ID: 1001324104

View in Genome Browser
Species Human (GRCh38)
Location 5:170707634-170707656
Sequence GTCAGCACAAATGTTGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 131}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001324104_1001324109 9 Left 1001324104 5:170707634-170707656 CCCACCTCAACATTTGTGCTGAC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 1001324109 5:170707666-170707688 ACATTAAAAACATACCCATTTGG 0: 1
1: 0
2: 1
3: 29
4: 340

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001324104 Original CRISPR GTCAGCACAAATGTTGAGGT GGG (reversed) Intronic
903658534 1:24963374-24963396 GTCAGCAGAGATGCAGAGGTGGG - Intronic
906625201 1:47319406-47319428 ATCAGCATAACTATTGAGGTTGG - Intergenic
907783715 1:57591392-57591414 ATCACCACAAATGTTCAGGAAGG + Intronic
912627081 1:111214358-111214380 GTGAGCACAAAGGGTGAAGTTGG + Intronic
921575851 1:216833850-216833872 GATAGCACATATGTTGAGGCTGG + Intronic
923117636 1:230958223-230958245 GACAGCACAAATGAAGAGTTAGG - Exonic
923974562 1:239247285-239247307 GTTATCACAAATGTAGAGTTTGG - Intergenic
1063747183 10:8897845-8897867 GTCAGCAAAAAAGGTGGGGTGGG + Intergenic
1067477000 10:46573919-46573941 GCCAGCACAGGTGCTGAGGTGGG - Intergenic
1067617739 10:47767862-47767884 GCCAGCACAGGTGCTGAGGTGGG + Intergenic
1075202080 10:120412818-120412840 TTAGACACAAATGTTGAGGTTGG - Intergenic
1075602302 10:123778916-123778938 GTCAGCACAGACTTAGAGGTGGG - Intronic
1077992535 11:7424785-7424807 GTATGCACAAAGGTTGAGCTTGG - Intronic
1085331509 11:75655708-75655730 GACAGCATAAAGGTTGAAGTTGG + Intronic
1088468361 11:110165775-110165797 TTCAGCTCAAATGCTGAGGGAGG + Exonic
1090467212 11:126945195-126945217 GACAGCAGAAAGGTGGAGGTGGG - Intronic
1093263872 12:16976030-16976052 GACAGCATAAATGATGAGATGGG - Intergenic
1095119374 12:38397689-38397711 TTCAGTAAAAATGTAGAGGTTGG - Intergenic
1096209544 12:49753660-49753682 TTTAGCATAAATGTAGAGGTGGG + Intronic
1096631561 12:52930030-52930052 GTCAGCAAAAGTGCTGAGGATGG + Intronic
1098343288 12:69473444-69473466 GTGAGCAGAAGTGTGGAGGTGGG + Intronic
1100484921 12:95015883-95015905 GTGAGCTCAAATAGTGAGGTTGG - Intergenic
1103937112 12:124482622-124482644 GGCAGCACAGCTGTGGAGGTGGG + Intronic
1104245998 12:127041952-127041974 GTCATCCCCAGTGTTGAGGTGGG - Intergenic
1110336030 13:74331067-74331089 TTCATCACAAATGCTGAGCTGGG - Intergenic
1110969134 13:81739481-81739503 ATCAGCACCCATGTTGAGCTGGG + Intergenic
1111216710 13:85152403-85152425 ATCAGCAGAAATGTTGAGGCTGG - Intergenic
1115620714 14:35137350-35137372 AAGAGCACAAATGTGGAGGTTGG + Intronic
1115660837 14:35493074-35493096 GTCAGCAAAAATGGTGGAGTAGG - Intergenic
1119187736 14:72655033-72655055 TTCAGCACAAATGTTCATGCTGG + Intronic
1121940110 14:98062587-98062609 GACAGCAGAAATCTTGATGTTGG - Intergenic
1122491743 14:102121595-102121617 GTTAGCACAGATGTTAATGTTGG - Intronic
1131469148 15:92681193-92681215 TTCAGTACACATGTTGAGGGGGG - Intronic
1131674337 15:94655530-94655552 CTCAGCACAAATATTGGGCTCGG + Intergenic
1140918193 16:79512540-79512562 GTCAGCTCAGATGGTGAGCTGGG - Intergenic
1146969728 17:37062885-37062907 CTCAGCACAACTGTGCAGGTGGG + Intergenic
1148444884 17:47731523-47731545 ATCAGCACATCTTTTGAGGTTGG - Intergenic
1149159379 17:53672437-53672459 TGCAGCACAAATGTTGGGGGGGG + Intergenic
1149340196 17:55677812-55677834 AGCAGCTCAAATATTGAGGTGGG + Intergenic
1150247122 17:63684846-63684868 CTCTGCACAAAAGTTGGGGTGGG - Intronic
1153314274 18:3706602-3706624 GCAAGCATAAATGTTGATGTTGG + Intronic
1156721487 18:40075596-40075618 GTCAGCACAAACCATGACGTGGG - Intergenic
1158529150 18:58242610-58242632 GCCACCACAGAGGTTGAGGTGGG - Intronic
1159024299 18:63168439-63168461 CCCAGGCCAAATGTTGAGGTGGG + Intronic
1159474886 18:68908472-68908494 GTCAGCAAAAATGGCAAGGTAGG - Intronic
1163233748 19:16019677-16019699 GTCAGCACAAAGGCAGAGGGAGG + Intergenic
1167203730 19:48085990-48086012 GTCAGCCAAAAAGTTCAGGTGGG + Intronic
928736411 2:34295910-34295932 GTCTGCACCAATGATGAGGGTGG - Intergenic
929945739 2:46370451-46370473 CTTAACACATATGTTGAGGTAGG + Intronic
930042983 2:47143124-47143146 ACCATTACAAATGTTGAGGTTGG - Intronic
930283658 2:49401579-49401601 GACAGCACAAATGATGAAATTGG + Intergenic
932001625 2:67890451-67890473 GTCTGCAGATATGTTGAGGTGGG - Intergenic
933053319 2:77629447-77629469 GTGAGTACAAATTTTGTGGTGGG - Intergenic
933164500 2:79061232-79061254 AGAAACACAAATGTTGAGGTAGG - Intergenic
934536393 2:95137851-95137873 GTAATCACTAATGTTGAGGTTGG + Intronic
938183944 2:129211222-129211244 GTCAGGTCAAATGGTGAGGATGG + Intergenic
940612714 2:156010544-156010566 GTCAGCACAGCTGATGAGGGAGG - Intergenic
940765582 2:157786460-157786482 GTCAGCACAGATCTTAAGGCAGG + Intronic
942668584 2:178349267-178349289 ATCTGCACAAAGGTTGGGGTTGG - Exonic
942993118 2:182226799-182226821 GTCTGCAGAAATGCTCAGGTTGG + Intronic
945332292 2:208553484-208553506 GTCAGCAAAAATGATGAAATAGG - Intronic
948934844 2:241157002-241157024 TTCAGCACACATGCTGAAGTAGG + Intronic
1168878607 20:1187040-1187062 GCCAGCGCAAAGGCTGAGGTAGG - Intronic
1175195679 20:57241736-57241758 GCCTGCACAGATGTTGGGGTAGG + Intronic
1176686924 21:9857349-9857371 ATCAGCACAAATGCAGATGTGGG - Intergenic
1177957825 21:27622707-27622729 ATGAGCACAAATGTTTTGGTGGG - Intergenic
1178995979 21:37400222-37400244 GCCATCACAAATGTTGAGAGAGG - Intronic
1182411502 22:30190704-30190726 GCCAGCAAAAGTGTTGAGATTGG + Intergenic
1182905068 22:33928874-33928896 GTCAGGACAAATGTCAGGGTTGG - Intergenic
1183993728 22:41617532-41617554 GACAACACAAATCTTGAAGTTGG - Intronic
1184815844 22:46869081-46869103 GTCAGCAGAAATGTGAAGGATGG - Intronic
1185419878 22:50729305-50729327 GACAGCACAGAGGTTGGGGTGGG + Intergenic
949535167 3:4989649-4989671 CTCAGCAAAGATGTGGAGGTGGG + Intergenic
954720831 3:52561457-52561479 GTAAGCACACATGTTGAGCTAGG - Intronic
955458666 3:59154768-59154790 GTAAGCACACATATTGGGGTTGG + Intergenic
956142011 3:66155565-66155587 GTCAGCAAATATTTTGAGGATGG + Intronic
956378881 3:68644959-68644981 GTCAGCTCAAATGTTCATGGGGG + Intergenic
956837708 3:73109284-73109306 GTCAGGCAAAAAGTTGAGGTTGG - Intergenic
958445616 3:94211081-94211103 GTAATCACAAATATTGAGATGGG + Intergenic
962352011 3:134663305-134663327 GTATTCACAAATGTTTAGGTAGG + Intronic
962804732 3:138918634-138918656 ATCAGCAGAATTGTTGAAGTGGG - Intergenic
963293538 3:143519220-143519242 GGGAGATCAAATGTTGAGGTAGG + Intronic
963759264 3:149270010-149270032 TTCAGCACACATGGTGAGATTGG + Intergenic
964164239 3:153682338-153682360 GTGGACACAAAGGTTGAGGTTGG - Intergenic
965213323 3:165825407-165825429 GTCTTCACAAATGTTGGTGTAGG + Intronic
965674641 3:171181802-171181824 GTCACCAGAAATCTAGAGGTAGG - Intronic
969645273 4:8424820-8424842 GTCAGTATACAAGTTGAGGTCGG - Intronic
970841968 4:20484241-20484263 GTCAGCATAAATTTTGAGGATGG + Intronic
972137111 4:35905851-35905873 GTCAGCACAAAACTGGAGGCAGG - Intergenic
978304571 4:107311703-107311725 GGCAACACAAATGTAGAGTTAGG + Intergenic
978957385 4:114631108-114631130 GTCAGTATAAATATTGGGGTTGG - Intronic
979841689 4:125449990-125450012 GTCACCAAAAATGTTAAGGTTGG + Exonic
980350311 4:131675498-131675520 ATCAGCACAAATGCAGATGTGGG - Intergenic
981430575 4:144654276-144654298 GTCACCACATATGTTGATCTGGG - Intronic
982539239 4:156646735-156646757 TTAAGCACATATGTTGAGCTTGG + Intergenic
988968341 5:36441931-36441953 GGGAGAACAAATGTTGAGGCTGG - Intergenic
990892594 5:60664620-60664642 ATCAGTACACAAGTTGAGGTCGG - Intronic
991281818 5:64923163-64923185 GTCAGCAAAAGTGCTGAGGTGGG + Intronic
991962180 5:72056133-72056155 GGCAGCATCAATGTTGATGTTGG + Intergenic
995126153 5:108578538-108578560 ATCAGTATAAAAGTTGAGGTCGG + Intergenic
995588639 5:113675025-113675047 GTGGACACAAAGGTTGAGGTTGG + Intergenic
997663770 5:135610320-135610342 GTCAGCACATATGTGAGGGTTGG - Intergenic
1001324104 5:170707634-170707656 GTCAGCACAAATGTTGAGGTGGG - Intronic
1003012751 6:2441303-2441325 GTCAGCACAGATGGGGATGTGGG - Intergenic
1003124577 6:3346226-3346248 GTCAGCAGAGACGTTGAGCTGGG - Intronic
1005699673 6:28387876-28387898 GTCAGTACAAATGTTGGGCTCGG - Intronic
1006983167 6:38161863-38161885 GTCAGCCCAAAGGTTGGGGTGGG - Intergenic
1007230864 6:40346967-40346989 GTCAGCTCAAGTGTGGAGGCAGG - Intergenic
1008076659 6:47152832-47152854 GTCAGCACAAATATTGCAGAGGG + Intergenic
1008374730 6:50778637-50778659 GCCAGCATTAATCTTGAGGTGGG - Intergenic
1009757549 6:67958695-67958717 GTAAGCAAAAGTGTTGAGATAGG - Intergenic
1011884239 6:92073960-92073982 GTCAGCACAATTGTACAGCTGGG + Intergenic
1013572752 6:111446198-111446220 ATCAGAATAAATGCTGAGGTTGG + Intronic
1019374870 7:684026-684048 ATCAGCACACGTGTGGAGGTGGG - Intronic
1019374887 7:684113-684135 ATCAGCACACACGTAGAGGTGGG - Intronic
1023160111 7:37288680-37288702 GTTAGCACAAATCTTGATGGCGG + Intronic
1024039615 7:45542136-45542158 GTCAGCACAAATGAAGAAGGGGG - Intergenic
1026375469 7:69746174-69746196 GTCATAAAAAATGTTGATGTAGG - Intronic
1028802215 7:94979095-94979117 ATCACTACAAATGTTGATGTTGG - Intronic
1033971140 7:147041006-147041028 GTCAACACCAATGTGGTGGTAGG - Intronic
1034434627 7:151057466-151057488 GGCTGCAGAAATATTGAGGTTGG + Intronic
1035982241 8:4385371-4385393 TTCAGAACAAATGTTAAGGCTGG - Intronic
1039912491 8:41836041-41836063 TCCAGCACAGATGTTCAGGTCGG + Intronic
1040789245 8:51205814-51205836 GTCAGCAAAAGTGTTGTGGTGGG + Intergenic
1045332924 8:101171661-101171683 GGCATCACAAATTTTCAGGTAGG + Intergenic
1045499645 8:102735272-102735294 TTCTGCACACATGTTGAGTTAGG + Intergenic
1047220443 8:122914346-122914368 GTAACCACAAATGGTGAAGTGGG + Intronic
1048204719 8:132406185-132406207 GTCAGAACAGATGTTGGGCTTGG + Intronic
1054170352 9:61834370-61834392 CTCAGCACAAATGCAGATGTGGG + Intergenic
1054667185 9:67746445-67746467 ATCAGCACAAATGCAGATGTGGG - Intergenic
1062585947 9:137250107-137250129 CTCTGCCCAAATGTTGAGGGAGG - Intergenic
1188247420 X:27853226-27853248 GACAGCACAAAAGTTTGGGTTGG + Intergenic
1189393893 X:40602871-40602893 GTCAGCACATGTGTTGAGAGTGG + Intronic
1190058593 X:47196538-47196560 GCCTGAGCAAATGTTGAGGTAGG + Intronic
1192278605 X:69660036-69660058 ACCAGCACAAATGTTATGGTCGG - Intronic
1192830761 X:74748808-74748830 CTCAACACAAATGTTGGTGTGGG - Intronic
1194125873 X:90015768-90015790 GTCATCGCTAATGTTGAAGTTGG - Intergenic
1197331688 X:125160431-125160453 GGCAGGAGAATTGTTGAGGTAGG + Intergenic
1197979207 X:132198026-132198048 GTTAGCATAAAAGGTGAGGTTGG + Intergenic
1198010577 X:132549446-132549468 CACAGCAGAAATGGTGAGGTTGG + Intergenic
1201964507 Y:19717007-19717029 GTCACCAAAAATGATGAAGTTGG + Intronic
1202111744 Y:21427904-21427926 GTCATCACCAATAGTGAGGTGGG - Intergenic