTCAACATAACAAGCTTAGG - Intergenic
1091530690 12:1352296-1352318 GAACTGAGCTGAACCAGCAAGGG + Intronic
1091582761 12:1799076-1799098 GAACTGAGCAGAGCCCGCTGAGG + Intronic
1091767873 12:3133684-3133706 GAGTTGAGCAGAGCCACCTGGGG - Intronic
1093094528 12:14957734-14957756 CAATTTTGCAGATCCAGCTTTGG - Intronic
1094436677 12:30428292-30428314 GAAGGGAGGAGAGCCAGCTTTGG + Intergenic
1097422166 12:59393515-59393537 GAATAGAGCAGTATCAGGTTCGG + Intergenic
1097984948 12:65772899-65772921 GAAGATAGCAGAACCAGATTGGG - Intergenic
1103367612 12:120394638-120394660 GGATTGTGCAGACCCAGCTTTGG + Intergenic
1105203032 13:18195196-18195218 GGACTGGGCAGAAGCAGCTTCGG - Intergenic
1105446683 13:20463063-20463085 GAGGTGGGCAGACCCAGCTTCGG - Intronic
1109204173 13:59463288-59463310 AAATAGAGCAGAGCCAGCCTAGG - Intergenic
1109206324 13:59486951-59486973 GATATCAGCAGAAGCAGCTTTGG + Intergenic
1110573857 13:77034491-77034513 GAATAGAGCAGAACCAGGGCTGG - Intergenic
1112048145 13:95617789-95617811 GAATTGAGGAGACCCACCCTGGG + Intronic
1113361100 13:109632383-109632405 GAATTGTGCAGAATCACCCTGGG - Intergenic
1114216357 14:20660433-20660455 GAAAAGAGGAGAACCAGCATGGG + Intergenic
1115202546 14:30870335-30870357 TTATAGAGCAGAAGCAGCTTGGG - Intergenic
1116466248 14:45235878-45235900 GGATTGAGCACAACAAACTTAGG - Exonic
1116679554 14:47948491-47948513 GAATGGAGCAGAAGTTGCTTGGG - Intergenic
1119464777 14:74848098-74848120 ATATTGAGCAAAAGCAGCTTTGG + Intronic
1130917634 15:88318346-88318368 GCAGTGAGCAGAACCAGATCTGG - Intergenic
1131327885 15:91466486-91466508 GAAGTGAGCAAAAACACCTTTGG + Intergenic
1134276915 16:12784702-12784724 GAATTAATCAGAACCAGATAAGG + Intronic
1137551254 16:49439154-49439176 GGATTGAGCAGGGACAGCTTTGG + Intergenic
1138221463 16:55255359-55255381 TCATTGAGCAGCACTAGCTTTGG + Intergenic
1139363377 16:66417662-66417684 CAATTCAGCAAAACCAGGTTTGG - Intergenic
1140010049 16:71122603-71122625 GAGCTCAGCAGAACCAGGTTGGG - Intronic
1141479277 16:84295544-84295566 GAATTTAGCAGAAACCGCTCTGG + Intronic
1141783763 16:86184129-86184151 GAATTGATCATAGCCAGCATTGG + Intergenic
1142055296 16:87990632-87990654 GAATTAAACAAAACCATCTTAGG - Intronic
1142103689 16:88290702-88290724 AAATTGGGCAGAACCAGATTGGG - Intergenic
1148799945 17:50217768-50217790 GAATTTGGCTGATCCAGCTTGGG + Intergenic
1150322945 17:64231720-64231742 AAATTAAACAGACCCAGCTTTGG + Intronic
1151824747 17:76517997-76518019 GCATTGAGAAGCACCAGCTGGGG + Intergenic
1157571338 18:48714314-48714336 GAAGTGACCAGAATCAGATTTGG + Intronic
1158088355 18:53681241-53681263 GGACTGAACAGAACCAGTTTAGG + Intergenic
1160239997 18:77116450-77116472 GCATTGAACAGAACTAGATTTGG + Intronic
1161099048 19:2411352-2411374 GTATACAGCAGAAGCAGCTTTGG - Intronic
1165651865 19:37498312-37498334 GAATTGAGAACAACCAGGCTGGG + Intergenic
1167348353 19:48960831-48960853 GAACTGATCAGAACCATCATGGG + Exonic
1167963544 19:53126188-53126210 GACCTGAGCAGGACCAGCTGAGG + Intronic
926948039 2:18210106-18210128 GAACTGTGAAGAACCAGCCTTGG + Intronic
927459520 2:23285847-23285869 GAAATGACCAGAACCTGGTTTGG + Intergenic
927685962 2:25170593-25170615 TAATGCAGCAGAACCTGCTTTGG + Intergenic
927860110 2:26555450-26555472 GAACAGGGCAGCACCAGCTTAGG + Intronic
928306169 2:30172103-30172125 GCAGTGAGCACACCCAGCTTAGG + Intergenic
929928036 2:46231320-46231342 GGATAGAGCAGAGCCAGCCTGGG - Intergenic
930652098 2:53972840-53972862 GAACACAGCAGAAACAGCTTGGG + Intronic
930743190 2:54854929-54854951 GAATTGAGAAGAAACAACATTGG + Intronic
930768270 2:55107005-55107027 AAATTAAGCAGACCCAGCATTGG + Intronic
931201441 2:60101093-60101115 GAATTCTACAGAACCAGCTCTGG - Intergenic
932519606 2:72396566-72396588 GAATTGAGAAAAACCTACTTAGG + Intronic
933084718 2:78041413-78041435 TACTTGAGGAGAAACAGCTTTGG - Intergenic
935189284 2:100763026-100763048 CAAATGAGCAGAAACAGATTTGG - Intergenic
935952881 2:108346773-108346795 GAAATGAGCAGAACAAGATCTGG + Intergenic
936599807 2:113884743-113884765 GATGTGAGCAGATCCACCTTTGG + Intergenic
938590846 2:132734861-132734883 GAACTGAGCAGAGCCCACTTTGG - Intronic
938757969 2:134397927-134397949 GCATTGACCAGAACCAGCCATGG - Intronic
939366096 2:141233024-141233046 CAATTGAAGAGCACCAGCTTGGG + Intronic
939739672 2:145890248-145890270 AAATTCAGCAGATCCAGTTTGGG + Intergenic
944615759 2:201458414-201458436 GAATTCAGCAGAATAATCTTTGG + Intronic
944945609 2:204681394-204681416 GAATTCAGCAGAACTAGAATGGG - Intronic
946726205 2:222664053-222664075 GGATAGAACAGAACCAGTTTTGG - Intergenic
947688605 2:232113725-232113747 GGAGTGGGCTGAACCAGCTTTGG + Intronic
1169930731 20:10829912-10829934 TAATGGAGAAGGACCAGCTTCGG - Intergenic
1172640833 20:36439575-36439597 GAATTGGGCAGGGCCAGCCTCGG + Intronic
1172919532 20:38469548-38469570 TAATTGTGCAGTACCAGCTTGGG - Intergenic
1174159293 20:48539388-48539410 CAGGTGAGCAGACCCAGCTTTGG - Intergenic
1176679183 21:9810045-9810067 CAATTAAGCAGAAACAGGTTTGG + Intergenic
1176714927 21:10342809-10342831 GGACTGGGCAGAAGCAGCTTCGG + Intergenic
1176989521 21:15478429-15478451 GAGATGAGGATAACCAGCTTGGG + Intergenic
1180603421 22:17037129-17037151 GGACTGGGCAGAAGCAGCTTCGG - Intergenic
1183134873 22:35877684-35877706 GAATGCATCAGAACCAGATTTGG + Intronic
949538466 3:5013623-5013645 GACTTCAGCAGCTCCAGCTTAGG - Intergenic
949914940 3:8953391-8953413 GAAATGAGGAGAACCAGATATGG + Intronic
955755801 3:62224020-62224042 CAACTGAGCAGAACCACTTTGGG + Intronic
956706190 3:72001153-72001175 GCAGTGAGCAGTACAAGCTTTGG - Intergenic
960724403 3:120655531-120655553 GAGTTTATCAGAACCACCTTGGG - Intronic
964385489 3:156143218-156143240 GATTTTGGCAGACCCAGCTTGGG - Intronic
971450097 4:26792025-26792047 GAATTCAGAAGAACCAGCAAAGG + Intergenic
971619411 4:28835902-28835924 CAATTGAGTACAACCAGCTTTGG + Intergenic
973191256 4:47388555-47388577 GAATTAAGCAGCAGCAGATTTGG - Intronic
974165563 4:58196879-58196901 GAATTGAGCAGAAAAAGCTCTGG + Intergenic
975895680 4:79087299-79087321 GCATTGAGCAGAAGCTTCTTGGG + Intergenic
978706516 4:111719474-111719496 GCAGTGAGCAGAAACAGGTTGGG - Intergenic
978871069 4:113578712-113578734 GAAATGAGAAGAAAGAGCTTTGG - Intronic
978880228 4:113693322-113693344 GAATTTAGCAGAACTAGCTAAGG - Intronic
980874357 4:138645950-138645972 GACTTGAACAGAACGAGTTTTGG - Intergenic
982548395 4:156763672-156763694 TAATTGAGCAGACTCAGCTGTGG - Intronic
985178938 4:187235602-187235624 GCAGTGAGGAAAACCAGCTTAGG + Intergenic
985822083 5:2167214-2167236 GAGTGGGGCAGAACCAGCTGGGG - Intergenic
988039235 5:25867469-25867491 GAATGGAGCAGAAGGTGCTTTGG + Intergenic
991384055 5:66064658-66064680 GAATTGATAAGAAGTAGCTTAGG + Intronic
993907523 5:93640099-93640121 AAATTGAACAGAACCAGGTATGG + Intronic
994568000 5:101478071-101478093 GAATTCAGCTGAAATAGCTTTGG + Intergenic
998557105 5:143136131-143136153 GAATGAAGCAGAAGCAGCTTTGG + Intronic
998666437 5:144303707-144303729 GAAATGAGGAGATCCAGGTTGGG + Intronic
1001311973 5:170617575-170617597 GAATTGAGCAGAACCAGCTTTGG - Intronic
1006509898 6:34516013-34516035 GAATGGAGCTGAGCCACCTTGGG + Intronic
1006569225 6:34986875-34986897 GAATTAAGCAAATCCAGGTTTGG + Intronic
1010114227 6:72282585-72282607 GTATAGAACAGAAACAGCTTAGG + Intronic
1011194890 6:84771232-84771254 CAATTGAGGAAAGCCAGCTTGGG + Intergenic
1011746509 6:90412474-90412496 GCAATGAGCAGAACCACTTTTGG + Intergenic
1012930639 6:105312797-105312819 AAAATGAGCAGAACCAGGATGGG + Intronic
1014787776 6:125638009-125638031 CAATGGAGCAGAGCCAGCTGAGG + Intergenic
1018167011 6:161107652-161107674 AAATAGAGCAGAACCGACTTTGG - Intronic
1021780768 7:24103506-24103528 GCACTGAGCAGTAGCAGCTTTGG + Intergenic
1024570036 7:50715675-50715697 GGAGTGTGCAGACCCAGCTTTGG - Intronic
1026431001 7:70347235-70347257 GAATTGAGCAGAAGGAGGTGGGG - Intronic
1026680729 7:72464683-72464705 GACTGGAGCAGCTCCAGCTTTGG + Intergenic
1029176719 7:98669886-98669908 GAGTTGAGCAGACCCAGCCCAGG - Intergenic
1032542866 7:132718144-132718166 GCATTGAGCAGAGCAAGGTTAGG - Intronic
1033148788 7:138894860-138894882 AAGTTGTGCAGAACCAGTTTTGG - Intronic
1033151289 7:138916960-138916982 GAAGTGAGCACAACCAGCACCGG - Exonic
1034067817 7:148153667-148153689 GGATTGAGCAAAGCCAGCTTTGG + Intronic
1035899836 8:3447796-3447818 GAATTGAGCAGGACCACTTGGGG + Intronic
1038145327 8:24889471-24889493 GAATTGAGGAGAAGCAGGATTGG + Intergenic
1038775368 8:30525869-30525891 GAATTCAAGAGAAGCAGCTTAGG - Intronic
1039985935 8:42448075-42448097 GAGTTGGCAAGAACCAGCTTTGG - Intronic
1042392665 8:68254216-68254238 CAACTGAGTAGAATCAGCTTGGG + Intergenic
1042893773 8:73643110-73643132 GAATGGAGAAGAAACAGATTTGG - Intronic
1047648300 8:126892393-126892415 GATTTGGGCAGAAACAGGTTTGG - Intergenic
1048879040 8:138858186-138858208 GAATTGAGCAGAGTGAGCCTTGG - Intronic
1053487297 9:38469704-38469726 GAATGGAACAGCCCCAGCTTAGG - Intergenic
1056320647 9:85431602-85431624 GAACTCAGCCAAACCAGCTTTGG + Intergenic
1057465247 9:95308123-95308145 TACTTGATCAGAACCACCTTTGG - Intronic
1060428543 9:123527014-123527036 GAAGGGAGAAGAACCAGTTTGGG - Intronic
1061033526 9:128100954-128100976 GAGTGGAGCAGAAGCATCTTGGG + Intronic
1203664356 Un_KI270754v1:12581-12603 CAATTAAGCAGAAACAGGTTTGG + Intergenic
1187396184 X:18921618-18921640 GAACTGAGCAGAAGTAGCCTAGG + Intronic
1192699067 X:73448220-73448242 AAATTGAGCATCACCAGCTTTGG - Intronic
1192766451 X:74145182-74145204 AAATTAAGCAGATCCAGCATTGG + Intergenic
1196542988 X:116931388-116931410 GAATTGAGGGCAACCGGCTTGGG - Intergenic
1199145419 X:144360420-144360442 GAATTTAGCAAAACCACATTAGG + Intergenic