ID: 1001313866

View in Genome Browser
Species Human (GRCh38)
Location 5:170629403-170629425
Sequence GTCCGGGACCCCTCTAAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 46}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001313866_1001313879 28 Left 1001313866 5:170629403-170629425 CCACCCTTAGAGGGGTCCCGGAC 0: 1
1: 0
2: 1
3: 8
4: 46
Right 1001313879 5:170629454-170629476 ACCAACCAGCCCTGGGGCCAAGG 0: 1
1: 0
2: 1
3: 26
4: 257
1001313866_1001313870 -7 Left 1001313866 5:170629403-170629425 CCACCCTTAGAGGGGTCCCGGAC 0: 1
1: 0
2: 1
3: 8
4: 46
Right 1001313870 5:170629419-170629441 CCCGGACAGCCAAGCCCTGATGG 0: 1
1: 0
2: 0
3: 12
4: 132
1001313866_1001313876 20 Left 1001313866 5:170629403-170629425 CCACCCTTAGAGGGGTCCCGGAC 0: 1
1: 0
2: 1
3: 8
4: 46
Right 1001313876 5:170629446-170629468 GGTCAGCAACCAACCAGCCCTGG 0: 1
1: 0
2: 0
3: 11
4: 187
1001313866_1001313878 22 Left 1001313866 5:170629403-170629425 CCACCCTTAGAGGGGTCCCGGAC 0: 1
1: 0
2: 1
3: 8
4: 46
Right 1001313878 5:170629448-170629470 TCAGCAACCAACCAGCCCTGGGG No data
1001313866_1001313872 -1 Left 1001313866 5:170629403-170629425 CCACCCTTAGAGGGGTCCCGGAC 0: 1
1: 0
2: 1
3: 8
4: 46
Right 1001313872 5:170629425-170629447 CAGCCAAGCCCTGATGGAGTTGG 0: 1
1: 0
2: 1
3: 17
4: 192
1001313866_1001313877 21 Left 1001313866 5:170629403-170629425 CCACCCTTAGAGGGGTCCCGGAC 0: 1
1: 0
2: 1
3: 8
4: 46
Right 1001313877 5:170629447-170629469 GTCAGCAACCAACCAGCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 128

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001313866 Original CRISPR GTCCGGGACCCCTCTAAGGG TGG (reversed) Intronic
905303842 1:37004207-37004229 GTCCGAGCCCCCTCGGAGGGTGG - Intronic
1062927564 10:1328222-1328244 CACAGGGACCCCTCTATGGGAGG + Intronic
1077507890 11:2940598-2940620 GTCCAGGACCCCACTCAGGGCGG - Intergenic
1082875019 11:57979084-57979106 CTCAGGGACACCTGTAAGGGAGG + Intergenic
1083720688 11:64602139-64602161 GCCCTGGACCCCTGGAAGGGGGG - Exonic
1084422406 11:69066921-69066943 GGCTGGGACCCCTCTCAGGAGGG + Intronic
1091768427 12:3136857-3136879 GCTGGGGACCCCTCTAAGGCAGG + Intronic
1096982838 12:55738211-55738233 GTAAGGGAACCCTGTAAGGGGGG - Intergenic
1102236289 12:111296567-111296589 GTCTGGGAGGCCTCCAAGGGAGG - Intronic
1106603734 13:31208934-31208956 GGCAGGGACCCCTCTGAGGAGGG - Intronic
1113157429 13:107339529-107339551 GTCCCGGACTCCTCTGAGAGTGG - Intronic
1121711171 14:96039858-96039880 GTCCCGGAGCCCTCCAAGGCCGG + Intronic
1132493488 16:247951-247973 GTCTGGGAACCCTCTCAGAGTGG + Intronic
1134626643 16:15727127-15727149 TTCCTGGACCTCTCTGAGGGAGG - Intronic
1145869483 17:28261731-28261753 GTCAGGGACCCCCCGAATGGAGG + Intergenic
1147513616 17:41095535-41095557 GGCCGGGACAACTCTAAGTGGGG - Intronic
1149416048 17:56461044-56461066 GTGTGGGACCCCTGTAAGTGTGG + Intronic
1150626053 17:66841857-66841879 GACTGGAAACCCTCTAAGGGAGG - Intronic
1152276840 17:79362954-79362976 GTCCAGGACCCCTCTAGGGTTGG + Intronic
1152419953 17:80187266-80187288 GTCCGGCACCCGTCTTAGCGGGG - Intronic
1160575196 18:79849154-79849176 GTCTGGGCTCCCTCTAAGGGAGG - Intergenic
1160632465 18:80256179-80256201 ATCCAGGACCCCTCTTAAGGAGG - Intergenic
1160994461 19:1876259-1876281 GTCCGCGGCCCCTTTAAGGGGGG - Intergenic
1162059454 19:8085945-8085967 GTCTGGGAGCCCTCCAAGGCAGG - Intronic
1167113849 19:47477279-47477301 CTCTGGCACCCCTCTAGGGGTGG - Intronic
930706786 2:54512199-54512221 GTTGGGGACCCCTCTAATAGAGG + Intronic
931568957 2:63648018-63648040 ATCCGGGGCACCTGTAAGGGAGG - Intronic
938338020 2:130516528-130516550 GTCCAGGGCCACTCTAAGGGTGG - Intergenic
938351818 2:130604210-130604232 GTCCAGGGCCACTCTAAGGGTGG + Intergenic
948127668 2:235576697-235576719 GCCTGGGCCCCCTCTGAGGGAGG + Intronic
1171342929 20:24444775-24444797 AGCAGGGACCCCTCTTAGGGGGG - Intergenic
1183451469 22:37898247-37898269 CTCTAGGTCCCCTCTAAGGGTGG + Intergenic
1184891763 22:47383902-47383924 GTCTGTGACTCCTCTAAGGCAGG - Intergenic
953045407 3:39290168-39290190 GTGCTGGACACGTCTAAGGGAGG + Intergenic
961569782 3:127789308-127789330 GCCCGGGACCCATCTACGGCTGG + Intronic
969347506 4:6578592-6578614 GTCCCCGACCCCACTAAGAGGGG - Intronic
978382479 4:108144113-108144135 GTCTGGGACCCCTCTAGATGAGG + Intronic
1001313866 5:170629403-170629425 GTCCGGGACCCCTCTAAGGGTGG - Intronic
1001685423 5:173591087-173591109 GTCCGGGACGGCTCTGAGGAAGG - Intergenic
1004186903 6:13428687-13428709 GTCCAGGCCCCCTCCCAGGGCGG + Intronic
1006115957 6:31776367-31776389 GTCCCGGACCTTTCTAAGGAGGG + Intronic
1010410495 6:75555835-75555857 GTCTGGGACTCTTCTAAGTGTGG - Intergenic
1010781160 6:79947374-79947396 GCCGGGAACCCCTCTAACGGCGG + Exonic
1019234341 6:170597179-170597201 ATCCGGGACCCCTCTTAAGGAGG - Intergenic
1019705372 7:2494889-2494911 ATCTGCGACCCCTCTAAGGGAGG + Intergenic
1024599441 7:50966633-50966655 GTCCGGGACAACTCAAAGTGAGG - Intergenic
1036676597 8:10839416-10839438 GTCCGGGACCCCACAAAGGGCGG + Intronic
1041088125 8:54275682-54275704 GTGCTGCATCCCTCTAAGGGCGG + Intergenic
1049192227 8:141294774-141294796 GTGCGGGACCCCTGGGAGGGAGG + Intronic
1055555369 9:77468074-77468096 GTCTAGGACCCCTCTGAGAGGGG - Intronic
1061165134 9:128917793-128917815 GGCGGGGACCCTTCTAAGGTGGG - Exonic
1185621041 X:1452063-1452085 ACCCGGGACCCCCCTAGGGGTGG - Intronic
1200059575 X:153478280-153478302 TTCCGGCAGCCCTCTGAGGGTGG + Intronic
1200291839 X:154882997-154883019 TTCCGGCACCCCTCAATGGGTGG + Intronic
1200338677 X:155378734-155378756 TTCCGGCACCCCTCAATGGGTGG + Intergenic
1200347792 X:155461958-155461980 TTCCGGCACCCCTCAATGGGTGG - Intergenic