ID: 1001332450

View in Genome Browser
Species Human (GRCh38)
Location 5:170771999-170772021
Sequence GAGCAGTGGCCTTAGGTCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 207}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001332450_1001332457 11 Left 1001332450 5:170771999-170772021 CCCCTGACCTAAGGCCACTGCTC 0: 1
1: 0
2: 0
3: 28
4: 207
Right 1001332457 5:170772033-170772055 CTCCCCAAACAAAGGCATTTAGG No data
1001332450_1001332455 3 Left 1001332450 5:170771999-170772021 CCCCTGACCTAAGGCCACTGCTC 0: 1
1: 0
2: 0
3: 28
4: 207
Right 1001332455 5:170772025-170772047 ACCTGCTACTCCCCAAACAAAGG 0: 1
1: 0
2: 0
3: 10
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001332450 Original CRISPR GAGCAGTGGCCTTAGGTCAG GGG (reversed) Intronic
900290693 1:1922408-1922430 GAGAAGAGGCCTTCAGTCAGTGG + Intronic
900368666 1:2321819-2321841 GGGCTGTGGCCTGAGGTCAGAGG - Intronic
900483027 1:2908548-2908570 GAGGCGTGGCCTAAGGTCAGAGG - Intergenic
901461252 1:9393085-9393107 GAGCAGTGCCCTTCAGTCAAGGG + Intergenic
902600354 1:17536693-17536715 GAGGAGGGGCCTTAAATCAGAGG + Intergenic
905262827 1:36731417-36731439 GAGGAGAGCCCTGAGGTCAGAGG - Intergenic
905370869 1:37482147-37482169 GAGCAGAGGCCATGGGCCAGTGG + Intronic
905470018 1:38184901-38184923 GAGAAGATGCTTTAGGTCAGCGG + Intergenic
905559653 1:38916389-38916411 GAGAAGTTGCCATAGATCAGAGG + Intronic
907366036 1:53960992-53961014 GAGCAGTGGTTTGAGGTCTGAGG + Intronic
907393978 1:54177031-54177053 GAGCTGTGGCCTGATGTCATGGG - Intronic
908381794 1:63603819-63603841 GAGCAGGGGCCTGTGGTCACTGG + Intronic
910902122 1:92132414-92132436 GACCAGTGGGCAGAGGTCAGTGG + Intronic
911056865 1:93716338-93716360 CAGCACTGGCCTGAAGTCAGCGG + Intronic
912480898 1:109981561-109981583 AAGGAGTGGCCTAAGGGCAGTGG - Intergenic
915450698 1:156002999-156003021 CAGCAGGGTCCTCAGGTCAGTGG + Intronic
916265002 1:162881926-162881948 GAGCCCAGGCCTTAGGTCACAGG - Intergenic
917640661 1:176980343-176980365 GAGCTGAGGCCTGAGGACAGTGG + Intronic
918187086 1:182137631-182137653 GGGAAGAGGCCTGAGGTCAGAGG - Intergenic
1065809120 10:29424976-29424998 GAGAAGTGGCCTAAGGTCATAGG - Intergenic
1066464544 10:35640888-35640910 GAGCAGCCGCCTTCGGGCAGCGG - Exonic
1067430023 10:46236703-46236725 GAGCAGAGCCCTTAAGGCAGAGG - Intergenic
1067711135 10:48652034-48652056 GAGCAGCTGCCATAGTTCAGGGG + Intronic
1068383114 10:56285138-56285160 AAGCAGGGGCCATAGGGCAGGGG - Intergenic
1069770166 10:70893570-70893592 GAACAGGGGGCTTAGGACAGGGG - Intergenic
1070920464 10:80182106-80182128 GAGTAGTTGCCAGAGGTCAGGGG + Intronic
1072605866 10:96982266-96982288 GAGCAGCTCCCCTAGGTCAGAGG + Exonic
1073263363 10:102207470-102207492 GAGCTGTGACCTTTGGTCAAGGG - Intergenic
1075399637 10:122151682-122151704 GAGGAGAGGCCAGAGGTCAGAGG + Intronic
1076202270 10:128568061-128568083 GAGGAGTGGCCCTTGGCCAGGGG + Intergenic
1078064356 11:8068264-8068286 CAGGAGGGGCCTGAGGTCAGTGG - Intronic
1078801184 11:14644797-14644819 GAGCAGCGGCCTGAGGGCGGAGG - Exonic
1081701296 11:45154550-45154572 AAGCAGCAGCCTTAGATCAGGGG + Intronic
1081851481 11:46277914-46277936 GCGCGGGGGCCTTAGGGCAGCGG - Exonic
1083366035 11:62141914-62141936 GAGCAGTAGCCTTGAGGCAGTGG + Intronic
1083386344 11:62313057-62313079 GAGCTGTGGCCTTTGGTCAAGGG - Intergenic
1083593824 11:63909797-63909819 GCCCAGGGGCCTGAGGTCAGGGG - Exonic
1083860795 11:65418941-65418963 GAGTGGTGACCTTAGGGCAGAGG + Intergenic
1083882417 11:65555136-65555158 GAGCAGTGGCCCTAGGGAGGAGG - Intronic
1084216063 11:67647485-67647507 GTGCAGGGGTCTCAGGTCAGGGG + Intronic
1085271582 11:75273134-75273156 GAGCAGTGCCCTTAGGTAGCAGG + Intronic
1085686843 11:78631225-78631247 GAGCAATGGCCTGAAATCAGGGG + Intergenic
1089185689 11:116613269-116613291 GAGCAGTGCCCTTTGGGCTGAGG - Intergenic
1091333893 11:134752616-134752638 GAACAATGGCCTTAGGTGAACGG - Intergenic
1095324227 12:40868561-40868583 GAGCAGGGGAGTTAGGTCCGTGG - Intronic
1095459710 12:42430171-42430193 GATCATTGGCCTTTGGTGAGCGG - Intronic
1096628254 12:52908137-52908159 GAGCAGTGGCATTAAGTCTTGGG + Intronic
1098401801 12:70084714-70084736 CAGCAGTTGCCTAAGGTCAGGGG + Intergenic
1102826086 12:115948894-115948916 GAGCACTGGCCCCAGGACAGTGG + Intergenic
1104807063 12:131596406-131596428 TAGCAGTGGCCTTGGGTAGGTGG - Intergenic
1112803691 13:103138937-103138959 GAGAAGGAGCCTTAGGTAAGTGG + Intergenic
1113511120 13:110855488-110855510 GTGCTGTGTCCTTAGGCCAGAGG - Intergenic
1113543925 13:111131671-111131693 GGGCAGTGACCTGAGGTCAGGGG + Intronic
1115410553 14:33069090-33069112 AAGCAGGGGACTTAGCTCAGAGG + Intronic
1116806700 14:49501063-49501085 GAGCAGTCCCCTTATTTCAGAGG - Intergenic
1116991969 14:51286406-51286428 GAGCTGTGGCCTTTGGTAAAGGG - Intergenic
1117642301 14:57812827-57812849 GAGCAGTTGCATTATGTCATAGG - Intronic
1117771772 14:59140738-59140760 AAGAAGTGGGCTTTGGTCAGAGG - Intergenic
1117923821 14:60754697-60754719 GAGAAGTGGCTTTTGTTCAGAGG + Intronic
1119336225 14:73835960-73835982 GATCAGTCACCTGAGGTCAGGGG + Intergenic
1127912283 15:63427397-63427419 GAGCAGAGTTCTTGGGTCAGAGG - Intergenic
1128663896 15:69524314-69524336 CAGCAGTGGTCAGAGGTCAGGGG + Intergenic
1129210396 15:74064823-74064845 GAGAGGTGGCCTTGGGCCAGTGG + Intergenic
1129869051 15:78929235-78929257 GAGCAGTGGGCTCAGGTGGGTGG + Intronic
1130413979 15:83672840-83672862 GAGCAGTGGCCTTACTTCTTAGG + Intronic
1131051719 15:89352603-89352625 GAGCAGAGGCCGTGGGGCAGTGG - Intergenic
1131100000 15:89680654-89680676 GAGTAGTGGCTTTGGGCCAGAGG + Intronic
1131210884 15:90495332-90495354 GATCAGTAGCCTGAGGTCACAGG - Intronic
1133284663 16:4685000-4685022 GAGCAGTGGCCTGTGCTCATGGG + Intronic
1134065648 16:11226281-11226303 GAACAGTGGCCTTAAGTCACGGG + Intergenic
1136171469 16:28492241-28492263 GAGCCGTGACCTTAGATCAGTGG + Intronic
1137067443 16:35863211-35863233 GAGGTGTGGACTCAGGTCAGGGG - Intergenic
1137492884 16:48947901-48947923 CAGGACTGGCCTTAGGTCAGTGG - Intergenic
1137511231 16:49102509-49102531 GAGAAGTGGCCTGAAGTAAGAGG - Intergenic
1137569241 16:49554168-49554190 GAGCTGTGGCCTCAGGTGTGGGG - Intronic
1139654838 16:68381214-68381236 GAGCAGTGGCCTGGGGTTAGAGG - Intronic
1140199696 16:72885198-72885220 GAGCTCTGCCCTTATGTCAGTGG - Intronic
1142002328 16:87670898-87670920 GAGAAGTGACATTTGGTCAGAGG + Intronic
1143045078 17:4071680-4071702 GAGCAGTGGCTTCAGGCCTGGGG + Intronic
1143623776 17:8096391-8096413 GTGCATTGGACTTTGGTCAGCGG + Exonic
1145869005 17:28258411-28258433 GAGCTGTGCCCTTGGCTCAGAGG - Intergenic
1146305726 17:31728594-31728616 GTGCAGGGGGCTTATGTCAGTGG + Intergenic
1147998543 17:44374853-44374875 TTGCAGTGGGATTAGGTCAGAGG - Intronic
1148114106 17:45164826-45164848 GAGCAGGGGGCTTAGGACAGAGG + Intronic
1148340521 17:46870753-46870775 GAGCTGTGCCCTTGGCTCAGAGG + Intronic
1148565041 17:48627592-48627614 GAGCAGGAGCCTCAGGTGAGAGG - Intronic
1151991227 17:77575903-77575925 GTGCTGTGGCCTGAGGGCAGGGG - Intergenic
1155287558 18:24306613-24306635 TATCAGTGTCATTAGGTCAGTGG + Intronic
1155986565 18:32236554-32236576 GAGAAAAGGCCTTAGGTGAGAGG - Intronic
1156740309 18:40318599-40318621 GAGCAGTGGTCTTATGTCCCAGG - Intergenic
1158804100 18:60948245-60948267 GAGTAGTGGCCTTACATAAGAGG - Intergenic
1159030540 18:63226160-63226182 GAGAAGTGGCTTGAGTTCAGAGG - Intronic
1159364931 18:67453659-67453681 GAGTATTAGCCTTAGATCAGTGG + Intergenic
1160858599 19:1228227-1228249 GCGCAGTGGCCTTGGGGGAGAGG - Exonic
1162382696 19:10340785-10340807 GGTCAGAGGCCTGAGGTCAGAGG - Intergenic
1165118002 19:33540710-33540732 GAGCAGGGGGCTTGGCTCAGCGG - Intergenic
1165140731 19:33698579-33698601 GGGCAGTGGTCTTGGTTCAGGGG + Intronic
1165383818 19:35498815-35498837 GAGAAGGGGCCTGAGGCCAGAGG - Intronic
1167728323 19:51234469-51234491 GAGCACTGGTCTTTGGACAGAGG - Intronic
925745799 2:7042538-7042560 GAGGACTGGCCTTAGCCCAGTGG + Exonic
926026244 2:9547531-9547553 AAGGAGAGGCCTTAGGTCAAGGG + Intronic
926440141 2:12879894-12879916 CAGCAGATGCCTTAGGACAGAGG - Intergenic
927400325 2:22703605-22703627 TGGCAGTGGCCTTAGGCAAGTGG - Intergenic
927981551 2:27377976-27377998 GAGCAGAGGCATAAGGACAGCGG + Exonic
928411716 2:31059486-31059508 GAGGTGGGGCCTTAGGTCATGGG + Intronic
931191164 2:60001739-60001761 GAGCAGGGGCCTGAGGGCTGGGG - Intergenic
932635960 2:73387775-73387797 GAGCAGTAGCCATAGGTCAAGGG + Intronic
932948599 2:76266633-76266655 GAGCACTGGCCTTCGGTGGGAGG + Intergenic
934702186 2:96451404-96451426 GAGCAGTGGACTGAGGTGATGGG - Intergenic
935047396 2:99494425-99494447 TAGTAGTGGTCTTAGGACAGAGG + Intergenic
935451090 2:103210348-103210370 AAGCAGTTGCCTTTGGTCAGAGG + Intergenic
936020047 2:108988031-108988053 GAGCAGTGGCCTGGGGACTGGGG + Intronic
936552965 2:113465889-113465911 CAGCAGAGGCCTTAGGTGAATGG + Intronic
937334377 2:121052518-121052540 GAGCATTGGTCCTGGGTCAGTGG + Intergenic
938273945 2:129999304-129999326 GAGCAGTGGCTGTAGAACAGCGG - Intergenic
938620605 2:133048900-133048922 CAGCAGAGGCCTAAGGGCAGGGG + Intronic
940816566 2:158303809-158303831 GAGCTGTGGCCTTGATTCAGTGG + Intronic
941273310 2:163457971-163457993 GAGAAGTCGCCTTAGGTATGAGG - Intergenic
946548350 2:220772154-220772176 TAGAGGTGGCCTTTGGTCAGAGG - Intergenic
947461055 2:230305687-230305709 GAGCAGTGGCCACACTTCAGGGG + Intronic
1168844828 20:936945-936967 GACCAATGGCCTTAGGGCTGAGG - Intergenic
1169877944 20:10318090-10318112 GAGCTGTGGCCTTTGGTGAAGGG + Intergenic
1174081509 20:47973544-47973566 CAGCACTGGCTTTGGGTCAGGGG - Intergenic
1174134989 20:48373342-48373364 CAGCACTGGCTTTGGGTCAGGGG + Intergenic
1174297824 20:49561462-49561484 GAGAAGTGGCCTTAGCCCAGGGG - Intronic
1176199863 20:63855357-63855379 GAGCTGTGGCCGCAGGGCAGTGG + Intergenic
1178417328 21:32414110-32414132 GTGGAGAGCCCTTAGGTCAGAGG + Intronic
1180761720 22:18215368-18215390 GTGCAGTGGTGTTAGCTCAGTGG + Intergenic
1180773947 22:18409242-18409264 GTGCAGTGGTGTTAGCTCAGTGG - Intergenic
1180805295 22:18658786-18658808 GTGCAGTGGTGTTAGCTCAGTGG - Intergenic
1180805447 22:18710622-18710644 GTGCAGTGGTGTTAGCTCAGTGG + Intergenic
1181070007 22:20327956-20327978 GTGCAGTGGTGTTAGCTCAGTGG - Intergenic
1181193050 22:21156167-21156189 GTGCAGTGGTGTTAGCTCAGTGG - Intergenic
1181216394 22:21336407-21336429 GTGCAGTGGTGTTAGCTCAGTGG + Intergenic
1182114425 22:27747364-27747386 CTGCAGTGGCCTCAGGTCTGAGG + Intergenic
1183332737 22:37230090-37230112 GAGCTGTGGCCCTAGGACAGGGG + Intronic
1184128300 22:42502535-42502557 CGGCAGTTGCCTGAGGTCAGAGG - Intergenic
1184137090 22:42555848-42555870 CGGCAGTTGCCTGAGGTCAGAGG - Intronic
1184343353 22:43898227-43898249 CAGCCACGGCCTTAGGTCAGAGG + Intergenic
1185091293 22:48776255-48776277 GGGCAGTGGCCTTCTGTCAATGG + Intronic
1203235778 22_KI270731v1_random:150215-150237 GTGCAGTGGTGTTAGCTCAGTGG - Intergenic
949859763 3:8494578-8494600 GAGCTGTGGCTTTAGGTAGGGGG + Intergenic
950547743 3:13648589-13648611 GAGCAGAGGCCAGAGGTCTGTGG + Intergenic
951156152 3:19355732-19355754 GTGCAGTGGGGTTAGGTGAGAGG + Intronic
951319323 3:21225917-21225939 GAGAAGTGGCCTGACTTCAGAGG + Intergenic
951678755 3:25272682-25272704 GAGAACAGGCCTTAGGGCAGTGG - Intronic
952493656 3:33896848-33896870 CAGAACTGGCCTTTGGTCAGAGG - Intergenic
953478249 3:43224890-43224912 GAGCAGTAGCCTTATTTCAGTGG + Intergenic
954421646 3:50422041-50422063 AAGCAGTGCCTTTGGGTCAGGGG - Intronic
955126470 3:56117095-56117117 GAGCAGAGGCTTTGTGTCAGAGG - Intronic
957224866 3:77430368-77430390 AAGGAGTGGCCATTGGTCAGAGG + Intronic
957354061 3:79059290-79059312 GAGCTGAGGCATTAGATCAGGGG + Intronic
957553029 3:81731288-81731310 TAGCAGTGATCTTAGTTCAGGGG - Intronic
957717139 3:83942681-83942703 GAGAAGTGGCTTTATTTCAGAGG - Intergenic
960625392 3:119677117-119677139 GGGCAGAGGCCGTAGGGCAGAGG + Intronic
962292028 3:134145394-134145416 GGGCACTGGCCCCAGGTCAGGGG + Intronic
963311527 3:143715246-143715268 GAGCAGTGGCCTTTGAGCAAAGG - Intronic
964213295 3:154251816-154251838 GAGCAGTCACCTTTGGACAGAGG + Intronic
964237171 3:154545230-154545252 GAGCTGAGGCCTTAGGTATGGGG + Intergenic
964645627 3:158956152-158956174 GAGGAGGGGCCTGAGGGCAGAGG + Intergenic
968623631 4:1615873-1615895 GAGCAGCGACGTTAGGGCAGGGG + Intergenic
968763535 4:2455987-2456009 GAGCAGTGCCCAAAGTTCAGAGG - Intronic
969116712 4:4874717-4874739 GGGCAGTGGCCTGAGGGAAGAGG + Intergenic
969410543 4:7025248-7025270 AAGAAGTGGGCTCAGGTCAGCGG + Exonic
970194772 4:13543087-13543109 GAGCCGAGGCCTTAGATGAGAGG + Intronic
971076088 4:23151555-23151577 GAGAAGTGGCTTGATGTCAGAGG + Intergenic
975964532 4:79954781-79954803 GGGCAGAGGCCAGAGGTCAGAGG + Intronic
976613477 4:87052846-87052868 TAGGAGTGGCCTGAGGTGAGGGG + Intronic
983453838 4:167938139-167938161 GAACAGTAGCCTTCTGTCAGAGG + Intergenic
983491572 4:168396422-168396444 GAGCAGTGGCCAGAGCACAGTGG + Intronic
984105561 4:175541215-175541237 GAGAAGTGGCCTGACTTCAGGGG - Intergenic
986708671 5:10471700-10471722 GAGCTGTGGCTTTAGTACAGGGG + Intronic
989415881 5:41175086-41175108 GAGGACTGGTCTTAGGTCAAGGG - Intronic
991155682 5:63432065-63432087 GAGTAGAGTCCTTAGCTCAGAGG + Intergenic
992171658 5:74107876-74107898 GAGCAGTGGCTTTAGGCCGCTGG - Intergenic
993137559 5:83989323-83989345 GAGAAGTAGCCTTAGCTCATGGG - Intronic
995407820 5:111821115-111821137 GAGCAGTGGCCCTGGGTCTAAGG - Intronic
996151203 5:120036939-120036961 GAGCAGGGGCCTTGGCTCTGTGG + Intergenic
996414710 5:123197852-123197874 GAGCTTTGCCCTGAGGTCAGTGG - Intergenic
998559612 5:143159135-143159157 GAGCAGTGACCTTCAGTCAAGGG + Intronic
998715447 5:144878849-144878871 GACCAGTGGCCTTAATACAGGGG - Intergenic
999250645 5:150180337-150180359 GGGCAGCGGACTGAGGTCAGTGG + Intronic
999386236 5:151156373-151156395 GGGCACTGGCCTGGGGTCAGAGG - Intronic
999712615 5:154331996-154332018 GAGCAGTACCCCTAGGTCTGTGG + Intronic
999716703 5:154366894-154366916 GAGTACTAGCCTTGGGTCAGGGG + Intronic
1001332450 5:170771999-170772021 GAGCAGTGGCCTTAGGTCAGGGG - Intronic
1003723415 6:8732266-8732288 GAGGAGAGGACTTAGGTCTGGGG + Intergenic
1005809515 6:29505487-29505509 GACAAGTGTCCTTTGGTCAGTGG + Intergenic
1007618441 6:43196490-43196512 GAGGAGTGGCCCAAGGTCAGGGG + Intronic
1007976478 6:46106524-46106546 GAGCTTTGCCCTGAGGTCAGTGG + Intergenic
1010714732 6:79215326-79215348 GAACAGGGGCCAGAGGTCAGTGG + Intronic
1017823212 6:158063723-158063745 AAGCAGTGGCCATAGCACAGAGG - Intronic
1021542369 7:21774471-21774493 GAGCAGGGGCCTCAGGACTGAGG - Intronic
1023299759 7:38757696-38757718 GAGGAGTGGCCTGAGGTGATGGG + Intronic
1028896424 7:96046847-96046869 GAGGAGTGGGCTTGGGTTAGAGG + Intronic
1029453304 7:100654924-100654946 GAGCAGTGGCTTGAGGGGAGAGG + Intronic
1034227594 7:149495986-149496008 GAACAGTGGCCTTAGGTGGAGGG - Intronic
1034242770 7:149623032-149623054 GAACAGTGGCCTTAGGTGGAGGG - Intergenic
1035184020 7:157111863-157111885 GAGAAGTGGCTTGAGTTCAGGGG - Intergenic
1038093606 8:24282761-24282783 GAGCCCCGGCCTCAGGTCAGGGG - Intergenic
1038789693 8:30657785-30657807 GAGCATTGTCTTTAGGCCAGAGG - Intronic
1040571975 8:48619479-48619501 GAGCAGTGGCTGTAGGGGAGAGG - Intergenic
1041757914 8:61334230-61334252 GAGTAGGGGCCTAAGTTCAGGGG + Intronic
1042081564 8:65059811-65059833 GAGAAGTGGCCTGACTTCAGAGG + Intergenic
1043094319 8:75947156-75947178 GCGCAGTGGCCTTGTGTCAAGGG + Intergenic
1044789148 8:95828759-95828781 TAGCACTTGCCCTAGGTCAGAGG + Intergenic
1046317926 8:112531212-112531234 GAGCAGTGGCCTGAAATCAGGGG - Intronic
1046398746 8:113676146-113676168 GAGAAGTGGCCTGACTTCAGAGG + Intergenic
1049544035 8:143221359-143221381 GAGCTGTGGCCTGCGGTGAGTGG - Intergenic
1049600025 8:143503456-143503478 GACCAGTGGCCTCAGGTTTGTGG - Intronic
1049900032 9:151297-151319 CAGCAGAGGCCTTAGGTGAGTGG - Intronic
1053743083 9:41161593-41161615 CAGCAGAGGCCTTAGGTGAGTGG - Intronic
1054348361 9:63991406-63991428 CAGCAGAGGCCTTAGGTGAGTGG - Intergenic
1054446088 9:65317776-65317798 CAGCAGAGGCCTTAGGTGAGTGG - Intergenic
1054484183 9:65703735-65703757 CAGCAGAGGCCTTAGATGAGTGG + Intronic
1054685260 9:68269708-68269730 CAGCAGAGGCCTTAGGTGAGTGG + Intronic
1055762262 9:79621626-79621648 GAGTAGTGGCCTTTGGGCTGTGG + Intronic
1056246153 9:84697344-84697366 GAGCAGTGGGCCTAGGTTAGAGG + Intronic
1056873257 9:90304564-90304586 GAGCAGTGGGGTTGGGTCAGTGG - Intergenic
1057241591 9:93416560-93416582 GGGCAGTGACCTTATGCCAGTGG + Intergenic
1058577675 9:106421214-106421236 GAGCAGTAGACTTAGCTAAGGGG - Intergenic
1060517554 9:124275564-124275586 AAGCAGTGTGCTGAGGTCAGAGG - Intronic
1060532025 9:124353357-124353379 GAGCACTGGCCTAGGCTCAGAGG - Intergenic
1061335363 9:129930427-129930449 GAAAAGTCTCCTTAGGTCAGTGG - Intronic
1061538657 9:131265610-131265632 GGGCAGTCACCTGAGGTCAGGGG - Intronic
1061889166 9:133608785-133608807 GAACAGTGGCCTGGGGGCAGGGG - Intergenic
1062213890 9:135378709-135378731 GAGCAGTGGCCCTGGGTAAGTGG + Intergenic
1062522772 9:136965300-136965322 CAGCAGTGGCCTGGGGGCAGGGG + Intergenic
1062645194 9:137544202-137544224 GGGCAGTGGCCCCAGGTCAGAGG - Intronic
1203661267 Un_KI270753v1:45782-45804 GACCGGTGGCCGTAGGGCAGAGG + Intergenic
1187224259 X:17360618-17360640 AAGCAGTGACCTTAGGGCATGGG - Intergenic
1187722407 X:22165153-22165175 GAGCAGTGTCCAGAGGTCACTGG + Intronic
1194693767 X:97019539-97019561 TAGCACTGGCCTCAGGTTAGGGG - Intronic
1197593818 X:128442872-128442894 GAGCAGTGGCCTTAGATCCAAGG - Intergenic
1198541464 X:137644412-137644434 GAGTGGTGGCCAGAGGTCAGGGG - Intergenic
1201943320 Y:19483054-19483076 TAGCAGTGGCCTTAGGTACTGGG + Intergenic