ID: 1001317173

View in Genome Browser
Species Human (GRCh38)
Location 5:170652055-170652077
Sequence CTGAGCAATGAGGAGCTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 5, 3: 41, 4: 300}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001317167_1001317173 25 Left 1001317167 5:170652007-170652029 CCACCAGGAAGTTACTCGGCAAA 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG 0: 1
1: 0
2: 5
3: 41
4: 300
1001317168_1001317173 22 Left 1001317168 5:170652010-170652032 CCAGGAAGTTACTCGGCAAATAA 0: 1
1: 0
2: 0
3: 7
4: 69
Right 1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG 0: 1
1: 0
2: 5
3: 41
4: 300

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001317173 Original CRISPR CTGAGCAATGAGGAGCTGGC TGG Intronic
900414287 1:2527979-2528001 CTGAGCAGGAAGGAGCAGGCAGG + Intergenic
900502404 1:3012816-3012838 CTGAAGAATGAGGAACTGGGTGG + Intergenic
901129729 1:6954790-6954812 CTGAGCACAGCTGAGCTGGCGGG + Intronic
901621801 1:10594519-10594541 CTGAGCAGGAAGGCGCTGGCAGG + Intronic
901807690 1:11748626-11748648 GGGAGCGGTGAGGAGCTGGCTGG - Intronic
903722834 1:25418738-25418760 CTGAGCCTTCAAGAGCTGGCTGG + Intronic
904770581 1:32878961-32878983 CTGGGTCATGAGGAGCAGGCTGG + Intergenic
905013962 1:34764493-34764515 CTGAGCAATGTGGGGCTATCTGG - Intronic
905601528 1:39256272-39256294 CTGAGGAATGTGGACTTGGCTGG + Intronic
905811297 1:40915382-40915404 CTGAGGTAGGAGGAGCTGGGCGG - Intergenic
906190718 1:43898045-43898067 CTGAGAAAGGAGGTGATGGCAGG - Intronic
906316959 1:44792629-44792651 TTCAGCAATAAGGAGATGGCAGG - Intergenic
906530437 1:46520715-46520737 CTGAGCATTCAGGGGCTGTCTGG - Intergenic
909551706 1:76905219-76905241 CTGAGAAAGGATGAGGTGGCGGG + Intronic
909693535 1:78437616-78437638 TATAGCAACGAGGAGCTGGCTGG - Intronic
912227736 1:107754673-107754695 CTGAGCCATGAGGAATGGGCAGG - Intronic
912374798 1:109201376-109201398 CTGAGCAATTCTGAGCTGGGAGG + Intronic
912658253 1:111506754-111506776 CTGAGCTAGGAAGAGATGGCAGG + Intronic
915074575 1:153297837-153297859 CTGAGAAAGGATGGGCTGGCAGG + Intergenic
915446053 1:155975665-155975687 CTGAGGAATGGAGAGGTGGCTGG - Intronic
915553363 1:156647640-156647662 ATGAGCAATGTGATGCTGGCTGG + Exonic
916257494 1:162804599-162804621 CAGAGCAATGGGAAGCTGGAGGG + Intronic
916830103 1:168482146-168482168 CTGAAGGATGAGGAGCTGGCTGG + Intergenic
919409880 1:197229369-197229391 CTGAGCAAAGAGGAAATGCCAGG - Intergenic
920212332 1:204337237-204337259 CTGGGAAGGGAGGAGCTGGCTGG - Intronic
921310518 1:213838434-213838456 CTGAGCAAAGAAGTGATGGCTGG + Intergenic
922460875 1:225813475-225813497 CTGAGGAGGGAGGAGCTGGTGGG + Intronic
922938213 1:229437135-229437157 CTCAGCTTTGAGGGGCTGGCTGG + Intergenic
923765473 1:236889098-236889120 CAGAGCAGTGAGGAGCTGGCAGG + Intronic
1063975194 10:11409353-11409375 CTGGGCCATGAGGCTCTGGCAGG - Intergenic
1066181129 10:32961657-32961679 CTGAAAAAGGAGGAACTGGCAGG - Intronic
1066224031 10:33365085-33365107 ATGAGCAAAGAGAAACTGGCTGG - Intergenic
1066723943 10:38370285-38370307 CAGAGCAATGGGAAGCTGGAGGG + Intergenic
1067270106 10:44784258-44784280 CTGAGAATTGAGGAGCAAGCGGG - Intergenic
1067314822 10:45151465-45151487 CTGAGGGAGGTGGAGCTGGCTGG + Intergenic
1067478348 10:46580262-46580284 CTCACCTATGAGGAGCTGCCTGG + Exonic
1067616390 10:47761525-47761547 CTCACCTATGAGGAGCTGCCTGG - Intergenic
1069277561 10:66611586-66611608 GTGAGAAATGAGGAGAGGGCAGG - Intronic
1069534642 10:69244000-69244022 CTGGGCAGTGAGGAGAAGGCAGG + Intronic
1069720566 10:70547160-70547182 CTGAGAACTGAGGAGCAGGCAGG + Intronic
1070085430 10:73232433-73232455 CTGAGCAAGTTGGAGCTGGCAGG - Intronic
1070540234 10:77410371-77410393 CTCAGGCATGAGAAGCTGGCTGG + Intronic
1070648778 10:78220177-78220199 CTGGGAAATGAGGAGCTGGTTGG + Intergenic
1071523427 10:86344925-86344947 CTGACCAGTGAGGAGTGGGCTGG + Intronic
1071707235 10:88012314-88012336 CTTAGAAATGAGGAAATGGCAGG + Intergenic
1072497162 10:95973131-95973153 GTGAGCAAGGAGGAGGGGGCGGG + Intronic
1072736300 10:97881847-97881869 CTGAGGAATGAGGAGCAGTTCGG - Intronic
1074188367 10:111115698-111115720 CACAGCAATGAGGAGGTGCCGGG + Intergenic
1076992176 11:281172-281194 CTCAGCAAAAAGGAGCTGCCGGG + Exonic
1077232469 11:1464090-1464112 CTGAGCAGTGGGGAGCTGGCAGG - Intergenic
1077252120 11:1565342-1565364 CTGAGCAAGGAGGCCCTGGAGGG + Intronic
1077487401 11:2845437-2845459 CAGAGCACTGAAGTGCTGGCGGG + Intronic
1078978932 11:16509069-16509091 CTGAGAACTGAGGAACTTGCAGG + Intronic
1081806429 11:45893404-45893426 GAGAACAGTGAGGAGCTGGCAGG + Intronic
1082160516 11:48883798-48883820 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082161850 11:48896608-48896630 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082167435 11:48965053-48965075 CTGAGCAAAGAGGAGGAGGTGGG + Intergenic
1082236127 11:49821606-49821628 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082239585 11:49856152-49856174 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1082242569 11:49888199-49888221 CTGAGCAAAGAGGAGGGGGTGGG + Intergenic
1082609630 11:55281526-55281548 CTGAGCAAAGAGGAGGGGGTGGG - Intergenic
1083333026 11:61907847-61907869 CTGAGCTCTGATGAACTGGCAGG - Intronic
1083423719 11:62571661-62571683 GTGAGCAATGAGGAGCTGCGGGG - Exonic
1083618846 11:64039146-64039168 CAGAGCAAGGGGGAGCTGGAGGG + Intronic
1083662907 11:64260058-64260080 CTGAGCAATGGGGAGGAGGTAGG + Exonic
1084147180 11:67271192-67271214 CTGACCCATGGGGAGCCGGCGGG - Intronic
1084536187 11:69758607-69758629 CTGAGCCCTGAGGACCTGGAGGG - Intergenic
1084868264 11:72078106-72078128 CTGAGGCAGGAGGAGCAGGCGGG - Intronic
1085400790 11:76234385-76234407 CTGCGCCTTCAGGAGCTGGCTGG - Intergenic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089528932 11:119114072-119114094 CTGAGCAATGGGCACCTGGCAGG - Exonic
1091816418 12:3442409-3442431 CAGAGAAAAGGGGAGCTGGCTGG + Intronic
1092172492 12:6382872-6382894 CTGAGCCACAAGGAGTTGGCAGG + Intronic
1095954301 12:47797605-47797627 CTGGGCAATGTGGGGCTGGTAGG + Intronic
1096549010 12:52360113-52360135 CTGTCCAATGCAGAGCTGGCGGG - Exonic
1097148097 12:56955323-56955345 CTGAGCATTCAGCAGCTGGTGGG + Intronic
1097240997 12:57575250-57575272 CTGAGAGATGAGGAGCTGGCAGG - Exonic
1098134253 12:67384956-67384978 CTGAGAAAAGAGGACCTGGCTGG - Intergenic
1099977786 12:89564399-89564421 CAAAGCAATGTGGAGCTGTCAGG + Intergenic
1101328217 12:103735552-103735574 GTGTGAAATGTGGAGCTGGCAGG + Exonic
1102648228 12:114417800-114417822 CTGAGGACTGAGGACATGGCTGG - Intergenic
1102737415 12:115175048-115175070 CTGAGTTAGCAGGAGCTGGCAGG + Intergenic
1102960970 12:117093076-117093098 CAGAACAGTGTGGAGCTGGCTGG + Intronic
1104111715 12:125710684-125710706 CTCAGCAGTGAGGACCTGCCTGG + Intergenic
1106097192 13:26658565-26658587 CTGGGCAATGAGGAGCTAGAAGG - Intronic
1108407958 13:50124153-50124175 CTGGGGAAGGAGGAGCCGGCGGG + Intronic
1108651446 13:52484100-52484122 CTGGGGAAGGAAGAGCTGGCTGG - Intergenic
1110162227 13:72392356-72392378 CTGAGCAAGGAGGACCTTACAGG - Intergenic
1110981956 13:81911526-81911548 CTGAGGAATGAAGGGCTGGAAGG - Intergenic
1111557923 13:89905676-89905698 CTGAGCAATGAGTAAAAGGCAGG - Intergenic
1112773850 13:102823043-102823065 CTGAGACATCAGGAGTTGGCAGG + Intronic
1112818114 13:103297369-103297391 CTGAGATAGCAGGAGCTGGCTGG - Intergenic
1113339811 13:109411083-109411105 CTAAACACGGAGGAGCTGGCAGG - Intergenic
1113664545 13:112132098-112132120 CCAAGCAGTGAGGAGCGGGCAGG + Intergenic
1114669454 14:24401113-24401135 TTGAGCAAGGAGGGGGTGGCGGG - Intronic
1115472414 14:33782238-33782260 CTGAGCAATGGAGAACTGGAGGG - Intronic
1115609207 14:35035375-35035397 GTAAGTAATGAGGAGCTGCCAGG - Intergenic
1116432833 14:44866640-44866662 CTGAGTCCTCAGGAGCTGGCTGG + Intergenic
1117041858 14:51775278-51775300 CTGAGCAATGAGGAGGATGGAGG + Intergenic
1117375578 14:55115613-55115635 CTGAGCAGTGAGTGCCTGGCTGG + Intergenic
1119119420 14:72060095-72060117 CTGTGCCATGAGGAGATGTCGGG + Intronic
1119437949 14:74610545-74610567 CTGGGCAGTGAGGGGCTGGGTGG - Intronic
1120810881 14:88802422-88802444 CAGAGCAGGGAGGAACTGGCTGG - Intergenic
1121080920 14:91107801-91107823 CAGAGGGATGAGGAGCTGGCGGG + Intronic
1122056432 14:99101265-99101287 CTGAATTATCAGGAGCTGGCTGG - Intergenic
1122119338 14:99543570-99543592 CTGAGCACTGAAGAGCAAGCAGG + Intronic
1122693562 14:103542474-103542496 CGGTGGAATGAGGGGCTGGCAGG - Intergenic
1123106609 14:105844771-105844793 CTGAGGAATGAGCAGGTGGGTGG + Intergenic
1125608822 15:40957482-40957504 CTGGGCAATGAGGAGGAGGCTGG - Intergenic
1125611305 15:40972956-40972978 AGGAGCAATGAGCACCTGGCTGG - Intergenic
1127005055 15:54559540-54559562 GTGAGCAATGAGGAGGTGGTTGG + Intronic
1127451279 15:59118781-59118803 CTGAAAAAGGAGGAGATGGCAGG - Intronic
1128154353 15:65383473-65383495 TTGGGCAATAAGGAGCTGGGAGG + Exonic
1131383180 15:91981211-91981233 CAGAGCAAGGAGGGTCTGGCTGG - Intronic
1132195686 15:99913149-99913171 CAGAGCACTGAGGTGCAGGCTGG + Intergenic
1132576042 16:664652-664674 CTGAGCAATGAGGGACTGCAGGG - Intronic
1135658234 16:24270573-24270595 CTGAGCAGTTGGGAGATGGCAGG + Intronic
1136401528 16:30021780-30021802 CTGAGCACTAAGGAGGGGGCGGG + Intronic
1138020034 16:53470464-53470486 CTGAGCACTGAGGGGCTGGATGG - Exonic
1138346198 16:56321731-56321753 CTGGGCAGAGAGGAGCGGGCAGG + Intronic
1138420824 16:56898029-56898051 CAGGGCAGTGAGGAGCTGGCTGG - Intronic
1138434190 16:56988232-56988254 CTGAGCACTGACGGGATGGCTGG - Intergenic
1138443815 16:57050712-57050734 CTGAACAATGATGAGCTGGTTGG + Intronic
1139144985 16:64312493-64312515 CTCAGCAAGGAGTAGCTAGCTGG + Intergenic
1140263856 16:73403684-73403706 CTGAGCACTGAAAGGCTGGCCGG + Intergenic
1140780175 16:78288774-78288796 CTGAGCAATGATGCGCTGACTGG - Intronic
1141112937 16:81285134-81285156 ATGAGAAATGGGAAGCTGGCTGG - Intronic
1141640290 16:85337186-85337208 ATGAGCTTTGAGGAGCAGGCGGG - Intergenic
1141660923 16:85441021-85441043 CTGAGGAACGAGGGGCTGGCGGG + Intergenic
1141663491 16:85453961-85453983 CTGGGGCATGAGGACCTGGCTGG - Intergenic
1141664229 16:85457648-85457670 CTGGGGCATGAGGACCTGGCTGG - Intergenic
1141698516 16:85631976-85631998 CGGAGCAGAGAGCAGCTGGCAGG + Intronic
1141925963 16:87169748-87169770 CTCCGCCATGAGGAGCTGGTGGG - Intronic
1143383306 17:6509652-6509674 CTGAGCAGGGAGGAGCATGCAGG - Intronic
1143651158 17:8264982-8265004 CTGAGCCATGAGGAGCTCATAGG + Exonic
1144687556 17:17236419-17236441 CAGGGCAAGGAGGAGCTTGCTGG - Intronic
1144863080 17:18317953-18317975 CTGAGCAGGGAGTAGATGGCTGG - Exonic
1144954078 17:19010413-19010435 GTGAGAACTGGGGAGCTGGCAGG - Intronic
1146282474 17:31553725-31553747 CTGAGGACTGAGGAGCTTACTGG - Intergenic
1146677570 17:34784030-34784052 CAGGGGAATGAGGATCTGGCAGG + Intergenic
1147978774 17:44262276-44262298 CTGAGAAATGAGGGGCTTGTGGG - Intronic
1148549466 17:48542004-48542026 CTGAGAAATGTGGCGCTGCCGGG - Intronic
1149446673 17:56718569-56718591 CTGAGCCATCAGGAACTGGAGGG + Intergenic
1149449705 17:56740004-56740026 CTCAGCACAGAGCAGCTGGCTGG + Intergenic
1150230396 17:63546517-63546539 CTGAGCCATGAGGTGCTGGAGGG - Exonic
1150318873 17:64193079-64193101 CTGAGCAAAGAGGTGCTGCATGG + Intronic
1151149837 17:72075646-72075668 CTGTGAAATGAGGGGCTGGTTGG - Intergenic
1151296045 17:73186841-73186863 CTGAGCCATGAATAGCTGGGCGG + Intergenic
1151778621 17:76226766-76226788 CTGAGCAACGAGGTGTTGGTGGG - Intronic
1151987343 17:77552445-77552467 CTGGGCACTGAGGAGCTCACAGG - Intergenic
1155988474 18:32255144-32255166 TTGTGCAAAGAGGATCTGGCAGG + Intronic
1157709892 18:49842990-49843012 CTCAGCAGGGAGGAGCTGGAGGG + Intronic
1157719129 18:49910095-49910117 CCGAGCACTGAGAAGCAGGCAGG + Intronic
1158503168 18:58021953-58021975 CTGAGCTGTGAGGAGCTGCCTGG + Intergenic
1160657641 19:281711-281733 GGGAGCACTGAGGAGCTGACAGG + Intronic
1161498626 19:4600850-4600872 CTGAGAAGGGAGCAGCTGGCAGG - Intergenic
1161994491 19:7703929-7703951 CTGAGCATTGGAGAGGTGGCTGG - Intergenic
1162300894 19:9844363-9844385 CTGAACAATGAGAGTCTGGCAGG - Intronic
1162833679 19:13302709-13302731 CTGGCCACTGTGGAGCTGGCTGG - Intronic
1163155372 19:15437251-15437273 CTGAGAGCTGAGGAGCAGGCAGG - Intronic
1164757930 19:30704141-30704163 CTCTCCAATGGGGAGCTGGCAGG + Intronic
1166228490 19:41411845-41411867 CTGAGTACTGAGGGCCTGGCAGG - Intronic
1167413785 19:49360209-49360231 CTGAGGGAAGAGGAGCTGGGGGG + Intronic
1167689100 19:50974841-50974863 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167689134 19:50974925-50974947 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167689208 19:50975132-50975154 CTGAGGGAGGAGGGGCTGGCGGG + Intergenic
1167689272 19:50975300-50975322 CTGAGGGAGGAGGGGCTGGCAGG + Intergenic
1168219828 19:54952648-54952670 CTGAGGAATGAGGAGATGGGAGG - Intronic
1168245870 19:55112977-55112999 CTGAGCACTGAAGGCCTGGCCGG - Intronic
1168295289 19:55374993-55375015 CTGAGGGAGGAGGAGCTGGGGGG - Intergenic
1168295322 19:55375075-55375097 CTGAGGGAGGAGGAGCTGGGGGG - Intergenic
925027997 2:624771-624793 CTCTGCAGGGAGGAGCTGGCAGG + Intergenic
927137177 2:20105513-20105535 GAGAGCAATGAGGAGTGGGCAGG - Intergenic
927498262 2:23564756-23564778 CTGAGCAGGCAAGAGCTGGCTGG + Intronic
927818258 2:26239937-26239959 CTGGGGATTGAGGAGATGGCTGG - Intronic
928237502 2:29557403-29557425 CTGAGCCCTGAGAATCTGGCTGG - Intronic
929075897 2:38078491-38078513 CTGAGCCAGGAGAACCTGGCAGG - Intronic
929888789 2:45902561-45902583 GTCAGAAATGAGGAACTGGCTGG + Intronic
929906446 2:46050310-46050332 CTGAGCCGTGAGAAGCTGTCAGG + Intronic
929924271 2:46196152-46196174 CTGAGCAAGGCTGGGCTGGCGGG + Intergenic
930295110 2:49544590-49544612 CTGGGCAATGACGGGGTGGCTGG + Intergenic
930775116 2:55163321-55163343 CTGACGAATGAGGATATGGCTGG - Intergenic
934704721 2:96469083-96469105 CTCATCAATGAGGAGGTGGGTGG - Intergenic
934760467 2:96852960-96852982 CTGAGGGATGAGGAGCTGGGTGG + Intronic
935544531 2:104386880-104386902 CTGGGCAGTGAGGAGGTGGCTGG - Intergenic
936327980 2:111522087-111522109 CAGAGCAGGGAGGAGCAGGCTGG + Intergenic
937098110 2:119248711-119248733 CTGAACAAGGAGGGGGTGGCAGG + Intronic
937217105 2:120319691-120319713 CTGAGCACTGAGGAGATCACAGG - Intergenic
937765739 2:125658785-125658807 CTGGGCAATGACGGGGTGGCTGG - Intergenic
939921665 2:148122998-148123020 GTGAGCAATGAAGAGGTGGGTGG + Intronic
940003575 2:148991176-148991198 CTGGGAGATGAGCAGCTGGCAGG - Exonic
940268002 2:151860413-151860435 CTGAGCAAAGTGGAGATGACTGG + Intronic
942348801 2:175031248-175031270 CTGAGGACTCAGGAGCTGGCTGG - Intergenic
947634259 2:231672263-231672285 CAGACCTTTGAGGAGCTGGCTGG + Intergenic
947913619 2:233818359-233818381 CTGGGCACTGAGGGCCTGGCTGG + Intronic
948247365 2:236498148-236498170 GTGAGAAATGAGGTGCAGGCTGG + Intronic
948251928 2:236536242-236536264 CTGGGCACTGAGGAGCTGGGGGG + Intergenic
948274617 2:236698755-236698777 CACAGCAATGAAGAGCTGGTTGG - Intergenic
948704147 2:239778898-239778920 GTGAGCCAGGAGGCGCTGGCTGG + Intronic
948883431 2:240871586-240871608 CAGAGCAAAGAGGACCTGGGAGG - Intronic
1168998651 20:2150828-2150850 CAGAGCACTGAGTAGGTGGCTGG - Intronic
1169136961 20:3203380-3203402 CTGCACAATGAGGAGCTGGCAGG - Exonic
1169263845 20:4155870-4155892 CAGTGCCATGAGGGGCTGGCAGG + Intronic
1171279551 20:23884179-23884201 CTGAGCAATGCAGACCTGGCAGG - Intergenic
1171401459 20:24875248-24875270 CTGAGCTCTGAGGTCCTGGCTGG - Intergenic
1172658044 20:36548920-36548942 CTGAGGAATGAGGACGTGGCAGG - Intronic
1173856834 20:46255648-46255670 CAGAGCAGTGAAGAGTTGGCAGG - Intronic
1174454591 20:50640285-50640307 ATGAGCTTGGAGGAGCTGGCTGG + Intronic
1174472206 20:50769436-50769458 ATGAGCTTGGAGGAGCTGGCTGG - Intergenic
1174734617 20:52954211-52954233 ATGAGCACTGAGGAGCAGGAGGG - Intergenic
1178410626 21:32360767-32360789 CTCAGCACTCAGAAGCTGGCTGG + Intronic
1179473275 21:41626279-41626301 CAGAGCAATGAGGACCTTGTTGG - Intergenic
1179627622 21:42657605-42657627 CTCAGCACTGGGGAGCTGGAGGG + Intronic
1179708225 21:43194668-43194690 CTGAGAAATGAGGAGGGGGGAGG - Intergenic
1179789536 21:43748564-43748586 CTCAGCCAGGAAGAGCTGGCGGG + Intronic
1180186142 21:46140312-46140334 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180186183 21:46140513-46140535 CTGAGCAATGCGAAGGTGGACGG - Intronic
1180749932 22:18117454-18117476 ATGAGAAATGAAGAGCTGGGAGG - Intronic
1180877493 22:19181492-19181514 CTGAGAAATGAGGAGGAAGCAGG + Intronic
1181167681 22:20992268-20992290 CTGACCTATGAGGAGCGGGTTGG + Exonic
1181572321 22:23774243-23774265 TTGAGCAATGAGGTGATGCCAGG + Intronic
1182847044 22:33439895-33439917 GTGAGGAATGAGGAGCAGGAGGG - Intronic
1183005418 22:34897417-34897439 CTGAGCAATGTGGAACTCTCAGG + Intergenic
1183297962 22:37043283-37043305 CCCAGCAAGGAGCAGCTGGCAGG - Intergenic
1183418571 22:37697103-37697125 CTCAGAAAAGAGGAGCTGGTAGG + Intronic
1183929440 22:41227657-41227679 CTGGGCAATGAGGAGAGGGCGGG - Intronic
1184037498 22:41925704-41925726 CTGGCCAGTGGGGAGCTGGCAGG + Intronic
1184381535 22:44147769-44147791 CTGAGGGATCAGAAGCTGGCAGG + Intronic
1184486029 22:44780059-44780081 CTGGACTTTGAGGAGCTGGCCGG + Intronic
1184660831 22:45964792-45964814 CTGAGCACTGAGGAGGAGGCAGG + Intronic
1184677764 22:46053046-46053068 CTGAGCAATGGTGAGCTGCCCGG + Intronic
1185272057 22:49934342-49934364 CTGAGCTGTGAGGAGGGGGCTGG + Intergenic
949356600 3:3187055-3187077 CAGAGCAATGAGCAGTTGGTAGG + Intergenic
950440126 3:13005616-13005638 CTGAGCACTCAGGATGTGGCTGG + Intronic
950495781 3:13333493-13333515 CAGAGCACAGAGGAGCTGGGAGG - Intronic
950748788 3:15112409-15112431 CTGAGCCCTGAGGAACTGACAGG + Intergenic
950772732 3:15325025-15325047 CTGAGCAATGAGGAAAAGGACGG + Intronic
952883825 3:38001125-38001147 CTGAGCAGCGAGCAGCTGGGAGG + Intronic
954152014 3:48662528-48662550 CTCAGCCAGGAGGAGCTGGGGGG - Exonic
954265871 3:49470063-49470085 ATGAGCAGAGAGGTGCTGGCCGG + Intronic
955611029 3:60757686-60757708 CAGACCCATGAGGGGCTGGCTGG - Intronic
956712244 3:72048911-72048933 GTTAGCATTGAGGGGCTGGCTGG - Intergenic
957216149 3:77321979-77322001 CTGAGCAATCAGGAGATAACAGG + Intronic
958535029 3:95389845-95389867 CTGAGTACTGAGATGCTGGCTGG - Intergenic
959007841 3:101040520-101040542 CTGAGGAATGAGGAGGGAGCTGG - Intergenic
959020625 3:101184250-101184272 CTGACCAACAAGGAGCTGCCTGG + Intergenic
960133797 3:114085761-114085783 GTGACCAATGAGCTGCTGGCCGG + Exonic
963828072 3:149977051-149977073 CTGAGCATTGTGGAGCAGGAGGG + Intronic
966761442 3:183422668-183422690 CTGAGGAGAGAGGAGCTGGGAGG + Intronic
966912385 3:184566678-184566700 CTGCGCAAGGAGGAGCAGCCTGG - Intronic
968446777 4:656099-656121 CTGAGGCACGTGGAGCTGGCCGG - Intronic
968511210 4:996743-996765 CTGAGCATTGAGGCAGTGGCTGG + Intronic
968841025 4:3005882-3005904 CTGCACACTGAGGAGCTGGGTGG + Intronic
969311804 4:6357247-6357269 CTGGGCAAGGAGGGGCTGTCAGG + Intronic
969376792 4:6768395-6768417 CTGAGGGAGAAGGAGCTGGCTGG + Intergenic
970960796 4:21869218-21869240 CAGAGCAATGAGGATCTAGCTGG - Intronic
972095971 4:35347529-35347551 CTGAGCCTTGAGGAGCTGGCTGG + Intergenic
972436720 4:39042502-39042524 CTGAGAAGTGAGGAGTTGGGGGG + Intergenic
972936902 4:44147331-44147353 TTGAACAATGAGGAGCTCCCAGG - Intergenic
974500645 4:62697069-62697091 CTGAGAAATAAAGAGCTTGCAGG - Intergenic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
978259724 4:106740852-106740874 CTCAGCAACTAGGAGCTTGCTGG + Intergenic
981295221 4:143123863-143123885 CTCAGGAATGAGGGTCTGGCTGG + Intergenic
982399765 4:154953681-154953703 CTGAGAATTGAGGAACTGGCTGG + Intergenic
983922209 4:173358180-173358202 TTGAGCAATGTGTAGCTTGCAGG + Intergenic
985877684 5:2612804-2612826 CAGAACACAGAGGAGCTGGCTGG + Intergenic
987231319 5:15896595-15896617 CAGAGGAAGGAGGAACTGGCAGG - Intronic
989513661 5:42317553-42317575 CTGAGGGATGGGGAGCTGACAGG - Intergenic
992109786 5:73482080-73482102 CTGGGCAATGACAAGGTGGCTGG + Intergenic
996179262 5:120399354-120399376 ATAAGCAATGAGGAGCTGAATGG + Intergenic
997476969 5:134148468-134148490 ATGAGCACTGGGGAGCAGGCTGG - Intronic
997697249 5:135871544-135871566 GTGAGGAATGAGGGCCTGGCGGG + Intronic
998375648 5:141688895-141688917 CTGAGCAATGAGGGAGGGGCAGG - Intergenic
998417485 5:141956263-141956285 CTGAACTATGAAGAGATGGCCGG - Exonic
998749653 5:145305625-145305647 CTGACCAATGAAAAGCTGGATGG - Intergenic
999000958 5:147922404-147922426 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
999197960 5:149795623-149795645 CTCTGCCCTGAGGAGCTGGCTGG - Intronic
999383561 5:151138777-151138799 ATCAGCAATGAGGTCCTGGCAGG + Exonic
999460323 5:151752159-151752181 CTGAGCAATGCTGATCTGGTGGG + Intronic
1001100603 5:168810780-168810802 ATGATCAGTGAGGAGCTGGGAGG - Intronic
1001317173 5:170652055-170652077 CTGAGCAATGAGGAGCTGGCTGG + Intronic
1001635963 5:173210770-173210792 ATGGGCAATGGGGAACTGGCCGG - Intergenic
1002331403 5:178443357-178443379 CTGAACAAAGAGGAGCTGAGTGG - Intronic
1002344519 5:178538131-178538153 CTGAGCACAGAGGAGCTGAAGGG + Intronic
1004081272 6:12395784-12395806 CTGAGCAATGAGGATTGAGCAGG - Intergenic
1007096930 6:39219027-39219049 CTGCTGAATGAGGAGCTGGATGG + Intronic
1007367965 6:41407801-41407823 CTGAGAGATGAGGATTTGGCGGG + Intergenic
1009543560 6:64997006-64997028 GTGAGAAATGAGGAGCCGGAGGG + Intronic
1009807895 6:68626124-68626146 CTGAGGCATGAGAAGCGGGCAGG + Intergenic
1011986823 6:93457604-93457626 TTTAGCAATGATGAGCAGGCTGG - Intergenic
1013367709 6:109447827-109447849 CTGAGCAGGGAGGAGTGGGCAGG - Intronic
1014787205 6:125632712-125632734 CTTGGCAATGACGAGCTGCCAGG + Intergenic
1018460543 6:163994668-163994690 CTGAAGAATGTGGAGCTGGCGGG - Intergenic
1018776631 6:167023207-167023229 CTCAGAGATGAGGAGCTGGACGG + Intronic
1018939890 6:168302038-168302060 CTGGGCAGTGAGGAGCTGGATGG - Intronic
1019270999 7:149205-149227 CGGCGCAATGAGGAGGCGGCCGG - Intergenic
1019446752 7:1075187-1075209 CTGAGCAATGACAAGCTAGACGG + Intronic
1019745037 7:2695096-2695118 CTGAGCAAGGAGGAGCCGTGAGG - Intronic
1020434865 7:8151711-8151733 CTGAGAAATGTGGAGGTGGGTGG + Intronic
1020814826 7:12892589-12892611 CAGAGCAATGTGGAACTGCCAGG - Intergenic
1020945196 7:14596481-14596503 CTGAGCAATGGGGATATGCCTGG + Intronic
1022482484 7:30753011-30753033 CTGAGCCTGGAGGAGCAGGCCGG + Intronic
1023020367 7:36006630-36006652 CTTTGCAATGAGGAGCTGCCTGG - Intergenic
1023688333 7:42760216-42760238 TTCAGCAACTAGGAGCTGGCAGG - Intergenic
1024040645 7:45550939-45550961 TTGGGCAATGAAGAGGTGGCTGG - Intergenic
1024250346 7:47501491-47501513 CTGAGCAGAGCGGAGCTGGCTGG + Intronic
1024331603 7:48160690-48160712 CTGAGCAAAGAGCATCTGGTGGG - Intergenic
1024494720 7:50032146-50032168 CTCAGCAATTAGAAGCTGTCTGG - Intronic
1028935116 7:96455857-96455879 CTGGGCAATGATGGGGTGGCTGG - Intergenic
1029662659 7:101973232-101973254 CTGAGCAAGGAAGGGCTGGGAGG - Intronic
1029917824 7:104230661-104230683 CTGACCAAAGAGGAGGGGGCAGG + Intergenic
1031709995 7:125033681-125033703 GTGAGCAATGAGGAGCTGTGGGG + Intergenic
1032574277 7:133035664-133035686 GTGAGCAATGAGGAGCTGCGGGG - Intronic
1032601706 7:133303915-133303937 GTGAGCACTCAGGAGCTGCCAGG + Intronic
1034999153 7:155597597-155597619 CTCAGCACTGAGCAGCTGGGGGG + Intergenic
1035230411 7:157462462-157462484 CGGGGAAATGAGGAGCTCGCGGG - Intergenic
1038024765 8:23578529-23578551 ATGAGCAGAGAGGAGGTGGCAGG - Intergenic
1038408294 8:27339269-27339291 AAGAGCAATGAAGAGCTGGGGGG - Intronic
1039782367 8:40797936-40797958 CAGGGCACTGAGGGGCTGGCAGG + Intronic
1039922963 8:41906103-41906125 CTGAGCCATGAGGAGCAAGCAGG - Intergenic
1041564715 8:59263413-59263435 CTGAGCACTGATGATCTGTCTGG + Intergenic
1043086038 8:75834665-75834687 CTAAGGACTAAGGAGCTGGCTGG + Intergenic
1044669011 8:94659750-94659772 CTGAGCAAAGATGAGAAGGCTGG + Intronic
1048782227 8:138014876-138014898 CAGGGCAATGAGGAGCAGTCAGG + Intergenic
1052379037 9:27750189-27750211 CTGAGGAATGAGCAGCTGCTTGG - Intergenic
1056369751 9:85941648-85941670 GGGAGCAATGAGGAGCCGGCAGG - Intronic
1056777966 9:89527689-89527711 CTGAGGAATGGGGTCCTGGCTGG - Intergenic
1056795875 9:89658598-89658620 CGGAGCAATGAGGAGAGGACTGG - Intergenic
1058934445 9:109755293-109755315 GTGAGGAAAGAGGAACTGGCAGG - Intronic
1059964635 9:119601721-119601743 CTGAAGGATGAGGAGCTGTCAGG - Intergenic
1060412145 9:123406873-123406895 CTGTGCAAGGATGAGCTGACAGG - Intronic
1060442984 9:123658919-123658941 CTGAGCATTGAGATGCTGCCTGG - Intronic
1060852204 9:126887293-126887315 CTGAGGATTGAGGAGCTTGAGGG - Intergenic
1061007315 9:127935483-127935505 CTGAGCAAGAAGGAGGTGACCGG + Exonic
1061382856 9:130268709-130268731 CTGGGGCATGTGGAGCTGGCTGG + Intergenic
1061907760 9:133707620-133707642 CTGAGCATTGAGGTGCTCGGGGG - Intronic
1062384251 9:136302812-136302834 CTGAGCATTCAGGGGCTGGAGGG + Exonic
1188456262 X:30369967-30369989 CTGACATATCAGGAGCTGGCTGG - Intergenic
1188509137 X:30915154-30915176 CTAAGCAATCTTGAGCTGGCAGG - Intronic
1189757882 X:44290127-44290149 CAGAGCAATGAGATGATGGCAGG - Intronic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190524040 X:51310692-51310714 CTCAGCAGTGGGGCGCTGGCAGG + Intergenic
1192219800 X:69190056-69190078 CTGGGCCATGAGGAGCTGGGTGG - Intergenic
1192318080 X:70067264-70067286 CTGCGGAAGGAGGTGCTGGCTGG + Intergenic
1196439194 X:115703045-115703067 GTGAGCAATGAGGAGCTGCAGGG + Intergenic
1197862431 X:130984901-130984923 CTGAACCCTGAGGAGGTGGCGGG + Intergenic
1198656884 X:138924424-138924446 TTGAGGAATGATGAGCTGTCTGG + Intronic