ID: 1001332535

View in Genome Browser
Species Human (GRCh38)
Location 5:170772500-170772522
Sequence CACACGGAGGGAAAATTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 119}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001332535_1001332550 27 Left 1001332535 5:170772500-170772522 CCTCCCAATTTTCCCTCCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1001332550 5:170772550-170772572 TCAGACAGGGCTCTCAGTCAAGG 0: 1
1: 0
2: 3
3: 20
4: 195
1001332535_1001332543 1 Left 1001332535 5:170772500-170772522 CCTCCCAATTTTCCCTCCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1001332543 5:170772524-170772546 CAGATGCCAGTGTTAAGGACCGG 0: 1
1: 0
2: 0
3: 17
4: 124
1001332535_1001332541 -4 Left 1001332535 5:170772500-170772522 CCTCCCAATTTTCCCTCCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1001332541 5:170772519-170772541 TGTGCCAGATGCCAGTGTTAAGG 0: 1
1: 0
2: 0
3: 12
4: 152
1001332535_1001332547 13 Left 1001332535 5:170772500-170772522 CCTCCCAATTTTCCCTCCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1001332547 5:170772536-170772558 TTAAGGACCGGGGCTCAGACAGG 0: 1
1: 0
2: 0
3: 5
4: 90
1001332535_1001332548 14 Left 1001332535 5:170772500-170772522 CCTCCCAATTTTCCCTCCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1001332548 5:170772537-170772559 TAAGGACCGGGGCTCAGACAGGG 0: 1
1: 0
2: 0
3: 11
4: 130
1001332535_1001332544 2 Left 1001332535 5:170772500-170772522 CCTCCCAATTTTCCCTCCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1001332544 5:170772525-170772547 AGATGCCAGTGTTAAGGACCGGG 0: 1
1: 0
2: 1
3: 13
4: 184
1001332535_1001332545 3 Left 1001332535 5:170772500-170772522 CCTCCCAATTTTCCCTCCGTGTG 0: 1
1: 0
2: 0
3: 10
4: 119
Right 1001332545 5:170772526-170772548 GATGCCAGTGTTAAGGACCGGGG 0: 1
1: 0
2: 0
3: 4
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001332535 Original CRISPR CACACGGAGGGAAAATTGGG AGG (reversed) Intronic
900338485 1:2176448-2176470 CACATGGAGGGTTTATTGGGAGG + Intronic
901860257 1:12069891-12069913 CACACGGAATGAAAAGAGGGAGG + Intronic
902673573 1:17992831-17992853 CACAGGGAGGGAAAATGAAGCGG + Intergenic
902910874 1:19596505-19596527 CAGAGGGAGGGAAAATTGTGTGG + Intergenic
903484729 1:23681192-23681214 CGCATGGAGGGAAAACTGAGGGG + Intergenic
903663144 1:24990931-24990953 CACAAGGAGGGAACACGGGGAGG + Intergenic
904044525 1:27602019-27602041 CACAAGGAGGGACCCTTGGGGGG - Intronic
904619259 1:31765626-31765648 CAGAAGGAGGGAAAAGAGGGCGG - Intergenic
908590628 1:65629079-65629101 CACAAGGAGGGAATAATGTGTGG - Intronic
909505531 1:76385200-76385222 CAAACAGAAGGAAATTTGGGGGG + Intronic
910544206 1:88395833-88395855 CACAGGGAGAGAAAAATGGAAGG - Intergenic
917478069 1:175385984-175386006 CACAAGGAGGGAAAGAGGGGTGG - Intronic
918358126 1:183724978-183725000 CACACGGAGGGAAGAGGAGGAGG + Intronic
922534204 1:226367925-226367947 GGCAGGGAGGGAAAATGGGGAGG + Intronic
922536460 1:226384690-226384712 CGCACAGAGAGAAAATTAGGAGG + Intronic
1065198602 10:23291592-23291614 CACACAGAGGGAAGTGTGGGTGG - Intronic
1066565932 10:36722132-36722154 GAAACAGAGGGAAAATGGGGTGG - Intergenic
1068840786 10:61611659-61611681 GGGACGGGGGGAAAATTGGGAGG + Intergenic
1069174342 10:65271554-65271576 CACCCCAAGGGAAAAATGGGGGG - Intergenic
1072531497 10:96323677-96323699 CTAAGGTAGGGAAAATTGGGAGG - Intronic
1073575218 10:104617413-104617435 CACATGGAGGGAACATATGGAGG - Intergenic
1075207857 10:120462312-120462334 CCCACAGAGGCAAAACTGGGGGG + Intronic
1076434636 10:130431705-130431727 CACAAGGAGGCAGAATTGGGAGG + Intergenic
1076745042 10:132508747-132508769 CACAGGGCAGGAAAAGTGGGTGG + Intergenic
1079955047 11:26851915-26851937 CAGATGGAGGGACATTTGGGAGG + Intergenic
1082276209 11:50224231-50224253 CACACAGAGAGAACATTTGGGGG - Intergenic
1082802148 11:57423021-57423043 CACTAGGAAGGAATATTGGGAGG + Intronic
1082848375 11:57744183-57744205 CACACGGAGGGAACAGTAGTGGG + Exonic
1088051956 11:105527403-105527425 CACAAGAGGGGGAAATTGGGAGG - Intergenic
1094049555 12:26204228-26204250 CACACGGAGGTACGATGGGGTGG + Intronic
1096389571 12:51217995-51218017 CAGAAGGAGGGAAAAAAGGGGGG - Intergenic
1098564313 12:71914887-71914909 CACAAGCAGGGAAAATTTGAAGG - Intronic
1102548628 12:113674805-113674827 GAAAAGGAGGGAAAATCGGGAGG - Intergenic
1104933036 12:132350390-132350412 CACAAGGAGGGAAAAATTGGAGG - Intergenic
1106549222 13:30757119-30757141 CACAAGGAAGGAAAATGGTGTGG - Intronic
1107637039 13:42402664-42402686 CAAAGGGAAGGAAAAGTGGGAGG - Intergenic
1109042790 13:57361537-57361559 TACTCGGAGGGAAAGGTGGGAGG + Intergenic
1124596385 15:31095212-31095234 CACAGGGAGAGGAAATGGGGAGG + Intronic
1126969468 15:54094212-54094234 CACACGGAAGGAAAGTTTAGCGG - Intronic
1127877991 15:63128351-63128373 CTTACAGAGGGAAAAGTGGGAGG + Intronic
1129756129 15:78100343-78100365 CACGGGAAGGGAAAGTTGGGTGG + Intronic
1130919729 15:88334127-88334149 CACAGGGAGGGGAAACTGTGGGG - Intergenic
1134510040 16:14838989-14839011 CAGAGGGAGGTAAAATTGGAGGG - Intronic
1134769704 16:16796796-16796818 CACAGGGAGGCAAAACTGGCTGG + Intergenic
1134974155 16:18557187-18557209 CAGAGGGAGGTAAAATTGGAGGG + Intronic
1140841128 16:78840156-78840178 CACACTGAGGGTCAACTGGGAGG - Intronic
1144892244 17:18500787-18500809 CACAGGGAGACAAACTTGGGAGG + Intergenic
1145139972 17:20443501-20443523 CACAGGGAGACAAACTTGGGAGG - Intergenic
1145810336 17:27760494-27760516 CACAGGGAAGCAAACTTGGGAGG + Intronic
1147597939 17:41728552-41728574 CACACTGAGGTAAAGTTGGTGGG + Intronic
1148463383 17:47850763-47850785 CCGATGGAGGGAAAACTGGGCGG - Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1150600701 17:66648478-66648500 CACACAGATGGTAAATTGGATGG + Intronic
1151162435 17:72176617-72176639 GGCACGGGGGGAAAATGGGGTGG + Intergenic
1153791839 18:8586222-8586244 CCCAAGGAGGAAAAATGGGGAGG + Intergenic
1155161459 18:23199255-23199277 GACACCGTGGGAAAGTTGGGTGG + Intronic
1158253593 18:55519031-55519053 CACAAAGAGGGAAAAATAGGTGG + Intronic
1158712255 18:59848024-59848046 AACACAAAGGGAAAAGTGGGGGG + Intergenic
1160915106 19:1492738-1492760 CAGATGGTGGGAAAATTGGGGGG - Intronic
1163365398 19:16873341-16873363 CACACGGAGGGAAAGTGGAGGGG - Intronic
1165156708 19:33793115-33793137 AACTAGGAGGGAAGATTGGGGGG + Intergenic
925741711 2:7010694-7010716 CACACAGAGGGAAGAAAGGGGGG - Intronic
926076231 2:9945355-9945377 TACAGTGAGGGAAAATGGGGAGG + Intergenic
934489463 2:94750411-94750433 GACTCCGAGGGAAGATTGGGGGG + Intergenic
937048817 2:118871438-118871460 CACAGGGAGGGAAACTTTGCTGG - Intergenic
938632411 2:133181409-133181431 AAAACGGAGGGAAAAATGGAAGG + Intronic
938933577 2:136108923-136108945 AAGACTGAGGGAAAATTGGGTGG + Intergenic
943546536 2:189286524-189286546 TACTCGGAGGGAAAAACGGGAGG + Intergenic
945494688 2:210495971-210495993 CACAGGGAGGGAAAGAGGGGAGG - Intronic
946586771 2:221197987-221198009 GAAAGGGAGGGAAAATTGGAGGG + Intergenic
948354035 2:237362799-237362821 GACACAGAGGGAAACTAGGGAGG + Intronic
1171290588 20:23980790-23980812 CAGACGGAGGGACAGATGGGTGG + Intergenic
1173906245 20:46631881-46631903 CACAAAGAGGGCAAGTTGGGGGG - Intronic
1174130099 20:48338214-48338236 GACAAGGGGGGAAAGTTGGGAGG + Intergenic
1176840518 21:13838559-13838581 CACTCGGAGGGAAGGTTGGGGGG + Intergenic
1178746998 21:35262047-35262069 AACACAGAGGTAAAAATGGGAGG + Intronic
1178971707 21:37184072-37184094 CACAGGGAGTGAAAATTCTGAGG - Intronic
1179423634 21:41255343-41255365 CCCAAGGAGGGAAGATTGAGAGG + Intronic
1181401390 22:22652130-22652152 CAGACGGAGGGACAGATGGGTGG - Intergenic
1181703358 22:24633212-24633234 CAGACGGAGGGACAGATGGGTGG - Intergenic
1203228452 22_KI270731v1_random:91168-91190 CAGACGGAGGGACAGATGGGTGG - Intergenic
951008333 3:17646144-17646166 CACTCAGAGGGAAGATTAGGTGG + Intronic
954686055 3:52370853-52370875 CACAGGGAGGGACCACTGGGTGG + Intronic
959287621 3:104437019-104437041 CACACGGAGGTGAAACTGGAAGG + Intergenic
961047099 3:123716632-123716654 CACTGGGAGGGAACAGTGGGTGG - Intronic
963774477 3:149423981-149424003 CAGATGGAGGGAAAAGAGGGTGG + Intergenic
966154073 3:176897106-176897128 AAAACGGAAGAAAAATTGGGGGG + Intergenic
966546123 3:181151053-181151075 AACTCGGAGGGACAAGTGGGAGG + Intergenic
966705779 3:182911956-182911978 CACAGGCAGGGAACATTGGTTGG + Intronic
966728699 3:183132476-183132498 AACCCGGAGGGAGAATTGTGGGG - Intronic
968635481 4:1676284-1676306 CACACGCAGGGAGAATGCGGTGG - Intronic
972450480 4:39192991-39193013 CAAACGGAGGGAAATCTGAGAGG + Intronic
973077548 4:45948180-45948202 CACACTGAGTTAAAACTGGGCGG + Intergenic
975319403 4:72993499-72993521 CACAGGGTGGGGAAGTTGGGTGG - Intergenic
979212456 4:118121726-118121748 CACACAGATAGAAAAGTGGGAGG - Intronic
982455632 4:155606456-155606478 CACACAGAAAGAAAATTGGAAGG + Intergenic
983367278 4:166808815-166808837 CAAACAGAGGCAAAATTGGATGG + Intronic
985598976 5:815161-815183 CAAACTGAGGGAAGACTGGGAGG + Intronic
986457169 5:7931310-7931332 CATACGGAGGGAAACGGGGGTGG - Intergenic
995408530 5:111829326-111829348 CACATGGAGGAAGAATTGGCAGG + Intronic
995766991 5:115629315-115629337 CACAGGGTGGGGAAAGTGGGGGG + Intronic
997421404 5:133769849-133769871 CAAAAGGTGGGAAAGTTGGGAGG - Intergenic
1000917308 5:167098008-167098030 AACTCGGAGGAAAAAATGGGAGG - Intergenic
1001332535 5:170772500-170772522 CACACGGAGGGAAAATTGGGAGG - Intronic
1006750769 6:36375484-36375506 CACACTGAGGTATAAATGGGTGG - Intronic
1009557580 6:65193788-65193810 CACCCTGAGGTAAAATTTGGGGG + Intronic
1010054109 6:71543968-71543990 TACAGGGATAGAAAATTGGGAGG - Intergenic
1017647838 6:156555444-156555466 CACATGGAGGGAAAAGTTTGGGG + Intergenic
1019073759 6:169370515-169370537 CTCACGGAGGGCACATGGGGTGG + Intergenic
1019759408 7:2798938-2798960 CACAGGTAAAGAAAATTGGGGGG + Intronic
1020588444 7:10103440-10103462 GGCACGGAGAGAAAATGGGGAGG + Intergenic
1023099286 7:36697863-36697885 CACACAGAGGGAAAATGGCCAGG + Intronic
1024363293 7:48492195-48492217 TACACGGAGGGGAAAGTGAGGGG - Intronic
1031114926 7:117657102-117657124 CAATGGGAGGGAAACTTGGGAGG + Intronic
1032322157 7:130895431-130895453 AACACCGAAGGAAAATGGGGAGG + Intergenic
1034215304 7:149401163-149401185 AACACGGGGGAAATATTGGGAGG - Intergenic
1034286780 7:149889488-149889510 CACAAGGAGGGAAACTTGAGAGG + Intergenic
1036628879 8:10496519-10496541 AACAGGGAGGGGAAAATGGGAGG + Intergenic
1039195990 8:35032346-35032368 CACATGGAGGGTAATTTGGAGGG - Intergenic
1041083478 8:54235310-54235332 AACAAGGAGGGAGATTTGGGGGG + Intergenic
1043391405 8:79795639-79795661 CACATGGAGGGTAAATTGGTTGG + Intergenic
1045434436 8:102147278-102147300 CACACAGAGGGAAAACTATGTGG - Intergenic
1045499411 8:102733495-102733517 CACAGGGAGGGAACGGTGGGAGG + Intergenic
1059157450 9:112002521-112002543 GAAAAGGAGGGAAAATTGGACGG + Intergenic
1061634372 9:131897626-131897648 CACAGGGAGGGAAAAGGAGGTGG + Intronic
1203775419 EBV:70328-70350 CACGCGAAGGGAAACGTGGGAGG - Intergenic
1187200697 X:17131147-17131169 AACAGGGAGGGAAAAATGGGTGG + Intronic
1188245848 X:27835075-27835097 CAAAAAGAGGGAAAATTGGTAGG + Intergenic
1189040573 X:37538157-37538179 CAGACGGAGGGAAAACGTGGAGG - Intronic
1190383409 X:49861517-49861539 TACATGGAGGGACAATTGTGGGG - Intergenic