ID: 1001313396

View in Genome Browser
Species Human (GRCh38)
Location 5:170626824-170626846
Sequence GGGGATTTCTCAGACCTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 136}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001313396_1001313403 -1 Left 1001313396 5:170626824-170626846 CCTACTAGGTCTGAGAAATCCCC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1001313403 5:170626846-170626868 CTCAGCTTATGAGCCTGGGTGGG 0: 1
1: 0
2: 0
3: 11
4: 160
1001313396_1001313398 -5 Left 1001313396 5:170626824-170626846 CCTACTAGGTCTGAGAAATCCCC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1001313398 5:170626842-170626864 TCCCCTCAGCTTATGAGCCTGGG No data
1001313396_1001313406 28 Left 1001313396 5:170626824-170626846 CCTACTAGGTCTGAGAAATCCCC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1001313406 5:170626875-170626897 GCCTTCTCAAGAAGCCCAGAAGG 0: 1
1: 0
2: 2
3: 12
4: 170
1001313396_1001313402 -2 Left 1001313396 5:170626824-170626846 CCTACTAGGTCTGAGAAATCCCC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1001313402 5:170626845-170626867 CCTCAGCTTATGAGCCTGGGTGG No data
1001313396_1001313404 6 Left 1001313396 5:170626824-170626846 CCTACTAGGTCTGAGAAATCCCC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1001313404 5:170626853-170626875 TATGAGCCTGGGTGGGCAGCAGG 0: 1
1: 0
2: 1
3: 19
4: 287
1001313396_1001313397 -6 Left 1001313396 5:170626824-170626846 CCTACTAGGTCTGAGAAATCCCC 0: 1
1: 0
2: 1
3: 6
4: 136
Right 1001313397 5:170626841-170626863 ATCCCCTCAGCTTATGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001313396 Original CRISPR GGGGATTTCTCAGACCTAGT AGG (reversed) Intronic
901183898 1:7359826-7359848 TGGGGTTTTTCAGAGCTAGTGGG + Intronic
901484278 1:9547677-9547699 GGGGGTTACTCATATCTAGTGGG - Intronic
901532043 1:9859753-9859775 GGGCATTTCACAGACCTGGCTGG + Intronic
902709075 1:18226470-18226492 GTGGCTTTGTCAGACCAAGTGGG + Intronic
903305179 1:22408222-22408244 GGGGAGGTCTCAGACCTGGGAGG + Intergenic
908103614 1:60816788-60816810 GGGAATTTCTCACACAAAGTTGG - Intergenic
908269369 1:62408227-62408249 GGACATTTCTAAGACCTACTTGG + Intergenic
910447555 1:87314036-87314058 GGGCTTTGCTCAGACATAGTGGG + Intergenic
917750055 1:178044829-178044851 GTGGCCTTCTCAGACCCAGTGGG - Intergenic
920901206 1:210112118-210112140 GTGGCTTTCTCAGACCCTGTGGG + Intronic
922935200 1:229417238-229417260 GTGGACTTCTCAGACCCTGTAGG - Intergenic
924837430 1:247666503-247666525 GTGCATTTCTCAAACCTACTTGG - Intergenic
1063363506 10:5475631-5475653 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
1063503801 10:6579134-6579156 GCGGACTTCTCAGATCTTGTAGG + Intronic
1065438032 10:25721530-25721552 GTGGCCTTCTCAGACCTTGTGGG - Intergenic
1065458960 10:25935094-25935116 GGTGATTTCTCAGAACAAGCAGG + Intronic
1066653212 10:37678993-37679015 GGGTACTTCTCAGAGCAAGTGGG + Intergenic
1067166534 10:43870070-43870092 AGGGATTTCTCAGAGCTCCTGGG - Intergenic
1070284480 10:75073039-75073061 GAGCATTTCTCAGTCCTGGTGGG - Intergenic
1072617080 10:97057053-97057075 GAGACTTTCTCAGCCCTAGTGGG + Intronic
1075962685 10:126582946-126582968 GAGCATTTCTCAGACTTGGTTGG + Intronic
1077612509 11:3652244-3652266 GTGGCCTTCTCAGACCTTGTAGG - Intronic
1078290786 11:10007968-10007990 AGGGATTTCTCAGTCATACTAGG + Intronic
1080608225 11:33882343-33882365 GGGGATTTCTGAGACTCAGAGGG - Intronic
1084612968 11:70215635-70215657 GTGGCTTTCTCAGACCTTGTAGG + Intergenic
1087507460 11:99044068-99044090 TAGGCTTTCTTAGACCTAGTAGG + Intronic
1088555296 11:111054710-111054732 GTGGCGTTCTCAGACCTTGTAGG - Intergenic
1089349310 11:117812952-117812974 GTGGCCTTCTCAGACCTTGTAGG - Intronic
1090546152 11:127770270-127770292 GTGGCCTTCTCAGACCTTGTGGG + Intergenic
1090926622 11:131255896-131255918 GTGGACTTCTCAGACCCTGTAGG + Intergenic
1096323647 12:50638646-50638668 GGTAATTTCTGAGATCTAGTTGG + Intronic
1097493261 12:60296600-60296622 AGGGATCTCTCAGACATACTAGG + Intergenic
1098877210 12:75878443-75878465 GGGAATTTGTCAGAACAAGTCGG - Intergenic
1099502644 12:83432581-83432603 CTGGATTTCTCAGAGCTAGCAGG + Intergenic
1101999513 12:109548197-109548219 GGGGATTTCTCAGAGCTTTCAGG - Intergenic
1103206877 12:119136740-119136762 GGGGATTTCTGAGAACAGGTGGG + Intronic
1111305698 13:86409933-86409955 GCGGATGTCTCAGAGCTAGCAGG - Intergenic
1111463687 13:88579500-88579522 CAGTATTTCTCAGACCTAATGGG + Intergenic
1113384873 13:109839382-109839404 GGAGATTTCTCACACCTTGAAGG + Intergenic
1119022726 14:71128611-71128633 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
1119083852 14:71721939-71721961 GGGGAATTCTCAGCCAGAGTGGG - Intronic
1120141742 14:80937229-80937251 GAGGATTTCTCAAACCTGGGAGG + Intronic
1125046002 15:35242458-35242480 GTGGCCTTCTCAGACCTTGTAGG - Intronic
1130398978 15:83531342-83531364 TAGGACTCCTCAGACCTAGTTGG - Intronic
1132739587 16:1404887-1404909 GGGTATTTTTCAGACTTAGAAGG + Intronic
1135406473 16:22201745-22201767 GGGCATTTCTCATACCTAGTAGG + Intergenic
1144104892 17:11975574-11975596 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
1155397104 18:25398065-25398087 GGGGCTTTCTCAGGGCCAGTGGG + Intergenic
1161043181 19:2120853-2120875 GGGGAGTTCTCAGAGTGAGTGGG - Exonic
1161360817 19:3848615-3848637 GAGGATTTCTTGAACCTAGTAGG + Intronic
1162287117 19:9747051-9747073 GTGGCCTTCTCAGACCTTGTGGG - Intergenic
1164421478 19:28097195-28097217 GAGGACTTCTTAGACCTAGCAGG + Intergenic
1166884807 19:45953855-45953877 TGGGATTTCTCGGACCTTCTCGG + Exonic
1168051951 19:53835910-53835932 GGTGGTTTCTCAGACCCTGTAGG - Intergenic
926873209 2:17446100-17446122 CTGGATTCCTCAGAGCTAGTAGG - Intergenic
928175810 2:29033668-29033690 GGGTATCGCTGAGACCTAGTTGG + Intronic
933138330 2:78762730-78762752 GTGGTCTTCTCAGACCTTGTGGG - Intergenic
937010677 2:118560173-118560195 GGGGATTTCTGAGGCTGAGTGGG - Intergenic
939741056 2:145906686-145906708 AGGGAAATCTCAGGCCTAGTAGG - Intergenic
941455756 2:165710966-165710988 GTGGACTTCTCAGACCCTGTGGG + Intergenic
941750997 2:169135397-169135419 GTGGACTTCTCAGACCCTGTGGG - Intronic
943421268 2:187671890-187671912 GTGGCTTTCTCAGACCCTGTAGG + Intergenic
943950961 2:194132075-194132097 GTGGCATTCTCAGACCTTGTAGG + Intergenic
945362004 2:208904090-208904112 GTGGCCTTCTCAGACCTTGTGGG - Intergenic
948166228 2:235864707-235864729 GGGGATCTGTCAGTCCTGGTGGG + Intronic
1172785938 20:37469013-37469035 GGGGAGTTCTAAGCCCTAGAAGG + Intergenic
1174570244 20:51496242-51496264 GGAAATTTCTCATACCAAGTTGG - Intronic
1182941694 22:34283068-34283090 AGGTACTTCTAAGACCTAGTTGG - Intergenic
1183318514 22:37149677-37149699 GGGGAATTCTAAGACAAAGTTGG + Intronic
1183635213 22:39057946-39057968 GTGGACTTCTCAGACCCTGTGGG + Intronic
1184240050 22:43207193-43207215 GGGGATGTCTCAGAATCAGTGGG - Intronic
950280045 3:11699171-11699193 GTGGATTTCTTAGACTTACTTGG - Intronic
951298500 3:20968912-20968934 GTGGCTTTCTCAGACCCTGTAGG + Intergenic
952343208 3:32462319-32462341 GTGGCCTTCTCAGACCTTGTAGG + Intronic
953125574 3:40088747-40088769 AGGGCTTTCTCAGCCCTGGTAGG + Intronic
953177507 3:40565282-40565304 GTGGCCTTCTCAGACCTTGTAGG - Intronic
953599107 3:44346352-44346374 GTGGACTTCTCAGACCCTGTGGG + Intronic
954689151 3:52386618-52386640 GGGGAAGACTCAGACCCAGTGGG - Intronic
955268122 3:57467702-57467724 GAAGATTGCTCAGACCTATTAGG - Intronic
959863534 3:111242028-111242050 GTGTATTTGTCAGACCTAGTGGG - Intronic
963846130 3:150159796-150159818 GTGGATTCCTCAAACCTAGTTGG + Intergenic
964299851 3:155275813-155275835 GTGGCCTTCTCAGACCTTGTGGG + Intergenic
964372686 3:156017582-156017604 TGGCTTTTCTCAGACCTATTTGG - Intergenic
964984594 3:162723961-162723983 GTGGCCTTCTCAGACCTTGTAGG + Intergenic
966067244 3:175832819-175832841 GTGGTCTTCTCAGACCTTGTGGG - Intergenic
971180782 4:24326891-24326913 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
972287078 4:37659472-37659494 TGGCATTTCTCACACCCAGTGGG + Intronic
975418695 4:74137493-74137515 GGGGAATTCTCATACACAGTTGG + Intronic
976375715 4:84342716-84342738 CTGGATTTCTCAGAGCTAGCAGG - Intergenic
977254003 4:94720064-94720086 GAGAATTTCTCAGACCTGGGAGG + Intergenic
979104735 4:116669305-116669327 TGGGATTTCTCACACATTGTAGG + Intergenic
980197262 4:129606223-129606245 GAGGATTTCTCAAACCCAGGAGG - Intergenic
980496394 4:133591112-133591134 GGGTATTTCTAATACATAGTAGG - Intergenic
980528228 4:134016986-134017008 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
982396354 4:154919699-154919721 GTGGCCTTCTCAGACCTTGTAGG + Intergenic
983646198 4:169993893-169993915 GAGAATTTCACAGACCGAGTAGG - Intronic
984098698 4:175462587-175462609 GTGGCCTTCTCAGACCTTGTAGG + Intergenic
984437677 4:179725503-179725525 GTGGCTTTCTCAGACCCTGTAGG - Intergenic
985389548 4:189480772-189480794 GTGGACTTCTCAGACCCTGTAGG + Intergenic
989219380 5:38938629-38938651 GGGTATTTTTCATTCCTAGTAGG - Intronic
994295514 5:98083935-98083957 GTGGACTTCTCAGACCTTGTGGG - Intergenic
994778577 5:104065044-104065066 GTGGCCTTCTCAGACCTTGTAGG + Intergenic
996358311 5:122620287-122620309 GTGGCTTTCTCAGACCCTGTGGG + Intergenic
998913841 5:146993330-146993352 GAGGATTGCTCAAACCTAGGAGG - Intronic
1000250221 5:159487411-159487433 GGGTATCTCTCAGACCTCCTGGG + Intergenic
1001313396 5:170626824-170626846 GGGGATTTCTCAGACCTAGTAGG - Intronic
1003967752 6:11269450-11269472 GGGGATATCACAGACCTCCTTGG + Intronic
1009241954 6:61195033-61195055 GGGTATTTCTAACACATAGTAGG + Intergenic
1009345599 6:62610130-62610152 GGGCATTTCAGAGACCTACTTGG - Intergenic
1009809352 6:68640247-68640269 GGGAATGTCTCAGAGCTAGCTGG + Intronic
1010282944 6:74041405-74041427 CAGGATTTCTCAGAGCTTGTAGG + Intergenic
1010662534 6:78587071-78587093 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
1010826637 6:80484151-80484173 GTGGCCTTCTCAGACCTTGTAGG + Intergenic
1021173099 7:17418948-17418970 GTGGACTTCTCAGACCCTGTGGG - Intergenic
1022255653 7:28654874-28654896 GGGAACGACTCAGACCTAGTCGG + Intronic
1024084028 7:45878724-45878746 GGGCATTTCAGAGACCTAGGGGG - Intergenic
1026491739 7:70869561-70869583 GTGGAGTTCTCAGCCCTATTTGG + Intergenic
1033591264 7:142810209-142810231 GTGGATTTCTGAGTCCTAGATGG + Intergenic
1037693211 8:21201237-21201259 GAGGATTCCTCAGACCTATTTGG + Intergenic
1045431935 8:102123106-102123128 AGGGGTTTCTCAGACCTAAGTGG - Intronic
1046589503 8:116188982-116189004 GGGAATTACTCAGACTTTGTTGG - Intergenic
1047221885 8:122925444-122925466 GGGTATTTCTCGCCCCTAGTGGG - Intronic
1048135795 8:131745237-131745259 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
1048585123 8:135768541-135768563 GTGGACTTCTCAGACCCTGTAGG + Intergenic
1052244887 9:26322356-26322378 GGTGATTGCTCACACCTACTTGG - Intergenic
1052403424 9:28029398-28029420 GGGTACTTCTCAGAGCTACTCGG + Intronic
1053058367 9:35008004-35008026 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
1053463672 9:38289645-38289667 GGGGATTTCCCAGGCCCAATTGG - Intergenic
1057505667 9:95631479-95631501 TGGGATTTCTCAGTCCCGGTGGG + Intergenic
1058829072 9:108799246-108799268 GGGTGTTTCTCACACATAGTAGG - Intergenic
1059449850 9:114363795-114363817 GGGGATTCCTCAGTCTTTGTTGG + Intronic
1062063567 9:134513467-134513489 GGGGATTTCACAGAACTGATGGG - Intergenic
1062360724 9:136186680-136186702 GGGGATGCCTCAGACCTCGTGGG + Intergenic
1187003946 X:15213351-15213373 GCTGATTTCAAAGACCTAGTAGG - Intergenic
1187086211 X:16046093-16046115 GTGGCCTTCTCAGACCTTGTAGG + Intergenic
1187099664 X:16180585-16180607 GTGGCCTTCTCAGACCTTGTAGG + Intergenic
1188795505 X:34459006-34459028 GGGGATTTCTCAGAATTTGAAGG - Intergenic
1190478340 X:50850201-50850223 GGAGATTTCTCAGACAGAGAAGG - Intergenic
1191054562 X:56228836-56228858 GGGCATAGTTCAGACCTAGTGGG - Intergenic
1194502672 X:94700224-94700246 GAGGACTTCTCAGACCCTGTAGG + Intergenic
1195016687 X:100788118-100788140 GTGGACTTCTCAGACCCTGTGGG + Intergenic
1196300344 X:114044595-114044617 GTGGCCTTCTCAGACCTTGTAGG - Intergenic
1199073404 X:143503927-143503949 GTGGACTTCTCAGACCCTGTGGG + Intergenic
1201469952 Y:14322238-14322260 GAGGATGCCTCTGACCTAGTAGG - Intergenic