ID: 1001335338

View in Genome Browser
Species Human (GRCh38)
Location 5:170791927-170791949
Sequence CTGTGTCATCAGATGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3917
Summary {0: 1, 1: 18, 2: 406, 3: 1166, 4: 2326}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001335331_1001335338 16 Left 1001335331 5:170791888-170791910 CCAATATCAAGGTGCTGGAATTT 0: 1
1: 3
2: 48
3: 188
4: 890
Right 1001335338 5:170791927-170791949 CTGTGTCATCAGATGGTGGAAGG 0: 1
1: 18
2: 406
3: 1166
4: 2326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001335338 Original CRISPR CTGTGTCATCAGATGGTGGA AGG Intronic
Too many off-targets to display for this crispr