ID: 1001345753

View in Genome Browser
Species Human (GRCh38)
Location 5:170896908-170896930
Sequence ATTCTGGTGCATAGTCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 96}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1001345753_1001345761 4 Left 1001345753 5:170896908-170896930 CCCAGCTGACTATGCACCAGAAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1001345761 5:170896935-170896957 CAGTTGGTGGTCATACTGGTTGG 0: 1
1: 0
2: 0
3: 12
4: 97
1001345753_1001345758 0 Left 1001345753 5:170896908-170896930 CCCAGCTGACTATGCACCAGAAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG 0: 1
1: 0
2: 1
3: 5
4: 59
1001345753_1001345756 -9 Left 1001345753 5:170896908-170896930 CCCAGCTGACTATGCACCAGAAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1001345756 5:170896922-170896944 CACCAGAATGACCCAGTTGGTGG 0: 1
1: 0
2: 0
3: 8
4: 121
1001345753_1001345762 25 Left 1001345753 5:170896908-170896930 CCCAGCTGACTATGCACCAGAAT 0: 1
1: 0
2: 0
3: 8
4: 96
Right 1001345762 5:170896956-170896978 GGCCAGTGCGAAAACCAGATTGG 0: 1
1: 1
2: 5
3: 24
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1001345753 Original CRISPR ATTCTGGTGCATAGTCAGCT GGG (reversed) Intronic
902177818 1:14664525-14664547 ATTCTGATGCATAATCAGGTAGG - Intronic
902220606 1:14962182-14962204 TTTCTGGGGGATAGTCAGCTGGG - Intronic
902984579 1:20147941-20147963 ACTCTGGTGCATAGTAAAATTGG - Intronic
906748908 1:48241464-48241486 TTTCTGGTGCATGTTGAGCTGGG - Intronic
908171587 1:61510595-61510617 AGTCAGCTGCAGAGTCAGCTAGG + Intergenic
908435196 1:64098739-64098761 ATTCTGCCCCACAGTCAGCTGGG - Intronic
914801636 1:150966739-150966761 CTTCTGGTGAGTAGGCAGCTAGG - Exonic
916269499 1:162925056-162925078 ATTCTGAGGAATAGTCAGGTCGG - Intergenic
917095191 1:171392702-171392724 TTTCTGGTGCTGAGCCAGCTGGG - Intergenic
917772302 1:178292897-178292919 ATTCTGGTGTATAGGCAGCAAGG + Intronic
918831780 1:189407357-189407379 ATTCAGGTGAATAATCAGCATGG + Intergenic
924671728 1:246134509-246134531 ATTCTGAAGCATATTCTGCTAGG - Intronic
1063567262 10:7181593-7181615 AGTCTGCTGTAGAGTCAGCTTGG - Intronic
1064916786 10:20467059-20467081 ATTCTGGTGCAATGTCATTTGGG - Intergenic
1086877544 11:92114393-92114415 ATTCTGTTGCATATTGACCTGGG - Intergenic
1086919600 11:92571317-92571339 ATGCTGGGGCACAGGCAGCTAGG + Intronic
1092267729 12:6995755-6995777 ACTCTGTTGAGTAGTCAGCTGGG - Intronic
1099961329 12:89400050-89400072 ATTGTGGTACATAGCCAGCATGG + Intergenic
1103145866 12:118595362-118595384 ATCCTTGTGAATAGACAGCTGGG - Intergenic
1115329771 14:32184032-32184054 ATTCTAGTGAACAGACAGCTTGG + Intergenic
1115802602 14:37012042-37012064 GTTCTGTAGGATAGTCAGCTGGG + Intronic
1118929985 14:70232822-70232844 ACTCTGGTGCATAGGCTGCCAGG + Intergenic
1124706861 15:31973818-31973840 GTTCTGGTGCATCCTCTGCTTGG + Intergenic
1131308784 15:91269071-91269093 AGTATGGTCCACAGTCAGCTAGG + Intronic
1132319158 15:100912823-100912845 ATTCTGATGCATACTCAAGTTGG - Intronic
1134332229 16:13261531-13261553 ATTCTGGTGTTTCATCAGCTTGG - Intergenic
1137559630 16:49494379-49494401 ATTCTGGTGCCTGGTCCCCTTGG - Intronic
1138684004 16:58708662-58708684 ATTCTGATGCATAAACAGATGGG + Intronic
1146352137 17:32103772-32103794 CTACTGGGGCATAGTCAGCTGGG + Intergenic
1146556512 17:33829434-33829456 ATTGTTGTGGATAGTCACCTGGG + Intronic
1146611201 17:34306515-34306537 ATTCTGATTCATACTCAGTTTGG - Intergenic
1153803775 18:8694414-8694436 ATTCTGATTCATAGCCAGATTGG + Intergenic
1158296404 18:56001817-56001839 AACCTGCTGCACAGTCAGCTTGG - Intergenic
1158984156 18:62796662-62796684 TTCTTGGTGCATAGTCAGGTAGG + Intronic
1159641685 18:70870676-70870698 ATTCTGCTGCATTGTCAACGCGG + Intergenic
1161617087 19:5277324-5277346 ATTCTGCTGCATAGATAGCCTGG - Intronic
1166654364 19:44599375-44599397 ATTCTGGTCCACAGCCACCTGGG + Intergenic
1166792703 19:45407212-45407234 ATTCTGGGGCAAAGTCTGCAGGG - Exonic
925239475 2:2311226-2311248 ATTCTCATGCATTGTCAGCTTGG - Intronic
929240365 2:39647407-39647429 ATTCTGATGCTTTGACAGCTGGG - Intergenic
930388654 2:50731714-50731736 ATTTTGTTGCACAGTCACCTGGG - Intronic
931105777 2:59053639-59053661 ATTGTGGTTCATTTTCAGCTTGG + Intergenic
931367735 2:61633932-61633954 CTTCTAGTACATAGTCAGGTTGG + Intergenic
932958704 2:76386736-76386758 CTTCTGGTGCATATTCACATAGG + Intergenic
935610687 2:105021907-105021929 ATTTTGGTGCTTAGTTAACTCGG - Intergenic
936267402 2:111021125-111021147 ATTCTGGTGCAGAGGAGGCTGGG + Intronic
941004851 2:160237528-160237550 ATTCTAGTGCAGTGGCAGCTTGG - Intronic
948458231 2:238117109-238117131 AACCTGCAGCATAGTCAGCTGGG + Intronic
948574889 2:238943580-238943602 ATTCTTGTGCACGGTCAGTTTGG + Intergenic
1176358852 21:5975675-5975697 GTTCAGGTGCAATGTCAGCTGGG + Intergenic
1179764666 21:43562875-43562897 GTTCAGGTGCAATGTCAGCTGGG - Intronic
949355154 3:3172607-3172629 ATTCTGATGCATAGCAAGGTTGG + Intronic
950560477 3:13718598-13718620 TTTCTGGTGCCTGGTCAGGTTGG - Intergenic
952543322 3:34391519-34391541 AATGTGGTGCATAGACAGCATGG + Intergenic
952956517 3:38561095-38561117 TTCCTGGTGCATGGACAGCTGGG - Intronic
954288799 3:49638138-49638160 ATTCTGATGGAGAGCCAGCTTGG + Intronic
956200611 3:66701757-66701779 ATTCTGCTGCCTAGTCATCTGGG + Intergenic
961192561 3:124974304-124974326 ATTCTGATGCTTGGGCAGCTTGG - Intronic
962461709 3:135620370-135620392 ATTCTGGTGACCAGGCAGCTAGG - Intergenic
962710309 3:138080694-138080716 TTTCTGGCTCATACTCAGCTGGG - Intronic
963988041 3:151619861-151619883 AGTCTGTTGTATAGTCAGTTTGG + Intergenic
964800757 3:160554791-160554813 ATGCTGGTGCCTAGACAGCATGG + Intronic
966580982 3:181563035-181563057 ATTCTGTTGAAAAGTCAGCCTGG - Intergenic
970961845 4:21880722-21880744 ATTCTGGTGGATAGCCATCTAGG + Intronic
975540514 4:75505291-75505313 ATTCTGGTGCATGGCCTGTTAGG - Intronic
977451858 4:97208871-97208893 ATACTGGTGAATTGTCAGTTAGG + Intronic
982023088 4:151223801-151223823 ATTCTGATGCGTAGTCAGGTTGG - Intronic
991947723 5:71916045-71916067 ATTCTGGTGCACAGTGGCCTGGG - Intergenic
993358836 5:86947915-86947937 ATTCTGGTGAAAACTCAGATTGG - Intergenic
996301458 5:121991448-121991470 AGTCTGCTGCAAAGTCTGCTTGG - Intronic
997129205 5:131260214-131260236 ATTCTGCTGCATAATTAGTTAGG - Intronic
998360731 5:141584208-141584230 ATTCAGGTTCATATCCAGCTAGG + Exonic
1001345753 5:170896908-170896930 ATTCTGGTGCATAGTCAGCTGGG - Intronic
1007322484 6:41037687-41037709 AGGCTGGTGCATTGTCTGCTGGG - Intronic
1008084292 6:47228036-47228058 ATCCCAGTGTATAGTCAGCTTGG - Intergenic
1011261809 6:85477541-85477563 AGGCTGGTGCATAGTCTGATGGG + Intronic
1014839864 6:126206142-126206164 ATTCTTGTTCTTTGTCAGCTTGG + Intergenic
1021939836 7:25668587-25668609 TTTTTGGTTCATAGTCATCTGGG + Intergenic
1025010516 7:55394017-55394039 ATTGTGATGCATAGCCAGTTTGG - Intronic
1028210426 7:88067632-88067654 ATTCTGCTGCAAAGCCGGCTTGG + Intronic
1029184858 7:98731318-98731340 ATTATGGTGCTTAGTGAGCAAGG + Intergenic
1029482623 7:100822464-100822486 AGTCAGGTTCACAGTCAGCTGGG + Exonic
1030619246 7:111771356-111771378 ATTGTGGTCCAGAGGCAGCTGGG + Intronic
1031448234 7:121881353-121881375 TCCCAGGTGCATAGTCAGCTTGG - Intronic
1034248162 7:149665117-149665139 ATTCTGATGCAAAGTCAGACTGG - Intergenic
1036466984 8:9007659-9007681 TTTCTAGTAAATAGTCAGCTGGG + Intronic
1037555453 8:20017944-20017966 AGTCTAGAGCATAGTGAGCTGGG + Intergenic
1038441132 8:27571604-27571626 ATTCTGCTGCATAGCCAGGAGGG - Intergenic
1039663160 8:39488972-39488994 TTTCTGGTTCATAGTTATCTTGG - Intergenic
1039748588 8:40455990-40456012 GTGCTGGTGCCTAGTCTGCTGGG - Intergenic
1042748292 8:72131465-72131487 TTTCTGGTGCTTTGTCATCTGGG - Intergenic
1044446242 8:92280142-92280164 ATTCTTCTGGATAGGCAGCTGGG + Intergenic
1049438370 8:142598072-142598094 ACTCTGGAGCAGGGTCAGCTGGG - Intergenic
1049630345 8:143651203-143651225 AATCTGGTGCAGAAGCAGCTTGG - Exonic
1049847103 8:144808142-144808164 CTTCTGGTGCAGAGTGAGGTTGG - Exonic
1055639817 9:78310922-78310944 ATTCTGGTGAAAATTCTGCTGGG + Intronic
1056167303 9:83951831-83951853 ATTCTGGGGCACAGCCAGGTTGG + Intronic
1056262548 9:84863091-84863113 ATTCTGGTGCTTTGACATCTGGG - Intronic
1057320191 9:94005624-94005646 ATTCTGATGCATAGCAGGCTTGG - Intergenic
1058902017 9:109450320-109450342 ATTCTGGTTGAATGTCAGCTTGG - Intronic
1186174405 X:6909989-6910011 ATTCAGCTGCAAAGACAGCTTGG - Intergenic
1195067445 X:101250497-101250519 ATTCAGGTGCCCCGTCAGCTGGG + Exonic
1196754312 X:119144465-119144487 ATGCTGTAGCATAGACAGCTAGG + Intronic
1196906064 X:120436093-120436115 AACCTGATGCATAGTCAGTTAGG - Intronic
1199234774 X:145478811-145478833 TTTCTTTTGCATAGTCAGTTTGG + Intergenic