ID: 1001345752

View in Genome Browser
Species Human (GRCh38)
Location 5:170896907-170896929
Sequence TTCTGGTGCATAGTCAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001345752_1001345761 5 Left 1001345752 5:170896907-170896929 CCCCAGCTGACTATGCACCAGAA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1001345761 5:170896935-170896957 CAGTTGGTGGTCATACTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 97
1001345752_1001345756 -8 Left 1001345752 5:170896907-170896929 CCCCAGCTGACTATGCACCAGAA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1001345756 5:170896922-170896944 CACCAGAATGACCCAGTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 121
1001345752_1001345762 26 Left 1001345752 5:170896907-170896929 CCCCAGCTGACTATGCACCAGAA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1001345762 5:170896956-170896978 GGCCAGTGCGAAAACCAGATTGG 0: 1
1: 1
2: 5
3: 24
4: 138
1001345752_1001345758 1 Left 1001345752 5:170896907-170896929 CCCCAGCTGACTATGCACCAGAA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001345752 Original CRISPR TTCTGGTGCATAGTCAGCTG GGG (reversed) Intronic
906718937 1:47991919-47991941 TTCTGGAGCCTAGGCAGATGAGG - Intronic
908471200 1:64445654-64445676 TCCTGGTACATAGTCTGCTGTGG + Intergenic
920713647 1:208318842-208318864 TTCTGATGCATAGTCTGAAGTGG - Intergenic
1068528439 10:58157913-58157935 TTCTGATGGTTAGTCAGGTGTGG - Intergenic
1068703232 10:60043065-60043087 TTCTGCTGCCTTGTGAGCTGTGG - Intronic
1068996430 10:63210984-63211006 TGCTGGTGCAGAATCAACTGTGG + Intronic
1071788238 10:88927037-88927059 TTCTGTTGCAAAACCAGCTGAGG + Intronic
1072319294 10:94233149-94233171 GTGTGGTGCATTGTCATCTGTGG + Intronic
1077135996 11:999024-999046 CTCTGGTGCACAGGCTGCTGTGG + Intronic
1078860991 11:15246079-15246101 CACTGGTGCATAGTCAGAGGGGG - Exonic
1082301403 11:50510426-50510448 TACTGCTGCATTGCCAGCTGTGG - Intergenic
1083683521 11:64362029-64362051 TCCTGGTGCATACCCAGGTGGGG + Intronic
1085261462 11:75207684-75207706 TGCTGGTGTAAAGTCAGCAGAGG + Intergenic
1086877543 11:92114392-92114414 TTCTGTTGCATATTGACCTGGGG - Intergenic
1090877004 11:130799087-130799109 TTCTGTTTCTTAGTCAGCTCAGG - Intergenic
1091481368 12:835181-835203 TGGTGGTGCATAGTTGGCTGTGG + Intronic
1091874516 12:3922709-3922731 TTCTGATGCATAGTAAGTTTTGG - Intergenic
1092023316 12:5220839-5220861 TTCTGATGCATTGACAACTGCGG + Intergenic
1092611160 12:10174539-10174561 TTCCAGTCCATAGACAGCTGGGG - Intronic
1095257824 12:40060611-40060633 TACTGTTGAAAAGTCAGCTGTGG - Intronic
1095471167 12:42538350-42538372 TTCTGTTGGATAGTGATCTGGGG + Intronic
1097902237 12:64884403-64884425 TTCTGTTGCATAGACATTTGTGG - Intergenic
1099054079 12:77815912-77815934 CTCTGGTGCATACTCATATGAGG - Intergenic
1101554086 12:105790863-105790885 TTCTCGTGAGTAGTCAGCGGAGG + Intergenic
1101739930 12:107492898-107492920 TTCTGGTGCTGGGTGAGCTGAGG + Intronic
1103842962 12:123880050-123880072 TTCTGGTGCACAGCCAGGTTTGG + Intronic
1105278169 13:18948235-18948257 TTCTGGTGCACAGACAGGTTAGG - Intergenic
1106231458 13:27824219-27824241 TTTTTGTGCATAGGCAACTGAGG + Intergenic
1106846666 13:33744387-33744409 TTTGGGTGCAGAGTGAGCTGTGG + Intergenic
1107596881 13:41972714-41972736 TTCTTGTGCACAGTCATGTGAGG - Intergenic
1109879061 13:68447446-68447468 TTCTGTTACATAGTCAGGTCAGG - Intergenic
1109933720 13:69251170-69251192 TTCTTGTGTATATTCACCTGTGG + Intergenic
1111083737 13:83345439-83345461 TTCTGGTAGATAGCCAGTTGTGG - Intergenic
1112211489 13:97382399-97382421 TTCTGTTGCATGGACATCTGGGG - Intronic
1112369554 13:98782775-98782797 TCCTGTTGCAGAGACAGCTGTGG + Intergenic
1120622151 14:86776960-86776982 TTCAGGTCCATAATCAGCTCTGG - Intergenic
1121693700 14:95895689-95895711 GTCTGGTGCATAGGGTGCTGGGG - Intergenic
1123179511 14:106455549-106455571 TTCTGATGCCTAGTCTGTTGAGG + Intergenic
1124706862 15:31973819-31973841 TTCTGGTGCATCCTCTGCTTGGG + Intergenic
1126396193 15:48220350-48220372 TTCTGGTGAAAAGTCAGATTTGG - Intronic
1128124934 15:65185319-65185341 CTCTGGTGAATAGACGGCTGTGG - Exonic
1129831399 15:78673460-78673482 TTTTGGTGCAGACTCGGCTGAGG - Intronic
1131394957 15:92078828-92078850 TGCTGATGCCTAGTGAGCTGAGG - Intronic
1134863298 16:17580601-17580623 TTTAGGTGCAATGTCAGCTGTGG - Intergenic
1135195068 16:20387468-20387490 GTCTGGAGCAGAGTGAGCTGGGG + Intronic
1137285963 16:47016171-47016193 TTGTGGTGGATATACAGCTGAGG + Intergenic
1138684005 16:58708663-58708685 TTCTGATGCATAAACAGATGGGG + Intronic
1139486959 16:67263242-67263264 TCCTGGTGCATAGGTAGATGAGG + Intronic
1141960152 16:87400768-87400790 TTCTGGTGCATAAGGAGGTGAGG - Intronic
1142874419 17:2842861-2842883 TTCTGGGGCAGAGGAAGCTGAGG + Intronic
1146352138 17:32103773-32103795 TACTGGGGCATAGTCAGCTGGGG + Intergenic
1146556513 17:33829435-33829457 TTGTTGTGGATAGTCACCTGGGG + Intronic
1148583260 17:48758360-48758382 TTCTGATGCTTAGTCAGGTTTGG - Intergenic
1149869646 17:60170145-60170167 TACTGGGGCATAAACAGCTGAGG + Intronic
1156490079 18:37490988-37491010 TTCTGGAGCAGAGACAGCTTTGG + Intronic
1156944907 18:42816847-42816869 ATCTGGTGCACAGTAAGCAGTGG - Intronic
1157658607 18:49418242-49418264 TTTTGGTTCATAGGCATCTGAGG - Intronic
1158117480 18:54012245-54012267 TTTTGGTGGATATTAAGCTGTGG - Intergenic
1158632666 18:59129682-59129704 TTGGGGTGCATGGTCACCTGAGG + Intergenic
1160854843 19:1212112-1212134 TTCCGGTGCCCAGCCAGCTGGGG + Intronic
1162134768 19:8548549-8548571 TTCAGGGGCAGAGTCAGCTCTGG - Intronic
1165057959 19:33190677-33190699 TTCTGGAGCATTTTCAGCAGTGG + Intronic
1166792702 19:45407211-45407233 TTCTGGGGCAAAGTCTGCAGGGG - Exonic
925109591 2:1322667-1322689 TTCTGGTGCAGAGTCCTCAGAGG + Intronic
925239474 2:2311225-2311247 TTCTCATGCATTGTCAGCTTGGG - Intronic
926396715 2:12450376-12450398 TTCTGGTGCATAGACAAAGGTGG + Intergenic
929240364 2:39647406-39647428 TTCTGATGCTTTGACAGCTGGGG - Intergenic
931558032 2:63526562-63526584 TTCTGGAGGATAGTCAGCTATGG - Intronic
937454303 2:122028005-122028027 TTCTGATGCAGAGTCAGGTCTGG - Intergenic
941667125 2:168253325-168253347 TTCTTGTACATAGTAAACTGTGG + Intergenic
942686196 2:178534660-178534682 TTCAGGTGCATAGTATTCTGGGG + Exonic
948509939 2:238457452-238457474 TTCTAGTGCAGAGTGAGGTGGGG - Intergenic
1169103255 20:2970854-2970876 TTCTGATGCAGAGTGAGCTATGG + Intronic
1170130590 20:13014822-13014844 TTCCGGTCCATAATCAGTTGAGG + Intronic
1172992916 20:39049348-39049370 TTCTGGGTCACTGTCAGCTGAGG + Intergenic
1176217973 20:63957175-63957197 TGCTGGTGCAAAGGCAGGTGAGG - Exonic
1183177246 22:36233068-36233090 TTCTGGGGCTCACTCAGCTGTGG + Intronic
1183180583 22:36257469-36257491 TTCTGGGGCTCACTCAGCTGTGG - Intronic
1183712273 22:39512158-39512180 TTCTGGGGCTGAGGCAGCTGTGG + Intronic
950560476 3:13718597-13718619 TTCTGGTGCCTGGTCAGGTTGGG - Intergenic
951800770 3:26593579-26593601 TTTAGGTGCATACTCAGCAGAGG + Intergenic
952956516 3:38561094-38561116 TCCTGGTGCATGGACAGCTGGGG - Intronic
957027657 3:75202127-75202149 TTCTGTTGCACAGCCAGGTGTGG + Intergenic
960782323 3:121333099-121333121 TTCTGGTGCATATTGACCTTTGG - Intronic
962710308 3:138080693-138080715 TTCTGGCTCATACTCAGCTGGGG - Intronic
970230384 4:13904040-13904062 TAATGGTGCTTATTCAGCTGTGG + Intergenic
971226607 4:24759354-24759376 TGCTGGTAAATAGTCAGCAGTGG + Intergenic
971640146 4:29120830-29120852 TTCTGGGGCAGAGTCAGAGGAGG - Intergenic
973576457 4:52294607-52294629 TTCTGCTGCATAGCCAGGTTTGG + Intergenic
974066358 4:57081263-57081285 TTCTGGCCCATACTCAGCTATGG + Intronic
982023087 4:151223800-151223822 TTCTGATGCGTAGTCAGGTTGGG - Intronic
983364899 4:166774134-166774156 TGCTGGTGCAAAGTCAGGTAAGG + Intronic
985889521 5:2705046-2705068 TGCTGGTGCATAAACATCTGAGG - Intergenic
986459481 5:7955448-7955470 TTCTGATGCATAGCCATGTGTGG - Intergenic
987912094 5:24160919-24160941 TTATGGTGTATACTCAGCAGTGG - Intronic
989360716 5:40598379-40598401 TTCTGGGGAATAGTCAGCACTGG + Intergenic
991947722 5:71916044-71916066 TTCTGGTGCACAGTGGCCTGGGG - Intergenic
992152472 5:73918799-73918821 CTCTGATGCATAGCCAGCTAAGG - Intronic
997271356 5:132540956-132540978 TTATGGTGCAGGGTCAGGTGGGG + Intergenic
997634652 5:135396454-135396476 TCCTGGTGCGGAGTCAGGTGAGG - Intronic
1001345752 5:170896907-170896929 TTCTGGTGCATAGTCAGCTGGGG - Intronic
1002335187 5:178472498-178472520 TTCTGATGCACAGTCAGATATGG + Intronic
1002755540 6:156167-156189 TTCTGCTGGAGAGGCAGCTGGGG + Intergenic
1007162711 6:39805119-39805141 TTCTGGTGAAAATGCAGCTGTGG - Intronic
1008036824 6:46753794-46753816 TTCTGCTGCAAAATGAGCTGGGG - Exonic
1010690763 6:78908773-78908795 TGTTGGTGAAGAGTCAGCTGAGG - Intronic
1011504680 6:88028519-88028541 CTCTGCTCCATCGTCAGCTGTGG - Intergenic
1012221077 6:96650282-96650304 TTTTGGAGCTTAGTCAGATGTGG + Intergenic
1013209785 6:107976350-107976372 ATATGCTGCATAGGCAGCTGTGG + Intergenic
1013966221 6:115958946-115958968 TTCTTGTGCATAGTCTGATTTGG - Intronic
1017142190 6:151201218-151201240 TTCTGGTGCATATTCAAGTTTGG + Intergenic
1018067884 6:160136382-160136404 TTCTGGTGCAGATTCGTCTGGGG + Intronic
1022280145 7:28900014-28900036 TTCTGGGGCATGGTAGGCTGGGG - Intergenic
1023167637 7:37358555-37358577 TTCTGGGGCCTAGTTATCTGAGG + Intronic
1024701041 7:51904385-51904407 TTCTGGCTGATAGTCAACTGTGG - Intergenic
1027727246 7:81822997-81823019 TTCTGGTGGAAAGTCTCCTGAGG - Intergenic
1028018937 7:85746627-85746649 TACTGGTGCATATTCACCTTTGG - Intergenic
1031448232 7:121881352-121881374 CCCAGGTGCATAGTCAGCTTGGG - Intronic
1032302336 7:130699212-130699234 TTCTAGTGCTTAGACTGCTGAGG - Intergenic
1035336827 7:158134755-158134777 ACCCGGTGCATAGTCAGCAGAGG - Intronic
1035909070 8:3545630-3545652 TTCAGGTGCATCATCAGCGGTGG + Intronic
1036466985 8:9007660-9007682 TTCTAGTAAATAGTCAGCTGGGG + Intronic
1037555454 8:20017945-20017967 GTCTAGAGCATAGTGAGCTGGGG + Intergenic
1039119555 8:34130572-34130594 TTCTGGTGGGTAGTGGGCTGAGG - Intergenic
1039233292 8:35473154-35473176 TTCTCCTGCATTGTCAACTGAGG - Intronic
1039663159 8:39488971-39488993 TTCTGGTTCATAGTTATCTTGGG - Intergenic
1042748291 8:72131464-72131486 TTCTGGTGCTTTGTCATCTGGGG - Intergenic
1044732054 8:95236930-95236952 CTTTAGTGCATAGTCAGCTGTGG + Intergenic
1049930705 9:453865-453887 TCCTGGGGCATAGTCAACTTTGG - Intronic
1050151086 9:2620648-2620670 TTGAGGTGCATTGTCTGCTGTGG - Intergenic
1050529526 9:6576278-6576300 TCCTGGTTCATAGATAGCTGTGG + Intronic
1050741180 9:8822758-8822780 TTCTGTTCCATTGTCAGCTGCGG - Intronic
1055173341 9:73287695-73287717 ATCTGGTGCACAGCCAGGTGTGG + Intergenic
1056262547 9:84863090-84863112 TTCTGGTGCTTTGACATCTGGGG - Intronic
1057141964 9:92731871-92731893 TCCTGATGCACAGGCAGCTGGGG + Intronic
1057274789 9:93670510-93670532 TTCTGGTGCACAGACAGGTGAGG + Intronic
1057926590 9:99157320-99157342 TTTAGGTGCATAATGAGCTGAGG - Intergenic
1058580943 9:106456356-106456378 TTATAGTGAAAAGTCAGCTGTGG + Intergenic
1058893182 9:109378870-109378892 TTCAGGTGAATTTTCAGCTGAGG - Exonic
1188028142 X:25233229-25233251 TTAACGTGGATAGTCAGCTGCGG - Intergenic
1189165358 X:38855722-38855744 TTCTGTTGCATACAGAGCTGGGG + Intergenic
1194244979 X:91500050-91500072 TCCTGGTTCAGGGTCAGCTGGGG - Intergenic
1196169079 X:112567098-112567120 TTCTGGTAAATAGTCAGTAGTGG + Intergenic
1196722188 X:118864795-118864817 TTCTGGTCCTGGGTCAGCTGTGG + Intergenic
1198422172 X:136479158-136479180 ATCTGGTGCACAGGCAGGTGTGG - Intergenic
1199843013 X:151669894-151669916 TTCTGGTGTATACTCAGCAGTGG + Intronic
1200563954 Y:4741360-4741382 TCCTGGTTCAGGGTCAGCTGGGG - Intergenic