ID: 1001327237

View in Genome Browser
Species Human (GRCh38)
Location 5:170737987-170738009
Sequence GGGTCCTAACCTGCATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001327229_1001327237 15 Left 1001327229 5:170737949-170737971 CCCAAGAGAGGATCTGTCCTAGA No data
Right 1001327237 5:170737987-170738009 GGGTCCTAACCTGCATCTTGAGG No data
1001327232_1001327237 -2 Left 1001327232 5:170737966-170737988 CCTAGAGACTCTTCCCATATGGG No data
Right 1001327237 5:170737987-170738009 GGGTCCTAACCTGCATCTTGAGG No data
1001327230_1001327237 14 Left 1001327230 5:170737950-170737972 CCAAGAGAGGATCTGTCCTAGAG No data
Right 1001327237 5:170737987-170738009 GGGTCCTAACCTGCATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001327237 Original CRISPR GGGTCCTAACCTGCATCTTG AGG Intergenic
No off target data available for this crispr