ID: 1001345750

View in Genome Browser
Species Human (GRCh38)
Location 5:170896887-170896909
Sequence GGGGCGCTTGTGAGCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 83}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001345750_1001345756 12 Left 1001345750 5:170896887-170896909 CCGGCGCGGCTCACAAGCGCCCC 0: 1
1: 0
2: 1
3: 2
4: 83
Right 1001345756 5:170896922-170896944 CACCAGAATGACCCAGTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 121
1001345750_1001345758 21 Left 1001345750 5:170896887-170896909 CCGGCGCGGCTCACAAGCGCCCC 0: 1
1: 0
2: 1
3: 2
4: 83
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345750_1001345755 9 Left 1001345750 5:170896887-170896909 CCGGCGCGGCTCACAAGCGCCCC 0: 1
1: 0
2: 1
3: 2
4: 83
Right 1001345755 5:170896919-170896941 ATGCACCAGAATGACCCAGTTGG 0: 1
1: 0
2: 2
3: 25
4: 182
1001345750_1001345761 25 Left 1001345750 5:170896887-170896909 CCGGCGCGGCTCACAAGCGCCCC 0: 1
1: 0
2: 1
3: 2
4: 83
Right 1001345761 5:170896935-170896957 CAGTTGGTGGTCATACTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001345750 Original CRISPR GGGGCGCTTGTGAGCCGCGC CGG (reversed) Intronic
900226404 1:1535349-1535371 GCGGCACCTGTGAGCCGCACGGG - Exonic
902770080 1:18640815-18640837 GGGGCGCTGGAGGGGCGCGCCGG + Intronic
905408454 1:37753054-37753076 CGGGCGCCTGCGAGCCGTGCGGG - Exonic
915570932 1:156744664-156744686 GAGGTGCTTGTGAGCCGGGCAGG - Intronic
1064086244 10:12348844-12348866 GGGGTGTTTGGCAGCCGCGCGGG - Intergenic
1070610146 10:77927036-77927058 GGGGCCCCGGTGAGCCGGGCCGG - Intergenic
1073124567 10:101141403-101141425 TGGGCCCTTTTGAGCCACGCAGG - Intergenic
1077016467 11:400947-400969 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016530 11:401102-401124 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016587 11:401257-401279 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016624 11:401349-401371 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016637 11:401380-401402 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016657 11:401441-401463 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016662 11:401456-401478 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016688 11:401518-401540 GGGGCGGGTGTGAGCGGGGCGGG - Intronic
1077016715 11:401580-401602 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1077016738 11:401643-401665 GGGGCGGGTGTGAGCGGGGCCGG - Intronic
1078180094 11:9004101-9004123 GGGACGCGAGGGAGCCGCGCGGG - Intergenic
1083460059 11:62805270-62805292 GGGGCGCGGGTGGGCGGCGCCGG - Intronic
1083611837 11:64008061-64008083 GGAGCGCTTGTGAGCCGGGCAGG + Intronic
1091939261 12:4461501-4461523 GCGGAGCTTGTGAGCCGAGATGG + Intergenic
1092318040 12:7440251-7440273 GGGGCGCTCCTGAGCTTCGCGGG - Intronic
1092564199 12:9647942-9647964 CTGGCGCTTGTGACCCGAGCAGG - Intergenic
1096775164 12:53959336-53959358 GGGGCACTGGTGAGCTGAGCTGG + Intergenic
1105349375 13:19602000-19602022 GGGGCGCTCCTGAGCTTCGCGGG + Intergenic
1106109032 13:26760796-26760818 GGGGAGCGTGTGGGCCGGGCGGG - Intergenic
1106227332 13:27795038-27795060 GCGACGCTTGTGCGCCACGCCGG - Intergenic
1107481490 13:40789496-40789518 GGGGCGCTCCTGAGCTTCGCGGG + Exonic
1109366619 13:61364619-61364641 GGGGCTCTGGTGAGCTGCGGTGG - Intergenic
1113904529 13:113813019-113813041 GGGGCGCCTGTGACCCACCCGGG - Exonic
1116970378 14:51058602-51058624 GGTGCGCTGGTGAGCCACCCTGG + Intronic
1142876254 17:2853540-2853562 AGGGCGCCTGGGAGCCGGGCAGG + Intronic
1143723943 17:8832802-8832824 GGGGCGCCAGAGAGCAGCGCTGG - Intronic
1143742740 17:8965964-8965986 GGGTCGCTGGTGCTCCGCGCTGG - Intergenic
1145093997 17:20009289-20009311 GGGGCGAGCGCGAGCCGCGCGGG - Intergenic
1146006208 17:29162306-29162328 GAGGCCCCTGTGAGCCGTGCTGG - Intronic
1146814383 17:35930743-35930765 GGGGCGAGGGTTAGCCGCGCAGG - Exonic
1150137557 17:62704047-62704069 GGGGCGCCTGGGCGCGGCGCCGG + Intronic
1152152907 17:78614058-78614080 GGGGCTCTTGTCAGCCATGCAGG + Intergenic
1152245604 17:79183212-79183234 GGGGCGCACGTGCGCCGGGCCGG + Intronic
1152378442 17:79930244-79930266 GGGGTGGATGTGAGCGGCGCCGG + Intergenic
1152870577 17:82751393-82751415 GGGGCCCGTGTGATCCGCGCGGG + Intergenic
1161125593 19:2555704-2555726 GGGTCTCATGTGAGCCGCCCAGG + Intronic
1162097032 19:8316463-8316485 GGGGCTGTGGTGAGCAGCGCTGG + Intronic
1162744721 19:12791998-12792020 GGCGAGCTTGAGAGACGCGCCGG - Exonic
1168334142 19:55587293-55587315 CGGGCGCTTGTGAGACACGGAGG + Intergenic
925395143 2:3528342-3528364 GGGGAGCTTGTGGGCCGAGGCGG + Intergenic
928904612 2:36356209-36356231 GCGGCGCGTGTGCCCCGCGCAGG + Exonic
932702749 2:74002549-74002571 AGGGTGCTGCTGAGCCGCGCTGG - Intronic
933893211 2:86789626-86789648 GGGGCGCAGGTGAGGCGTGCGGG - Exonic
942248114 2:174025788-174025810 GAGGCGCTGGTGCCCCGCGCTGG - Intergenic
945296461 2:208175951-208175973 GGGGAGCTTGTGAGGCTCACGGG + Intronic
946019935 2:216633906-216633928 AGGGCACTTGTGAGAAGCGCCGG + Exonic
948887193 2:240890214-240890236 GGGGAGCTTCTGAGCCCCGGAGG + Intronic
1176286229 21:5020843-5020865 AGGGCGCAGGTGAGCCGGGCGGG - Intergenic
1179870952 21:44242632-44242654 AGGGCGCAGGTGAGCCGGGCGGG + Intergenic
1180086343 21:45509548-45509570 GGTGGGCTTGTGGGTCGCGCCGG - Exonic
1182667586 22:31970826-31970848 GTGGCGCTGTGGAGCCGCGCAGG + Intergenic
1184331030 22:43828109-43828131 GGGGCGGATGAGAGACGCGCTGG - Intronic
954640090 3:52092691-52092713 GGTGACCTTGTGAGCCGAGCAGG - Intronic
968497518 4:926918-926940 GGAGCGCTGGTGAGCCGGGAGGG - Intronic
968497540 4:926992-927014 GGAGCGCTGGTGAGCCGGGAGGG - Intronic
985564164 5:606981-607003 TGGGAGCTTGTGAACCGCTCTGG - Intergenic
991450155 5:66743059-66743081 AGGAAGCTGGTGAGCCGCGCAGG - Intronic
998200291 5:140113581-140113603 GGGGCTCTGCTGCGCCGCGCAGG + Intronic
1001345750 5:170896887-170896909 GGGGCGCTTGTGAGCCGCGCCGG - Intronic
1008629179 6:53348004-53348026 GGGGCGGTTGTGCTCTGCGCCGG - Intronic
1014079548 6:117270902-117270924 GGGGCGGTTGCGAGGCGGGCCGG - Exonic
1015332712 6:131999584-131999606 GGGCCTCTCGTGAGCTGCGCTGG - Intergenic
1019529095 7:1494775-1494797 GGGGCTCCTGTGTGCCGGGCTGG - Intronic
1020130127 7:5555077-5555099 GCGGCCCACGTGAGCCGCGCGGG - Intronic
1020235093 7:6348991-6349013 GCGGGGCCTGTGGGCCGCGCAGG - Intergenic
1020727291 7:11831887-11831909 GGGGCGCTGCGGGGCCGCGCCGG - Exonic
1023382572 7:39623538-39623560 GGGGCGCTGGGGAGCGGGGCGGG - Exonic
1023822412 7:43987591-43987613 GGGGCCCTGGTGAGCCTCGTAGG + Intergenic
1029750675 7:102541006-102541028 GGGGCCCTGGTGAGCCTCGTAGG + Intronic
1029768630 7:102640117-102640139 GGGGCCCTGGTGAGCCTCGTAGG + Intronic
1034222898 7:149459872-149459894 GGGCCGCGTGTGTGCCGGGCCGG + Intronic
1034429940 7:151036196-151036218 GGGGCGCTTGTGGGCTGGGGAGG + Intronic
1034957754 7:155345031-155345053 GGGGCGCTGGTGCGGCGCGGCGG - Intergenic
1045555166 8:103208560-103208582 GGGCCCCTTGTGAGCCCAGCAGG - Intronic
1049349201 8:142154986-142155008 GGGGTGCTTGTGGGCCTGGCTGG - Intergenic
1049532256 8:143160377-143160399 GGGGCGGCTGGGAGACGCGCGGG + Intronic
1049654896 8:143793093-143793115 GGGGCTCTTGTGAGCTATGCTGG + Intronic
1062479572 9:136745063-136745085 GGGCCGCTTGGGGGCCGCGTGGG - Intronic
1062491789 9:136808346-136808368 GGGGCGCGGGAGCGCCGCGCGGG + Intronic
1189890918 X:45601284-45601306 GGGGAGCTTGTGGGCAGCTCAGG + Intergenic