ID: 1001318220

View in Genome Browser
Species Human (GRCh38)
Location 5:170659564-170659586
Sequence CTCTATACAAAGAAGGAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 363}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001318220_1001318223 -8 Left 1001318220 5:170659564-170659586 CCTTTCTCCTTCTTTGTATAGAG 0: 1
1: 0
2: 2
3: 27
4: 363
Right 1001318223 5:170659579-170659601 GTATAGAGAGGTCTTTCCTGAGG 0: 1
1: 0
2: 0
3: 10
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001318220 Original CRISPR CTCTATACAAAGAAGGAGAA AGG (reversed) Intronic
902220667 1:14962540-14962562 CTCCATCCTGAGAAGGAGAATGG - Intronic
902231170 1:15028585-15028607 CTCTACACAAACAAGGAGGCTGG - Intronic
903257714 1:22114042-22114064 CTCAAAACAAAGAAGGGAAAGGG - Intergenic
903311223 1:22458103-22458125 CTCTAACCAAAGGAAGAGAAAGG - Intronic
903977785 1:27162484-27162506 TGCTATACAAAGAAGAAAAAAGG - Intronic
904853066 1:33473637-33473659 CTCTTGGCAAAGAAGGTGAAGGG - Intronic
905476999 1:38236025-38236047 CTCTAGAGTAAGAAGGAGAAGGG - Intergenic
907377888 1:54059038-54059060 CTCTGTAAAAAGAAACAGAAGGG - Intronic
907995928 1:59632746-59632768 CTCAATACAAAAGAGCAGAATGG - Intronic
908086362 1:60639065-60639087 ATCAAAATAAAGAAGGAGAAGGG + Intergenic
908598723 1:65716070-65716092 TTGTATACAGAGAAGGATAAGGG + Intergenic
908613695 1:65892815-65892837 CTCTGTAGAAAAAAAGAGAAGGG - Intronic
909975766 1:82044675-82044697 CTCTATAGAAAGAAACAAAATGG - Intergenic
911502332 1:98703483-98703505 CTGTAGACAGAGTAGGAGAAAGG + Intronic
911827129 1:102500618-102500640 TTATATACAAACAAGGAAAATGG - Intergenic
911987955 1:104655423-104655445 CTCCAGACAAAGAAGCAAAAAGG + Intergenic
912846745 1:113081250-113081272 CTCTATAAAAACAAAGATAAGGG - Intronic
913233826 1:116763665-116763687 CACTTTACAAAGAAGGAAACAGG + Intronic
913584850 1:120264606-120264628 CTCTCTACAAACAAAGACAATGG - Intergenic
913623332 1:120633752-120633774 CTCTCTACAAACAAAGACAATGG + Intergenic
914566849 1:148876462-148876484 CTCTCTACAAACAAAGACAATGG - Intronic
914605971 1:149253779-149253801 CTCTCTACAAACAAAGACAATGG + Intergenic
916040547 1:160957544-160957566 GTCTCTATAAAGAAGGAGACAGG - Intergenic
916310243 1:163390325-163390347 CTGTATAAAAAAGAGGAGAAAGG + Intergenic
916465326 1:165068489-165068511 CTCTATACCAAGGAGGATAATGG + Intergenic
919769719 1:201149673-201149695 CTCTGCACAACCAAGGAGAAGGG + Intronic
920087128 1:203425662-203425684 CTCTATACAAAGAGAGGGGAGGG + Intergenic
920246465 1:204591357-204591379 CTCTTTACAATGAAGAAGAGTGG - Intergenic
922000513 1:221473061-221473083 CCCTCTTCAAAGAAGGAGCAGGG - Intergenic
922034152 1:221832080-221832102 CTCTATGGAAAGAGGAAGAAGGG - Intergenic
922451172 1:225738564-225738586 CTCTATATAAAGAACTACAATGG - Intergenic
923394441 1:233546888-233546910 CCCTCTACCAAGAAGGACAAAGG + Intergenic
923589599 1:235307442-235307464 CTCTTTACAAAAAAAGAAAAAGG + Intronic
923608403 1:235466708-235466730 CTCCATTCTAAGAAGTAGAAAGG - Intronic
1063616820 10:7607477-7607499 CTCTACAGAAAGAAAGAGGAGGG + Intronic
1064358326 10:14639977-14639999 CAGTATACAAAGAAGGAAACGGG - Intronic
1064644965 10:17451732-17451754 CTCTATACAACCAAGTAGTATGG + Intronic
1065886026 10:30077918-30077940 CTATATACCTAGAAGTAGAATGG + Intronic
1066056085 10:31681418-31681440 CCCTGCACAGAGAAGGAGAAGGG - Intergenic
1068810214 10:61247138-61247160 CTCTTTACCCAGAAAGAGAATGG - Intergenic
1070213859 10:74355028-74355050 GTCTTTAAAAAGAAGAAGAAGGG - Intronic
1070721386 10:78759635-78759657 CTCAATACAAAGAAGGAGCTTGG - Intergenic
1071130381 10:82385601-82385623 CTCTATACAAGGAATAAGGAGGG + Intronic
1071224166 10:83508714-83508736 CTCTCTAAAAAGAAGAAGAGTGG + Intergenic
1071791970 10:88964560-88964582 CTCTCTACCAAGAAGGACAAAGG - Intronic
1073960072 10:108915594-108915616 CTTAATACAAAGAAGTAGATTGG - Intergenic
1074172496 10:110956467-110956489 CTATATCCAAAGAAGCAGAGTGG - Intronic
1074699319 10:116079469-116079491 CTTTATACTAACAAGGAAAATGG - Intronic
1074971508 10:118543054-118543076 CACTGTACAAAGGAGGGGAAGGG - Intergenic
1075162562 10:120037433-120037455 CTCTCTACCAGGAAGGACAAAGG - Intergenic
1075757185 10:124822214-124822236 GTCCTTACAAAGAAGGAGAGAGG + Intronic
1077765883 11:5160129-5160151 CTATATCCAAAAAAGTAGAAAGG - Intronic
1078319469 11:10321160-10321182 TTCTATACAATGACTGAGAAGGG + Intronic
1078664057 11:13309885-13309907 TTCTAGGCAAAGAAGCAGAATGG + Intronic
1080316481 11:30955812-30955834 GTTAATACAGAGAAGGAGAAGGG - Intronic
1081088084 11:38825372-38825394 GGCTAGACAAAGAAAGAGAAAGG + Intergenic
1082181028 11:49119845-49119867 CTTTATCCAAAGAAGGAAAGTGG - Intergenic
1083009102 11:59377830-59377852 CTCTCTGCAAAAAAGGAAAAGGG + Intergenic
1085067072 11:73506321-73506343 ATCTATAGAAATAAGAAGAAAGG + Intronic
1085303076 11:75469708-75469730 TTCGATCTAAAGAAGGAGAATGG + Intronic
1085612074 11:77959657-77959679 CTCTATTGAATGAAGTAGAATGG - Intronic
1085694215 11:78690080-78690102 CTCCGTACTAAGAAAGAGAAAGG - Intronic
1086220868 11:84441538-84441560 TTCTATACAAACTAGTAGAAAGG + Intronic
1086248464 11:84784430-84784452 CTTAATACAAAGAATGAGAGAGG - Intronic
1086559705 11:88153909-88153931 CTTTATATCAAGAAGGAAAATGG + Intronic
1086684461 11:89715027-89715049 CTTTATCCAAAGAAGGAAAGTGG + Intronic
1087153162 11:94876889-94876911 CTCCAGACAAATAAGGAGAAAGG + Intergenic
1087270326 11:96104788-96104810 CTAGATTGAAAGAAGGAGAAGGG + Intronic
1088779945 11:113124206-113124228 CTCTAGACTGAGAAGGAGGAAGG + Intronic
1088905458 11:114152027-114152049 GTCCATACAAAGAAGGCTAATGG - Intronic
1089757038 11:120694835-120694857 CTTTATAAAAAGAAGAAGACAGG + Intronic
1090324393 11:125872043-125872065 ACCTGAACAAAGAAGGAGAAGGG + Intergenic
1091639408 12:2223683-2223705 CTCTATAAGAGGAAGGATAATGG - Intronic
1092516128 12:9215487-9215509 TTGTATAAAAAGAAAGAGAAAGG - Intergenic
1092539480 12:9412016-9412038 ATAAATACAAAGAAGGAGAGGGG + Intergenic
1094371347 12:29740779-29740801 GTCTTTACAAAGAAGGAAAAAGG + Intronic
1094500029 12:31012790-31012812 ATAAATACAAAGAAGGGGAAAGG - Intergenic
1094566224 12:31600578-31600600 CACTACACAACGAAGGAGGAGGG - Intergenic
1095525647 12:43122004-43122026 CTAAATATAAGGAAGGAGAAGGG + Intergenic
1099744146 12:86680370-86680392 CACTTTACAAATGAGGAGAATGG + Intronic
1099876219 12:88409301-88409323 GAGTATAGAAAGAAGGAGAATGG + Intergenic
1099996162 12:89781356-89781378 CTCTATACACAGACTGAGAAGGG - Intergenic
1101032525 12:100674628-100674650 GGCAATACAAAGAAGCAGAATGG + Intergenic
1101747125 12:107551056-107551078 CTCAATAGCAAGAAGGAGAGAGG + Intronic
1104216244 12:126736524-126736546 CTCTCTACAATGATGGAGAATGG - Intergenic
1106861946 13:33919032-33919054 CTCTATAGAATAAAGAAGAACGG - Intronic
1107752037 13:43577980-43578002 CTATATAAAAAAAAGGAGAATGG + Intronic
1108007626 13:45967375-45967397 CTCTATAGAAGAATGGAGAATGG + Intronic
1108128382 13:47269764-47269786 CTCAAGACAGAGAATGAGAAAGG + Intergenic
1108483841 13:50905161-50905183 TTCTGTACAAAGAATAAGAAGGG - Intergenic
1108632519 13:52300574-52300596 GTCAATACATAGAAAGAGAAAGG - Intergenic
1108654183 13:52512017-52512039 GTCAATACATAGAAAGAGAAAGG + Intergenic
1109099014 13:58155873-58155895 CTCTAAACACTGAAGGAGATTGG + Intergenic
1109442089 13:62387996-62388018 CTCTATACAAACAGTGATAATGG + Intergenic
1109882736 13:68502315-68502337 AGATATACAAAGAAAGAGAAAGG + Intergenic
1110873838 13:80485298-80485320 CTCTAAATAAATAAGGAGAGGGG + Intergenic
1111104914 13:83632277-83632299 CTAGAAATAAAGAAGGAGAATGG + Intergenic
1111236076 13:85410001-85410023 TTCTTTAGAAAGAAGGATAAAGG - Intergenic
1112074339 13:95893293-95893315 CTATAGACATAGAAGCAGAATGG + Intronic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1115043995 14:28967248-28967270 CTTTATTTAATGAAGGAGAAGGG + Intergenic
1115088717 14:29548293-29548315 CTCTCAAAAAAGAAAGAGAAAGG + Intergenic
1116779306 14:49218647-49218669 ATTTGTACAAAGAAGCAGAAGGG + Intergenic
1118895336 14:69941098-69941120 CTCGTGAGAAAGAAGGAGAAAGG - Intronic
1119411143 14:74431308-74431330 CCCTTTACACAGAGGGAGAAAGG - Intergenic
1119565689 14:75627304-75627326 CTCTATAGAAACAAGAACAATGG + Intronic
1202831824 14_GL000009v2_random:42821-42843 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1124170583 15:27369002-27369024 TTCAAAACAATGAAGGAGAAAGG - Intronic
1124559937 15:30762343-30762365 CTTAATACAAAAAAAGAGAAAGG + Intronic
1124960597 15:34390580-34390602 TGCTATCCAAAGAAGAAGAAAGG - Intronic
1124977226 15:34536801-34536823 TGCTATCCAAAGAAGAAGAAAGG - Intronic
1125886534 15:43233923-43233945 CTCTCTACCAGGAAGGACAAAGG + Intronic
1126961297 15:53998102-53998124 CTCTATAAAAAGAACAAGATTGG - Intergenic
1127208491 15:56745801-56745823 CTATCTATAAAGAAGCAGAAGGG - Intronic
1127358362 15:58223482-58223504 TTCTAGAAAAAGAAAGAGAAAGG - Intronic
1127847441 15:62883483-62883505 CTCTCTACCAAGAAAGATAAAGG + Intergenic
1128261324 15:66235031-66235053 CTCTGCACAAAGCAGGAGAGGGG + Intronic
1129011251 15:72419678-72419700 CTCTATGCAAAGAAAAAGGAGGG + Intergenic
1129831380 15:78673330-78673352 CTCTTTTCCAAGAATGAGAATGG - Intronic
1130292234 15:82613285-82613307 ATCTATAGAATAAAGGAGAAAGG + Intronic
1130449345 15:84035135-84035157 CTAAATACAAAGAATGAGAGGGG - Intronic
1130804684 15:87307304-87307326 CTCTACACAAAGAAGCAAGAAGG - Intergenic
1131311343 15:91293208-91293230 CTCTATTCAAAGAAACGGAATGG + Exonic
1131797255 15:96031787-96031809 CTCTACAAAAAGGAGGAAAAAGG - Intergenic
1133481065 16:6171173-6171195 ATATAGACAAAGAAGGAGAGAGG - Intronic
1133658817 16:7894222-7894244 CTATAATCAAACAAGGAGAAGGG + Intergenic
1134343947 16:13371973-13371995 AGCTTTACAAAGAAGAAGAAAGG - Intergenic
1136358745 16:29763886-29763908 CTCTAAAAAAAAAAGGAAAAAGG + Intergenic
1136632963 16:31499849-31499871 CTCTAAAGCAAGAAGAAGAACGG - Intronic
1136990647 16:35149397-35149419 CTATAGACAATGAAGGAGCAGGG - Intergenic
1138278944 16:55758120-55758142 CTCTACAAGAATAAGGAGAAAGG - Intergenic
1138289590 16:55835554-55835576 CTCTACAAGAATAAGGAGAAAGG + Intergenic
1139018315 16:62717075-62717097 TTCTATACAAATAAGCACAAGGG - Intergenic
1139122417 16:64036573-64036595 CTCTATCCAAAGTAGGAAAGTGG - Intergenic
1139125643 16:64073058-64073080 CTCTAAACAAAGGTGGAGAAAGG - Intergenic
1139207619 16:65044541-65044563 CTCTCTATACAGAAGGAAAAAGG + Intronic
1139347788 16:66315481-66315503 CTCTGGCCAGAGAAGGAGAAAGG + Intergenic
1139583063 16:67884658-67884680 CTCCATAGAAGGAGGGAGAAGGG - Intergenic
1140977944 16:80078678-80078700 CTCTTAAAAAAGAAGAAGAAAGG - Intergenic
1141024872 16:80537080-80537102 CTTTGTTCAAAGAAGAAGAAAGG - Intergenic
1141158197 16:81611405-81611427 CTCTCTACAGACAAGGGGAATGG + Intronic
1141283330 16:82648588-82648610 CTCTAAATAAAGAAAAAGAAGGG + Intronic
1143641475 17:8200706-8200728 CTCTAAACAAAGAAAAGGAAGGG + Intergenic
1143980145 17:10861816-10861838 CTCTCTACAAACAAAAAGAAAGG + Intergenic
1144285888 17:13773928-13773950 ATCTATACAAAGAGTGTGAAGGG + Intergenic
1144443977 17:15309468-15309490 CTCTTTACAGAGAAAGAGGAGGG - Intronic
1144878296 17:18414916-18414938 ATCTATACATAAAAGGAAAATGG - Intergenic
1144995315 17:19264094-19264116 TTCTAAACAAAGCAGGACAATGG + Intronic
1145098448 17:20052703-20052725 CACTATCCAAGGAAGGAGCATGG + Intronic
1147476046 17:40712339-40712361 CTCTACACACAGAAAGATAATGG - Intergenic
1148535047 17:48431693-48431715 TTTTTTACAAAGAAGGAAAAAGG - Intergenic
1148775044 17:50090421-50090443 CTATATACAAAGAAGGCACAAGG - Intronic
1149208334 17:54275209-54275231 CTCTATACAAAGCACCAAAATGG + Intergenic
1149864120 17:60140976-60140998 ATCCATAAAAAGAAAGAGAAAGG + Intergenic
1151359591 17:73580682-73580704 AGCTACACAAAGAAGGAAAAAGG + Intronic
1153509239 18:5834091-5834113 TTCTATACAAAGCAGGTGGAGGG + Intergenic
1155552937 18:26985602-26985624 CTCAAGACAAAGAACCAGAAAGG + Intronic
1156704957 18:39869532-39869554 GTCTATAAAAAGAGGGAGAGAGG + Intergenic
1156744194 18:40369466-40369488 CTCTATTCACAGGAGGAAAAAGG + Intergenic
1158779739 18:60633029-60633051 CTGTATACAAATAGGCAGAATGG + Intergenic
1159583948 18:70265074-70265096 CTGAATTCTAAGAAGGAGAAAGG - Intergenic
1160131198 18:76226315-76226337 CTGCACACACAGAAGGAGAAAGG + Intergenic
1160131317 18:76227285-76227307 CTGCACACACAGAAGGAGAAAGG + Intergenic
1161955162 19:7489787-7489809 CTCTCTACCAGGAAGGACAAAGG + Intronic
1163511222 19:17736214-17736236 CTCAAGAGAAAGAAGGAAAAAGG - Intergenic
1164717231 19:30401695-30401717 TTCTATTCAAAGAGGGGGAAAGG + Intronic
1164879308 19:31717658-31717680 TTTTATATAAAGCAGGAGAAGGG + Intergenic
1164957799 19:32402127-32402149 CTCTTTCCAAAAAGGGAGAAGGG + Intergenic
1165164521 19:33842200-33842222 CCCTATATAAAGATGGGGAATGG - Intergenic
1202640867 1_KI270706v1_random:84931-84953 ATCTATACAAAGAAGGTGGGTGG + Intergenic
925205450 2:2002106-2002128 GTCAATAAAAAGAAGTAGAATGG - Intronic
926470410 2:13248345-13248367 ATCTGTACAAAGAAGGAGCAAGG - Intergenic
928432162 2:31229177-31229199 CCCTCTAGAAAGAAGGAGAAGGG + Intronic
928777473 2:34783011-34783033 CACTAGACAATGAAAGAGAAAGG + Intergenic
929911591 2:46094272-46094294 CAGTATACAAAGAAAGAGGAAGG - Intronic
930558170 2:52926561-52926583 CTTTATTCAATGAAGGAGAGAGG + Intergenic
931829086 2:66032020-66032042 GTCTCTACATAGAAGAAGAAAGG + Intergenic
931856501 2:66307456-66307478 CTTTATCCAAAGCTGGAGAAAGG + Intergenic
932630873 2:73342266-73342288 CTCTCTACAGAGAAAGTGAAGGG + Intergenic
934496430 2:94804919-94804941 ATCTATACAAAGAAGGTGGGTGG + Intergenic
936269159 2:111035457-111035479 TCCTAAACAAAAAAGGAGAAAGG + Intronic
937642190 2:124226268-124226290 CTCTTTATAAAGAAGGAGATAGG - Intronic
937687626 2:124715777-124715799 TGCTATAGAAAGAAGGAGATTGG + Intronic
939055091 2:137355787-137355809 CACTTTACAGAGAAGGAAAAAGG - Intronic
939558273 2:143703142-143703164 CTACATTCAAAGAAGCAGAAAGG + Intronic
939727004 2:145733276-145733298 CTCTATGCAAAGAAGGAAGCAGG + Intergenic
940672303 2:156685758-156685780 CTCTATCCAAAGAAAGTCAAGGG - Intergenic
942123092 2:172797976-172797998 CAAGATACAAAGATGGAGAAAGG - Intronic
942322014 2:174744012-174744034 CACTTTGCATAGAAGGAGAATGG + Intergenic
942426448 2:175865635-175865657 CACTTTACAAGGAAGGAGATGGG - Intergenic
943885536 2:193212343-193212365 CTTTATCCAAAGAAGGGGAAAGG + Intergenic
944198269 2:197078023-197078045 TTCTATACAAAGAAGGTGTTAGG + Intronic
944880196 2:204005309-204005331 CTCTTTAGAAAGAAGCAGGATGG - Intergenic
946028131 2:216684588-216684610 CTCTCTACAAAGAATGAAAAAGG + Intronic
946693772 2:222332139-222332161 CTTTATAAAAGGAAGGTGAAGGG - Intergenic
947220069 2:227783347-227783369 CTATATAGAAGGAAGAAGAAAGG - Intergenic
1168742544 20:204825-204847 CTCTAAACAAAGAATGGCAAGGG - Intergenic
1171887744 20:30671680-30671702 ATCTATACAAAGAAGGTGAGTGG + Intergenic
1172988535 20:39013738-39013760 TTCTCTACAAAGAAGCAAAATGG - Intronic
1174091435 20:48051815-48051837 ATGTCTACCAAGAAGGAGAATGG + Intergenic
1174296265 20:49547449-49547471 CTCTGTAAAATGAAGGAGAGAGG - Intronic
1174743475 20:53039173-53039195 GTGTAGACCAAGAAGGAGAAGGG - Intronic
1178018731 21:28384073-28384095 CTGAATACAAAAGAGGAGAAGGG - Intergenic
1178757853 21:35369386-35369408 GTCTATCCAAGGAAGCAGAAGGG + Intronic
1178807543 21:35851944-35851966 CTGGTTACAAAGCAGGAGAAAGG + Intronic
1180241957 21:46514820-46514842 CTTTTAACAAACAAGGAGAAGGG - Intronic
1180361085 22:11896931-11896953 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1180690787 22:17713837-17713859 GTCTATACAAAGAAAAAAAATGG + Intronic
1180865771 22:19118847-19118869 TTCTCTACACAGATGGAGAAAGG + Intronic
1182237706 22:28889360-28889382 CTCTATACCCACAAGGAAAAGGG + Intronic
1182466817 22:30522043-30522065 CTCTGTAAAAAGAAAGAAAAAGG - Intergenic
1183036735 22:35146279-35146301 CTCTTTTCAAAGAAAGAAAAGGG + Intergenic
1184338742 22:43873588-43873610 CTCTTTACATGGAAGCAGAAAGG - Intergenic
949103367 3:173587-173609 CTCTATATATAGAGAGAGAAAGG + Intergenic
949447784 3:4153712-4153734 AACTATACAAAGGAGGTGAATGG - Intronic
950386827 3:12666597-12666619 CTCTTAAAAAAGAAGAAGAAAGG + Intergenic
951400869 3:22230287-22230309 CTATAAAAAAAGAAGGAAAATGG + Intronic
951534046 3:23725670-23725692 CTCTAAAAAAAGAAAGAAAAAGG + Intergenic
951649594 3:24936153-24936175 CTCTATACAAACATGGACCATGG - Intergenic
953029795 3:39171435-39171457 CTCAATAAAAAGAAAGAAAATGG + Intergenic
953193374 3:40710488-40710510 CTCCATAGAAAGAAAGATAAAGG + Intergenic
955485015 3:59426427-59426449 CTGTCTTCAAAGATGGAGAAAGG - Intergenic
956343047 3:68247873-68247895 TTCTATACAAATAAAGAGAAAGG - Intronic
956421185 3:69087374-69087396 CTCTTTGCAAAGAAGCAGGAGGG + Intronic
957385158 3:79486873-79486895 CTCTCTACTAGGAAGGACAAAGG + Intronic
957501862 3:81067549-81067571 CACTTTCCAGAGAAGGAGAATGG - Intergenic
958666821 3:97150756-97150778 CTTTCTACAAATAAGGAAAAGGG - Intronic
958750598 3:98190277-98190299 CACTATACAAACAAGAAGAATGG + Intronic
959717301 3:109446858-109446880 CTCAAAAAAAAGAAAGAGAAAGG - Intergenic
959890293 3:111547315-111547337 ATATATAAAAAGAAGGAGCAGGG - Intronic
960818648 3:121702506-121702528 CTCTATAGAACTAAGGAGCAAGG + Exonic
960929844 3:122835947-122835969 CTCTACACCAACAACGAGAAAGG + Intronic
961445275 3:126977691-126977713 CTCCCTACACAGGAGGAGAAGGG - Intergenic
961555133 3:127691970-127691992 CTTTATGCAAAAAAAGAGAAAGG - Exonic
962463117 3:135632670-135632692 CTTTTCACAAAGAAGGACAAAGG + Intergenic
962893593 3:139694188-139694210 CTCTATGCAAAAAAGTAGCATGG + Intergenic
962954472 3:140251660-140251682 CACTAAACAAGGAAGGAAAAAGG - Intronic
963782696 3:149503016-149503038 TTATATACAAAGAAGTAGTATGG - Exonic
963783599 3:149511047-149511069 CTCTACAAAAAGAAGGAGGCTGG - Intergenic
963963312 3:151334802-151334824 CTCTATAAAAAAAAGAAGACTGG - Intronic
964517589 3:157529780-157529802 ATCTATAGAAGGAAAGAGAAAGG + Intronic
965836022 3:172853778-172853800 CTCTTTACAAAGGAGCGGAAAGG - Intergenic
966166480 3:177024333-177024355 CTTTATACAAAGCAAGATAACGG - Exonic
966926284 3:184646637-184646659 ATCTCTAGAAGGAAGGAGAAGGG + Intronic
967182526 3:186918846-186918868 CTACATACACAAAAGGAGAAAGG - Intergenic
967184644 3:186934112-186934134 CACTGTACAAAGAAGGAAACTGG - Intronic
967665901 3:192171851-192171873 CTCTCTACAAATAAGGAGATTGG - Intronic
1202737693 3_GL000221v1_random:22456-22478 ATCTATACAAAGAAGGTGGGTGG - Intergenic
969182449 4:5452457-5452479 CTCCATTCAAAGGAGGAGGAAGG + Intronic
970560693 4:17279352-17279374 CTCTATAAGGAGAAGGAGATGGG - Intergenic
971170009 4:24224257-24224279 ATCCATAGAAAGAGGGAGAATGG + Intergenic
973384383 4:49495462-49495484 ATCTATACAAAGAAGGTGGGTGG + Intergenic
973895178 4:55405062-55405084 CTTTATTCAAAGAAGGTGGAGGG - Intronic
975056368 4:69936111-69936133 CCTTACACAAAGAAGGAGTAGGG + Intronic
977913489 4:102564219-102564241 CACTATTCAAAGAAGTAAAAGGG + Intronic
978588381 4:110297351-110297373 CTCTGGACAAAGAGGGTGAAGGG + Intergenic
979092963 4:116510251-116510273 CTCTGTACAAAAAAAGATAATGG + Intergenic
979340321 4:119514873-119514895 CATTATACAAAGAAGGAAACAGG + Intronic
979827734 4:125260020-125260042 CTTTAAGAAAAGAAGGAGAATGG - Intergenic
979936617 4:126705650-126705672 TTATATACAAAGAAGTAGAAAGG - Intergenic
980026458 4:127773365-127773387 CTCTATACAAAGAAAAACAAAGG - Exonic
980222761 4:129940929-129940951 CATTATAAAGAGAAGGAGAAGGG - Intergenic
980255000 4:130368223-130368245 CTCTGTATAAAGAGAGAGAATGG + Intergenic
980312973 4:131158748-131158770 CTCTATATATAGAAGTAGATGGG - Intergenic
983329922 4:166312472-166312494 CTCTATTCAGAAAAGAAGAAAGG - Intergenic
983666438 4:170189444-170189466 CTAGAAACAAAGAAGGAAAAGGG - Intergenic
984044976 4:174785768-174785790 CTCTTAAAAAAGAAGAAGAATGG - Intronic
984192174 4:176619288-176619310 CTTTATATAAAGAAGAAGAAAGG + Intergenic
984470506 4:180165576-180165598 TTCTATAAAAAGGTGGAGAAGGG - Intergenic
1202768234 4_GL000008v2_random:170786-170808 ATCTATACAAAGAAGGTGGGTGG + Intergenic
986517880 5:8582220-8582242 CTCTGGTCAAAGTAGGAGAAAGG + Intergenic
987257242 5:16168655-16168677 CCCCATGGAAAGAAGGAGAAGGG - Intronic
988459152 5:31417026-31417048 CTATATGCTAAGGAGGAGAAAGG + Intronic
991435274 5:66591894-66591916 CTCTATAGAAAGAAGGTGGTTGG - Intergenic
992544409 5:77797429-77797451 CTCTAGAAGAAGAAGGTGAAAGG + Intronic
993254978 5:85579203-85579225 CTTTATCCAGAGAAGGAGTAGGG - Intergenic
994611073 5:102040356-102040378 CTCTATACACACAAGGATGATGG + Intergenic
995206261 5:109484995-109485017 CCCTATACACAGAAGCAGACAGG + Intergenic
996701313 5:126452699-126452721 TAGTATACAAAGGAGGAGAAAGG - Intronic
997435929 5:133875566-133875588 CTCTCTACCAGGAAGGACAAAGG - Intergenic
1000823234 5:166011387-166011409 CTCTATAAAATGAATGAGATAGG - Intergenic
1001318220 5:170659564-170659586 CTCTATACAAAGAAGGAGAAAGG - Intronic
1002281735 5:178134284-178134306 CTCTATACAAAGAAGTGCAGAGG + Intronic
1002383161 5:178845103-178845125 CTCTATACCAAGAAGGACAAAGG + Intergenic
1002405594 5:179027718-179027740 CTCCATACAACCAAGGGGAATGG - Intronic
1002829312 6:804803-804825 CTGTTAACAAAGAAGGAGGAAGG - Intergenic
1004173575 6:13318750-13318772 ATATAAATAAAGAAGGAGAAGGG + Intronic
1004986330 6:21087154-21087176 CTCTATCCAAAGACCGAGCAAGG + Intronic
1005030240 6:21501481-21501503 CTGTATGCAAAGAAGGAAGATGG - Intergenic
1008028318 6:46664212-46664234 CTCTATAGATAGATGAAGAATGG - Intronic
1010751610 6:79621746-79621768 GTGTATATCAAGAAGGAGAATGG - Intergenic
1010962718 6:82164745-82164767 GTCTCTACTAAAAAGGAGAAAGG + Intergenic
1011008013 6:82669782-82669804 CTATTTTCAAAGAAGGGGAATGG + Intergenic
1011751350 6:90458326-90458348 CTCTATAAAAAGAACGTGTAGGG - Intergenic
1012779649 6:103541456-103541478 CAATATACAAAGGAGGGGAATGG + Intergenic
1013267262 6:108512207-108512229 CTCTATGCACAGAATGAAAATGG + Intronic
1013600625 6:111701099-111701121 CTTTATAAAAAAAAGAAGAAAGG + Intronic
1013751164 6:113408189-113408211 TTCTAAACAAGGAAGGAGACTGG + Intergenic
1014000488 6:116360523-116360545 CTCTATTTAAAGAGGGATAATGG - Intronic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014958887 6:127657879-127657901 CTTTATACAAAGCAAGATAACGG - Intergenic
1015075809 6:129155924-129155946 CTATATACAAATATGGAAAATGG + Intronic
1015871096 6:137777051-137777073 TTTAATACAAAGAAGCAGAACGG - Intergenic
1015881657 6:137875975-137875997 GTCTGTTCAAAGAAAGAGAAAGG - Exonic
1017401727 6:154072076-154072098 CTATTGCCAAAGAAGGAGAAGGG - Intronic
1018436935 6:163769122-163769144 CTGTATACCAAGAAGAATAAAGG + Intergenic
1019338562 7:496495-496517 CTTTATACAAAAAAGAAAAATGG + Intergenic
1020612823 7:10422271-10422293 CTCTATACTAAGAGGAACAAAGG + Intergenic
1021886889 7:25148061-25148083 CTCTACCCAGGGAAGGAGAAGGG - Intronic
1023753766 7:43396793-43396815 ATCTGTAAAAAGAAGGAAAATGG - Exonic
1023826356 7:44012573-44012595 CTCGAAAGAAAGAAAGAGAAAGG - Intergenic
1024438921 7:49392070-49392092 CTCTAGCACAAGAAGGAGAAGGG + Intergenic
1026024868 7:66736419-66736441 CCCTATAGACAGAAGAAGAAGGG + Intronic
1026089936 7:67291438-67291460 CTCGAAAGAAAGAAAGAGAAAGG - Intergenic
1026310384 7:69178488-69178510 CTCTCTTCAAAGGAGAAGAATGG - Intergenic
1026746520 7:73017423-73017445 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1026750172 7:73045566-73045588 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1026753819 7:73073676-73073698 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1026757470 7:73101712-73101734 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1027032623 7:74901981-74902003 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1027089934 7:75291774-75291796 CTCGAAAGAAAGAAAGAGAAAGG - Intergenic
1027093579 7:75319702-75319724 CTCGAAAGAAAGAAAGAGAAAGG - Intergenic
1027097222 7:75347669-75347691 CTCGAAAGAAAGAAAGAGAAAGG - Intergenic
1027119527 7:75506757-75506779 CTCGAAAGAAAGAAAGAGAAAGG - Intergenic
1027272298 7:76528854-76528876 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1027322124 7:77020000-77020022 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1027325758 7:77047920-77047942 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1028169164 7:87575022-87575044 TTGTATACAAAGTAGGAGAATGG - Intronic
1028783980 7:94771373-94771395 TTCTAAACAAACAAGCAGAATGG + Intergenic
1029005148 7:97201472-97201494 CTCTATAGAAAGACTGAGATTGG - Intergenic
1029398332 7:100324670-100324692 CTCGAAAGAAAGAAAGAGAAAGG - Intergenic
1029717969 7:102343275-102343297 CTCGAAAGAAAGAAAGAGAAAGG + Intergenic
1030755293 7:113280468-113280490 TTCAACACAAAGAAGGAGATAGG - Intergenic
1031061346 7:117054854-117054876 TTCTTTACAAAGATGAAGAAAGG + Intronic
1031126627 7:117781049-117781071 CTCTATAAAAGGCAGCAGAAAGG + Intronic
1031939045 7:127767745-127767767 TTCTTTAGAATGAAGGAGAAAGG - Intronic
1032868694 7:135956565-135956587 CTCTGTATAAAGAAGGATATGGG - Intronic
1034830247 7:154302709-154302731 CTCTTTACTGAGAAGGAAAATGG + Intronic
1034845576 7:154441254-154441276 CTCTTTATAAAGAAAGGGAAGGG - Intronic
1036115092 8:5950843-5950865 CTCTATACAAATAACCAGAAAGG + Intergenic
1036671901 8:10795315-10795337 CTCTAATCAATGAAGCAGAAAGG + Intronic
1037275375 8:17172782-17172804 CTCCATCCAAAGCAGAAGAAAGG - Intronic
1038604279 8:28982922-28982944 CTCTACACAAAGTAGAAGATAGG - Intronic
1038629901 8:29231759-29231781 CTCTAAAAAAAAAAGGAAAAAGG + Intronic
1039409249 8:37338672-37338694 ATAGAAACAAAGAAGGAGAAAGG - Intergenic
1040662095 8:49585178-49585200 ATTTATACAAAGTAGGAAAAAGG + Intergenic
1041693569 8:60713941-60713963 CTTTCTACAAAGAAAGAAAACGG - Intronic
1042108842 8:65357357-65357379 CTTGATAGAAAGAAGGAGAAGGG - Intergenic
1042441890 8:68838347-68838369 CTCTAAACAAAGAGAGAAAATGG - Intergenic
1043880562 8:85537842-85537864 CTCAATACAAAGCAAGAGGATGG - Intergenic
1044718742 8:95125075-95125097 CTAGATACAAAGAAGAAAAAAGG + Intergenic
1045109059 8:98922015-98922037 CTCTGTAGTGAGAAGGAGAAAGG - Intronic
1045705916 8:104922148-104922170 CTCTAAACAAACAAGGAAGAAGG + Intronic
1046778530 8:118190202-118190224 CTCTTTACAGAGTATGAGAAGGG - Intronic
1047487646 8:125346331-125346353 CTCAAGATAAAGATGGAGAATGG + Intronic
1049955256 9:687197-687219 CATTACACAAAGAAGGAAAATGG - Intronic
1050180016 9:2912072-2912094 TTCTATCCAAAGAAGTACAAAGG + Intergenic
1051370843 9:16357822-16357844 CTCTGTAAAAATAAGGATAATGG + Intergenic
1053500405 9:38584356-38584378 ATCTATACAAAGAAGGTGGGTGG + Intergenic
1053660715 9:40275528-40275550 ATCTATACAAAGAAGGTGGGTGG - Intronic
1053911091 9:42904873-42904895 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1054523895 9:66100756-66100778 ATCTATACAAAGAAGGTGGGTGG + Intergenic
1054680465 9:67911521-67911543 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1054750853 9:68904804-68904826 TTCTATAGAAAGAATGAAAATGG + Intronic
1054967953 9:71051392-71051414 CTCTTTGAAATGAAGGAGAATGG - Intronic
1055813135 9:80175087-80175109 ATGTATACAAAGAAGGTTAAAGG + Intergenic
1057679798 9:97168782-97168804 ATCTATACAAAGAAGGTGAGTGG + Intergenic
1058097496 9:100879720-100879742 CTCTTTACAAAGTAGGTGATTGG + Intergenic
1058568599 9:106314656-106314678 TTCTTTTGAAAGAAGGAGAAAGG - Intergenic
1059234795 9:112751823-112751845 CTCCGTACAAAGAAGGTCAAAGG - Intronic
1059285864 9:113170995-113171017 CTCTAACCACAGAAGAAGAATGG - Intronic
1060364650 9:122998576-122998598 ATCTAAACAAAGAAAGAGAGAGG - Exonic
1060679769 9:125551895-125551917 CTTTAGACAAAGTAGGACAAGGG - Intronic
1061098475 9:128473797-128473819 CTTTTTACAGACAAGGAGAAAGG - Intronic
1062496666 9:136835095-136835117 CTCTATTTAAAAAAAGAGAAGGG + Intronic
1203706419 Un_KI270742v1:52900-52922 ATCTATACAAAGAAGGTGGGTGG - Intergenic
1186548842 X:10480977-10480999 ATTTATTCAAAGAAAGAGAAAGG - Intronic
1187061298 X:15789735-15789757 CCCTTTACCCAGAAGGAGAAGGG - Intergenic
1187537236 X:20153428-20153450 CTCTATGCAATTAAAGAGAAAGG - Exonic
1187625504 X:21108303-21108325 CTCTCTACCAGGAAGGACAAAGG + Intergenic
1188757417 X:33979838-33979860 CTACATACCAAAAAGGAGAATGG + Intergenic
1189545848 X:42042052-42042074 CTCTATACACACATGGAGAGAGG + Intergenic
1190438587 X:50453138-50453160 CTCTAAACAAAGTGGGATAATGG - Intronic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1192540322 X:71963918-71963940 GTCTCTAAAAAGAAAGAGAAAGG + Intergenic
1193459185 X:81769984-81770006 TTATATATAAAAAAGGAGAAAGG + Intergenic
1194490853 X:94547348-94547370 CTTTGTATAAAGAAGCAGAAAGG + Intergenic
1195441513 X:104904107-104904129 CAATATACAAATAAGGAGAGAGG - Intronic
1196188346 X:112768939-112768961 CGATATACAAAGTAGGAGAATGG + Intergenic
1196429642 X:115609138-115609160 CCCAAAACAAAAAAGGAGAAAGG + Intronic
1197546481 X:127831554-127831576 CTCAATACAATGGAAGAGAAAGG + Intergenic
1199863826 X:151825413-151825435 CCCCACACAAAGAGGGAGAATGG + Intergenic
1201458098 Y:14193378-14193400 CATTGAACAAAGAAGGAGAAAGG + Intergenic