ID: 1001335200

View in Genome Browser
Species Human (GRCh38)
Location 5:170790986-170791008
Sequence CTGGGAAAACCAGGGGATAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 205}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001335200_1001335209 23 Left 1001335200 5:170790986-170791008 CCAATATCCCCTGGTTTTCCCAG 0: 1
1: 0
2: 1
3: 7
4: 205
Right 1001335209 5:170791032-170791054 GCACGTGAGTCTGCACGCCTTGG 0: 1
1: 0
2: 0
3: 8
4: 65

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001335200 Original CRISPR CTGGGAAAACCAGGGGATAT TGG (reversed) Intronic
901055902 1:6448489-6448511 CTGTGAGAACCAGGGGGTCTAGG + Intronic
901685343 1:10940616-10940638 CTGGGAACAGCAGGGGAGACTGG - Intergenic
903122281 1:21224139-21224161 CTGGGAAAAGCTGGGGAAAATGG - Intronic
904112090 1:28134009-28134031 CTGGGAAGACTAGGGCATCTGGG - Intergenic
906153607 1:43601643-43601665 CGAGGCAAACCAGGGCATATGGG + Intronic
906542983 1:46602471-46602493 TTGGGAAAACCAAGGGAAACAGG + Intronic
907066065 1:51484167-51484189 CTGGGCATACCAGGGCATATGGG - Intronic
907963868 1:59310216-59310238 CTGGGAAAAACTGTGGATTTCGG + Intronic
908475964 1:64488968-64488990 CTGGGAACAGCAGGGGATGAGGG + Intronic
910471016 1:87552888-87552910 CTGAGAGAATCAGAGGATATAGG + Intergenic
911773176 1:101773414-101773436 TTTGGAAAACCAATGGATATGGG + Intergenic
916337030 1:163684421-163684443 GTGGCAAAAGAAGGGGATATTGG - Intergenic
916831503 1:168496744-168496766 CTGAGACAACCAGTGGATGTGGG - Intergenic
919705060 1:200668669-200668691 GAGGGAAAACAAGGGGAGATGGG - Intronic
920513113 1:206565362-206565384 CTGGGAAAATTTTGGGATATGGG - Intronic
920546388 1:206822084-206822106 CTGGGAAAACTGGGGGTTCTGGG + Intronic
920845253 1:209588247-209588269 ATGGACAAACCAGAGGATATGGG - Intronic
923637926 1:235719734-235719756 CTAGGAAATACAGGGGTTATGGG + Intronic
924060790 1:240172101-240172123 CTGAGAAAACAAGGGAATGTAGG + Intronic
924882629 1:248179173-248179195 CTGGGAATACCATGTGATAGGGG - Intergenic
1065334304 10:24640260-24640282 CTGGGAATATCAGGTGCTATAGG + Intronic
1067457286 10:46428021-46428043 CTGGGAACACCAGTGGGGATGGG + Intergenic
1067920054 10:50445998-50446020 CTGGGAGCACTAGGGGAGATGGG - Intronic
1068108516 10:52650937-52650959 CTGTAAAAACCAGGTGATTTAGG + Intergenic
1069514878 10:69069624-69069646 TTGGGACATCCAGGGGACATTGG + Intergenic
1070116278 10:73531766-73531788 CTGGGAAAACCAGGAGAGCTGGG + Intronic
1071479316 10:86052542-86052564 CTGGGAATACCAGGTGCTGTCGG + Intronic
1072153894 10:92706332-92706354 TGGAGAAAACCAGGGGAGATGGG - Intergenic
1074235440 10:111580367-111580389 CCTGGAAAACAAGGGGAAATTGG - Intergenic
1078797926 11:14611900-14611922 CTGGGAAAGGAAGGGGATAGAGG - Intronic
1079187210 11:18248391-18248413 CTGGGAATACCAGGTGCTAAAGG - Intronic
1079189591 11:18266486-18266508 CTGGGAATACCAGGTGCTAAAGG + Intronic
1079811837 11:25006051-25006073 CTCAGACAAGCAGGGGATATGGG - Intronic
1080596060 11:33774919-33774941 CGGGGAAAACGAGGGGTTCTCGG - Intergenic
1080792040 11:35530071-35530093 CTGGGAAAGCCAGAGGAAACAGG + Intronic
1081235974 11:40647639-40647661 CTTTGAAAACCTGGGGAGATCGG - Intronic
1083321858 11:61852659-61852681 CTCGGGAAAGCAGTGGATATTGG + Intronic
1084102650 11:66959842-66959864 CTGTGCCAACCAGGGGATAAGGG + Intergenic
1084106156 11:66982032-66982054 CTTGGAAAAGCAGGGGAAAAAGG + Intergenic
1084884075 11:72192025-72192047 CTGGGAAAACTGAGGGAGATGGG + Intronic
1085758170 11:79218725-79218747 CTGGGAAAAAAAGGGAATTTAGG - Intronic
1088565304 11:111166046-111166068 CTTGGAAGACAATGGGATATTGG - Intergenic
1089606099 11:119642290-119642312 CTGAGAAGAAAAGGGGATATAGG - Intronic
1090474319 11:127005589-127005611 CTGGGGAAACAAGGAGATAAGGG - Intergenic
1090719608 11:129459514-129459536 CTGGGAAAACCAAGAGAGTTTGG - Intergenic
1091478925 12:806692-806714 CTGGGAAGACAAAGGGAAATAGG + Intronic
1091566812 12:1654901-1654923 CTGGGAAAGCCAGTGGAGAGAGG - Intergenic
1096407039 12:51351404-51351426 CTGAGAAACCCAGAGGACATTGG - Exonic
1100105889 12:91171602-91171624 CTGGGACAGCCAGGGGCCATAGG + Intronic
1103952266 12:124557776-124557798 CTGGGTAAACCAGGGGAGGAAGG - Intronic
1104087811 12:125492509-125492531 CTGGGAACACCAGGGGAGGCCGG - Intronic
1105471767 13:20701551-20701573 CTGAGTAAACCAGGGGATGAGGG + Intergenic
1106076041 13:26462058-26462080 GTGGGTAAACCAGGGCAGATGGG - Intergenic
1106797812 13:33225246-33225268 CTGGGAAATACATGGGAAATAGG + Intronic
1107051833 13:36058883-36058905 CTGAGAAAAATAAGGGATATTGG - Intronic
1107563978 13:41583279-41583301 TTTGGAAATACAGGGGATATTGG + Intronic
1107617293 13:42182844-42182866 CTGAGAAAACTAAGGGAAATGGG - Intronic
1108551895 13:51554570-51554592 CTGGAAAAACCCGTGGCTATAGG + Intergenic
1110713087 13:78671443-78671465 CAGTGAAAACCAGGAGAAATGGG - Intergenic
1110831129 13:80032073-80032095 CTGGGAGAACCAAGTGTTATAGG - Intergenic
1111052724 13:82906381-82906403 CTGAGAAAAACAGGGATTATTGG + Intergenic
1111944628 13:94651399-94651421 CTGGGAATACCAGGTGCTGTAGG - Intergenic
1112819779 13:103318871-103318893 CTGGTAAAACAATGGGTTATGGG + Intergenic
1114214332 14:20644570-20644592 TTGGGAAAACAAGGAGAAATTGG + Intergenic
1114630860 14:24158698-24158720 CTGGGAATTCCAGGTGCTATAGG + Intronic
1115700931 14:35952262-35952284 GTGGGAAAAACAAGGGATTTCGG + Intergenic
1117090617 14:52246444-52246466 ATGGGAAGCCCAGGGGATTTAGG - Intergenic
1121305359 14:92903239-92903261 CTGGGAATCCCAGGAGATAGAGG + Intergenic
1123578575 15:21696034-21696056 CTGTGCAAACCAGGGCATACGGG - Intergenic
1123615202 15:22138516-22138538 CTGTGCAAACCAGGGCATACGGG - Intergenic
1124162042 15:27280320-27280342 CTGGAAACACCAGGTGCTATAGG - Intronic
1125271084 15:37939482-37939504 CTGGGAAAAAGAGGTGATCTTGG - Intronic
1126906001 15:53366387-53366409 CTGAGCAAACCAGGATATATGGG + Intergenic
1127935157 15:63630075-63630097 CTGGGAACATCAGTTGATATGGG - Intronic
1128688383 15:69704420-69704442 CTGGGACAACTAGGGCATATTGG + Intergenic
1129244263 15:74270185-74270207 GTGGGAAAACCAGCTGAGATGGG + Intronic
1129329957 15:74821956-74821978 CTGGGAGAACCAGGGCAGAGAGG + Intronic
1130581043 15:85136985-85137007 CTGGGAGAAGCAGGGGACAGTGG - Intronic
1130636037 15:85620965-85620987 CTGGCAAAGGCAGGGGAAATTGG + Intronic
1132401238 15:101506736-101506758 CTGGGAGAACAAGAGGCTATTGG + Intronic
1202987445 15_KI270727v1_random:430279-430301 CTGTGCAAACCAGGGCATACGGG - Intergenic
1133618222 16:7499970-7499992 CAAGGAAAACCAGGGGTTTTTGG - Intronic
1134613082 16:15626499-15626521 CTGGGAATACTAGGAGCTATAGG + Intronic
1138069784 16:53981370-53981392 TGGGGAACACCAGGGAATATGGG - Intronic
1140246227 16:73252493-73252515 CTGGGAGAAGAAGGGAATATGGG + Intergenic
1140917846 16:79509612-79509634 CAGGAAAGACCTGGGGATATTGG + Intergenic
1141009962 16:80387981-80388003 CTGGGAAGACCACGTGAGATAGG - Intergenic
1141955214 16:87366285-87366307 CTGGGGAAATCAGAGCATATGGG + Intronic
1143615367 17:8046330-8046352 CTAGGAAAACCAGGGCCTGTGGG - Intronic
1154138170 18:11799197-11799219 CTGGGGACACATGGGGATATGGG - Intronic
1155274196 18:24170507-24170529 CTGGGAATACCAGGTGCTGTCGG - Intronic
1156089881 18:33454519-33454541 ATGGGAATCCCAGGGGATGTGGG - Intergenic
1157096245 18:44687871-44687893 CTGGGCAGACCAGGTGCTATGGG - Intronic
1157482283 18:48063105-48063127 CTGGGAAAACCAAGACATGTTGG - Intronic
1157823579 18:50791853-50791875 CTGGGGAAACCAGAAGTTATAGG + Intergenic
1159114144 18:64093868-64093890 CTAGGAAAACCAGGAGGCATTGG + Intergenic
1160580690 18:79883215-79883237 CTGGGAAAGCCAGGGGTTGGGGG + Intronic
1160730761 19:640747-640769 CTGGGCACAGCAGGGGATGTGGG + Intronic
1162235608 19:9306831-9306853 CTGGTAAAACTAGGGAATAAGGG - Intronic
1165392969 19:35548920-35548942 ATGGGAAAACCCCGGGTTATGGG + Intergenic
1165811395 19:38614086-38614108 CTGGGAATGAGAGGGGATATGGG + Intronic
1166042669 19:40213152-40213174 CTGGCAAAGCCAGGGGCGATGGG - Exonic
1166313668 19:41976705-41976727 CTGGGAGAAGCAGGGGAGAAGGG + Intronic
1168699510 19:58428394-58428416 CTTGGAAAACCAGGAGATATGGG + Intergenic
925093630 2:1175946-1175968 CTGGGAGAACCAGGAGAACTGGG - Intronic
925327932 2:3037250-3037272 CTTTGAAAACCAGGGGGTCTAGG + Intergenic
926229924 2:10994638-10994660 GTTGGGAAAGCAGGGGATATGGG - Intergenic
926294849 2:11561663-11561685 CTGGGAATACCAGGTGCTGTAGG - Intronic
926835638 2:17016498-17016520 CTGGGCAAACCAGGACAAATAGG - Intergenic
927335534 2:21919262-21919284 CTGGGAAAGCCAGTGGGTGTGGG - Intergenic
927369558 2:22338888-22338910 CTGGGAATACCAGGTGCTGTAGG - Intergenic
929759179 2:44791891-44791913 GTGGGAAAAGCAGGGAATCTGGG + Intergenic
930491747 2:52082533-52082555 ATGGGAAAACCTGGGCATCTAGG + Intergenic
933770816 2:85742844-85742866 GTTGGAAAATCAGGGGATCTGGG + Intergenic
934666189 2:96172723-96172745 CTGGGACAAAGAGGGGATAAGGG + Intergenic
935785519 2:106545044-106545066 GTGGGAAACACAGGGGACATGGG + Intergenic
939648398 2:144730795-144730817 CTGGGAAATCCTGGGAATACAGG - Intergenic
939998852 2:148947479-148947501 CTGGGAGAACCAGGGAATGCAGG - Intronic
944384775 2:199151906-199151928 CTGGGAAAACCAGGCAGGATGGG - Intergenic
944558414 2:200910658-200910680 ATGGGAAAAACAGAGTATATAGG - Exonic
944761266 2:202817120-202817142 CTGGTTAAACCAGGGCAAATGGG + Intronic
948017700 2:234703292-234703314 CAGGGAAGACCAGGGGAAGTGGG + Intergenic
948977737 2:241473763-241473785 CTGGGAGAGCCAGGGGATGGGGG + Intronic
1169282799 20:4281264-4281286 CTGGAAAGACCTGGGGAAATTGG + Intergenic
1171135133 20:22688772-22688794 CTGGGAAGAACAGGGGCTTTGGG + Intergenic
1171186551 20:23127588-23127610 CAGGGAAACCCAGGGGCTGTGGG + Intergenic
1173500167 20:43547485-43547507 ATGGGAAATACAGGGGATAGAGG - Intronic
1173522542 20:43710504-43710526 CTGGGAAGAGCAGGGGAGAAGGG - Intronic
1174661671 20:52219064-52219086 CTGGGCAAACCAGGACATACGGG + Intergenic
1175868206 20:62192696-62192718 CTGGGAAGTCCAAGGGATTTAGG + Intronic
1181384532 22:22534280-22534302 CTTGGAAAATCAGGGTAGATTGG - Intergenic
1183123271 22:35748991-35749013 CTAGGAAAATGAGGGGAAATTGG - Intronic
1184083190 22:42240304-42240326 TTGGGTAAACCAGGTGGTATTGG - Intronic
950131300 3:10548570-10548592 CTGGGAAAACCATGAGCTGTGGG + Intronic
950138442 3:10599441-10599463 CTGGGAGAACAAGGTGATGTGGG - Intronic
951966115 3:28387144-28387166 CTGGGAAAACCAAGAGTGATTGG - Intronic
952268096 3:31806251-31806273 CTGGCAAAGCCAGGAGGTATGGG - Intronic
952456830 3:33480545-33480567 CTGGGAAGAGTAGGGGAAATTGG + Intergenic
954285217 3:49614441-49614463 CTGGAAAAGCCATGGGATAGAGG + Intronic
955060496 3:55488384-55488406 CTGAGAACACCAGGGGAAAGAGG - Intronic
956794028 3:72702054-72702076 CTTGGGAAACCAGGAGATCTGGG - Intergenic
956794164 3:72703033-72703055 CTTGGGAAACCAGGAGATCTGGG + Intergenic
957440256 3:80237125-80237147 CTGAGAAAATCAGGGCATACAGG + Intergenic
958892135 3:99794757-99794779 CTGGGAAAGCCAGGGGCTCCAGG + Exonic
960422527 3:117464612-117464634 GTGGGGAAATCAGAGGATATAGG + Intergenic
961970188 3:130955585-130955607 CTGAGAAATCCAGAGGATTTGGG - Intronic
962402333 3:135071271-135071293 CTGGGAATATCAGGGGAGACTGG + Intronic
962412004 3:135149386-135149408 CTGTGAAAACCATTGTATATGGG + Intronic
966762381 3:183429085-183429107 CTAGGGAAACCACGGGATAATGG - Intergenic
966948941 3:184798369-184798391 CTGGGAAAACTCTGGGAAATGGG - Intergenic
969877679 4:10148009-10148031 CTGGTAAACCCAGGGGACTTAGG + Intergenic
970455744 4:16222527-16222549 CTGGGATAACTATGTGATATAGG + Intronic
972098482 4:35380755-35380777 CTGGGAAAAGAAGGGAATAAAGG - Intergenic
978433736 4:108660628-108660650 TTGGAAAAACCAGTGGCTATTGG - Intronic
980520846 4:133932014-133932036 CAGGGTAAACCAGGGGCTGTGGG - Intergenic
981481534 4:145243670-145243692 CTGGGAAAAGCATGGTATCTTGG + Intergenic
986323787 5:6656140-6656162 CTCAGAAAACCAGGAGATACTGG + Exonic
988413299 5:30914193-30914215 GTGAGAAAACCAGAGGATAAAGG + Intergenic
989266761 5:39483656-39483678 CTGAGAAGTCCAGGGGATACAGG - Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994150828 5:96445799-96445821 CTGGGTAAACCCGGGGGTAATGG + Intergenic
995247389 5:109950129-109950151 CTGGGACAACCAGGGAATTGGGG + Intergenic
997747886 5:136315565-136315587 ATGGGAAGACCAGGAGAGATGGG + Intronic
997890617 5:137673141-137673163 CTGGGAAATGCAGGCCATATAGG + Intronic
998162933 5:139823507-139823529 CCAGGAAATCCAGGGCATATGGG + Intronic
1000540541 5:162533749-162533771 CTGGAAAAAATAGGGGAAATGGG - Intergenic
1001335200 5:170790986-170791008 CTGGGAAAACCAGGGGATATTGG - Intronic
1003459817 6:6319603-6319625 CTGGGTAATCCAGGGGATCAAGG - Intronic
1005476119 6:26209876-26209898 CTGGGAGAACCAGGTGATGATGG - Intergenic
1007347082 6:41239522-41239544 CTGGGAATACCGGGTGATATAGG - Intergenic
1008634049 6:53391732-53391754 CTGAGGAAACCAGGGGACAAGGG + Intergenic
1008962178 6:57277171-57277193 CTGGGAAAATCAGATGACATGGG + Intergenic
1010960986 6:82145662-82145684 CATGGAAAACCAAGGTATATGGG - Intergenic
1012146260 6:95686851-95686873 CTGGGAAATCCAGTGCATATGGG - Intergenic
1013200928 6:107895237-107895259 CTGGGAAGTCCAAAGGATATGGG + Intronic
1013282517 6:108652098-108652120 CAGGGACAGCCAGGTGATATTGG + Intronic
1013609477 6:111780771-111780793 CTGGGAAAAACAGAGGAAACTGG - Intronic
1014339276 6:120182589-120182611 TTTAGAAAACCAGGAGATATTGG - Intergenic
1014858835 6:126437998-126438020 ATTGGAAAACCATGGGAGATTGG + Intergenic
1018636951 6:165870941-165870963 CTGGGAAAGGCAGCGGAAATGGG + Intronic
1019524102 7:1473004-1473026 CTGGGAAAACCAGGCCCTGTAGG + Intronic
1020466007 7:8480508-8480530 CAGGGAAAACAAGGTGACATAGG + Intronic
1020670104 7:11096097-11096119 CTGGGAAAACCATGTGATTAAGG - Intronic
1024215364 7:47243915-47243937 CCGGGAAAACAAGTGGAAATGGG + Intergenic
1028467112 7:91164873-91164895 CTTGGATCACCAGGGGATACTGG - Intronic
1031965693 7:128026777-128026799 CCTGGAAAAGCAGGGGAAATGGG - Intronic
1033648787 7:143324265-143324287 CTGGGAATCACAGGGGACATGGG + Intronic
1035169126 7:157008266-157008288 CTGGGAAATGCAGGTCATATTGG + Intronic
1037779947 8:21861110-21861132 CTGGGAATTCCAGGTGATGTGGG - Intergenic
1038919158 8:32063521-32063543 CTGGGAAAACCAGGATGTTTGGG + Intronic
1044294440 8:90511216-90511238 CTGGGAATACCGGGTGCTATAGG + Intergenic
1045248425 8:100463248-100463270 GTGGGACAACCCAGGGATATAGG - Intergenic
1045902641 8:107302429-107302451 CTGTGTAAAGCAGGGTATATGGG - Intronic
1046872986 8:119224261-119224283 CTGGGAAAATAAGGAGATTTTGG + Intronic
1047014390 8:120707872-120707894 CTGGGAAAATCTATGGATATTGG + Intronic
1048756622 8:137746749-137746771 CTGGGAAAATCCAGAGATATAGG - Intergenic
1049926579 9:414655-414677 CTGTGAAAACCAAGCAATATAGG - Intronic
1052719990 9:32162785-32162807 CTGGGAAAACCTGGAGAACTTGG + Intergenic
1053480941 9:38415803-38415825 CTGGGACACCCAGGGGCTATGGG - Intronic
1054837600 9:69694901-69694923 CTTGGAAACCCAGAGGAAATGGG - Intergenic
1055353535 9:75413986-75414008 CTGGGAAAGGCAGGAGAGATAGG + Intergenic
1058454453 9:105126323-105126345 CTGGGAAATCCAGGGAATTCAGG + Intergenic
1059743664 9:117179848-117179870 ATGGCAAAACCAGGGGATTGGGG - Intronic
1059905719 9:118983493-118983515 CAGGGAATACCAAGGTATATAGG + Intergenic
1060932219 9:127496293-127496315 CTGGGAAATCCTGGGGAGGTGGG + Intronic
1061652666 9:132063601-132063623 CTGGGAAAAACAAGGGATAGGGG + Intronic
1185895854 X:3858200-3858222 CTGGGAAACCCAGGGTACCTGGG - Intergenic
1185900973 X:3896624-3896646 CTGGGAAACCCAGGGTACCTGGG - Intergenic
1185906088 X:3935063-3935085 CTGGGAAACCCAGGGTACCTGGG - Intergenic
1188007463 X:25025616-25025638 CTGGGAAAACCAGGCTGAATTGG - Intergenic
1188344351 X:29045683-29045705 CTGGGAAGAGCTGGGCATATAGG + Intronic
1188588803 X:31809029-31809051 CTGGGAAAATGAAGGGACATTGG + Intronic
1189150882 X:38705290-38705312 TTGGGAAAACGAGGCGATCTGGG + Intergenic
1193878782 X:86896399-86896421 CTGGGAAAAGCGGTGGCTATGGG + Intergenic